Báo cáo khoa học: Effects of juvenile hormone on 20-hydroxyecdysone-inducible EcR, HR3, E75 gene expression in imaginal wing cells of Plodia interpunctella lepidoptera ppt

Effects of juvenile hormone on 20-hydroxyecdysone-inducible EcR , HR3 , E75 gene expression in imaginal wing cells of Plodia interpunctella lepidoptera David Siaussat, Franc¸oise Bozzolan, Isabelle Queguiner, Patrick Porcheron and Ste ´ phane Debernard Laboratoire de Physiologie Cellulaire des Inverte ´ bre ´ s, Universite ´ Pierre et Marie Curie, Paris, France The IAL-PID2 cells derived from i maginal wing discs of the last larval instar of Plodia interpunctella were responsive to 20-hydroxyecdysone (20E). These imaginal cells respond to 20E by proliferative arrest followed by a morphological differentiation. These 20E-induced late responses were inhibited in presence o f j uvenile hormone (JH II). F rom these imaginal wing cells, we have cloned a cDNA s equence encoding a P. interpunctella ecdysone receptor-B1 isoform (PIEcR-B1). The amino a cid s equence o f P IEcR-B1 s howed a high d egree o f identity with EcR-B1 i soforms o f Bo mb yx mori, Ma nduca sexta and Choristoneura fumiferana.The pattern of PIEcR-B1 mRNA induction by 20E was char- acterized by a biphasic response with peaks at 2 h and 18 h. The p resence of the protein s ynthesis inhibitor anisomycin induced a slight reduction in level of PIEcR-B1 mRNA and prevented the subsequent declines observed in 20E-treated cells. T herefore , PIEcR-B1 mRNA was directly induced by 20E a nd its downregulation d epended on protein synthesi s. An exposure of i maginal wing cells to 20E in the presence of JH II caused an increased expression of Plodia E75-B and HR3 t ranscription factors but inhibited the second increase of PIEcR-B1 mRNA. These findings showed that in vitro JH II was able to prevent the 20E-induced differen tiation of imaginal wing cells. This effect could result from a JH II action on the 20E-indu ced genetic cascade through a modulation o f EcR-B1, E75-B and HR3 expression. Keywords: d ifferentiation; 20-hydroxyecdysone; i maginal wing cells; juvenile hormone; steroid hormone receptor superfamily. Postembryonic d evelopment of in sects is characterized by a growth phase which is punctuated by a series of larval molts. When the larva has attained its characteristic size, the metamorphic molt(s) is initiated to produce an adult. The larva carries sets of diploid i maginal cells which a re tucked away in its body and contribute little or nothing to the functioning of the larva [1]. The imaginal cells typically proliferate during the larval life and at metamorphosis differentiate into new adult o rgan to replace their larval counterpart. This strategy of early sequestration and formation of i maginal discs is typical for most imaginal structures of higher Diptera and for the wing discs of Lepidoptera [2]. This type of development depends on changes in hemolymphatic levels both of the steroid hormone 20-hydroxyecdysone (20E) and the sesquiterpe- noid juvenile hormone (JH II). The c ontemporary advances in insect endocrinology and tissue culture have led to widespread, even routine use, of organ cultures and cell lines for the investigation of hormonal action [3,4]. N evertheless, most in vitro studies over the ensuing three decades have focused on ecdyster- oids [5,6] while few experiments have been performed for JH II. The first effects of 20E have been reported on lepidopteran and dipteran imaginal discs cultured in vitro [7–9]. The mesothoraric wing discs of last larval instar of Plodia interpunctella respond to 20E by an evagination followed by a morphological differentiation and the synthesis of tanned cuticle [8] as described for cultured Drosophila melanogaster discs [9]. These diverse 20E- induced responses were inhibited in presence of JH II [10,11]. Therefore, these results suggested that in vitro JH II could counteract the 20E-induced differentiation of imaginals discs but the molecular basis of this action remained largely unknown. Most 20E-induced responses are mediated by a nuclear heterodimeric complex ec dysone receptor (EcR)/ultraspira- cle [12,13] w hich, when a ctivated by 20E, evokes t he sequential transcription of genes encoding proteins that ultimately direct the molt [14–16]. These genes were first characterized in D. melanogaster and identified as tran- scription factors such a s E75 [17], E74 [18], HR3 [19] and BRC [20]. In Manduca sexta, some studies have shown that JH II prevented the metamorphic switching of larval tissues such as the epidermis through a modulation of 20E-induced genetic cascade [21,22]. Correspondence to D. Siaussat, Laboratoire de Physiologie Cellulaire des Inverte ´ bre ´ s, Universite ´ Pierre et Marie Curie, 12 rue Cuvier, 75005 Paris,France.Fax:+330144276593,Tel.:+330144276509, E-mail: address: dsiaussat@free.fr Abbreviations: 20E, 20-hydroxyecdysone; ANS, anisomycin; DIG, digoxigenin; EcRE, ecdysone response element; JH II, juvenile hormone; PHR3, Plodia interpunctella hormone receptor 3; PIE75-B, Plodia interpunctella transcription factor E75-B isoform; PIEcR-B1, Plodia interpunctella ecdysone receptor-B1 isoform; UTR, untranslated region. Database: The nucleotide and a mi no acid sequence of PIEcR-B1, PIE75-B, PHR3 are deposited in G enBa nk under the accession numbers AY48 9269, AY566195, AY573570, respectively. (Received 1 April 2004, revised 13 May 2004, accepted 27 May 2004) Eur. J. Biochem. 271, 3017–3027 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04233.x Recently, the P. interpunctella HR3 and E75 transcrip- tion factors (PHR3, PIE75) were characte rized in the IAL- PID2 cell line established from mesothoracic wing discs [23,24]. PHR3 a nd PI E75 w ere identified as components of a 20E-induced genetic cascade associated w ith proliferative arrest, chitin precursor synthesis and long-term m orpholo- gical transformation o f IAL-PID2 cells. These c ellular events could be referred to as differentiative changes of imaginal wing cells. This 20E-responsive cell line seemed to be a n appropriate system in which to identify the molecular mechanisms by which JH I I could influence the 20E-induced differentiation of imaginal wing cells. We first tested the sensitivity of IAL-PID2 cells to JH II examining the effects of this hormone on 20E-induced late responses such as pro lifera- tive arrest and morphological differentiation. Using a 5¢/3 ¢ RACE/PCR-based strategy, we isolated a cDNA fragment encoding a putative P. interpunctella ecdysone receptor B 1- isoform (PIEcR-B1). Next, we s tudied the effects of JH II on 20E-induced genetic cascade reporting the indu ction patterns of PIE75-B isoform, PHR3 , PIEcR-B1 mRNAs by 20E in the presence of JH II. Our results brought evidence that in v itro JH II prevented the 20E-induced differentiation of imaginal wing cells. This effect could result from a JH II action on the 20E-ind uced genetic cascade through a modulation of PIE75-B, PIEcR-B1 and PHR3 expression. Materials and methods Cell culture The IAL-PID2 cell line was established from imaginal wing discs of final larval instar of P. interpunc tella Hu ¨ bner, the Indian meal-moth [25]. The cell line kept its sensitivity to 20E. Cells grow as a loosely attached monolayer. We maintained them at 26 °Cin75-cm 2 tissue culture fl asks with 12 mL antibiotic-free Grace’s medium (Gibco BRL) supplemented with 10% heat-inactivated foetal bovine serum (Boerhinger Mannheim) and 1% BSA ( Calbiochem). Cells were subcultured weekly to a near confluent mono- layer. Cells were rinsed off the bottom of t he flask in a gentle stream of culture medium and resuspended. Cell density was e stimated by counting the cells in an aliquot of the suspension in a Mallassez haemocytometer under the microscope. A ll the cultures were initiated by seeding flasks with 1.5 · 10 6 cells. JH I I and anisomycin (ANS) were from Scitech (Czech Republic) and Sigma, respectively; 20E was a gift from R. Lafont (UPMC, Paris, France). Stock solutions of JH II were prepared in dimethyl sulfoxide ( DMSO) and were stored at )20 °Cinglassvialscoatedwith1% polyethylene glycol 20 000 to decrease possible adsorptive loss [26]. All media containing JH II were just prepared before culture, then they were sonicated and thoroughly vortexed briefly. For use in culture, 20E and ANS dissolved in ethanol and JH II in dimethyl sulfoxide were diluted in appropriate volumes o f s terile Grace’s medium supplemen- ted w ith foetal bovine serum and BSA. Then, these solutions were added directly to cell cultures by using glass capillary pipettes. Final ethanol and dimethly sulfoxide concentra- tions in all t reatments and control cultures were maintained at less than 0.1% to prevent any t oxic effect of the solvent. JH II becomes insoluble in aqueous solution above 2 · 10 )5 M [27], t herefore the highest concentration used was 10 )6 M . Isolation of RNA and cDNA synthesis Total RNAs from cells w ere extracted with TRIzol reagent (Gibco, BRL) and quantified by spectrophotometry at 260 n m. The quality of RNA was checked by electrophor- esis on a formaldehyde/agarose gel (1%). U sing the first strand synthesis kit (Roche), 1 lg total RNA was reverse transcribed into single-stranded cDNA with AMV reverse transcriptase and Oligo-p(T) 15 as primer. For 5¢-and 3¢-RACE, cDNA was synthesized from 1 lgtotalRNA at 42 °C for 1.5 h using the SMART RACE cDNA Amplification kit (Clontech) with 200 U of Superscript II (GibcoBRL), 5¢-or3¢- CDS-primer and SMART II oligonucleotide, according to the instructions in the k it. PCR amplification and cloning Two degenerate DNA primers (ED1, ER1) were de signed on the basis of conserved amino acid sequences (KCQECRL and VEFAKGL) from the DNA and ligand binding regions of D . melanogaster, Bombyx mori, Tenebrio molitor, Choristoneura f umiferana and M. sexta ecdysone receptors (EcRs). PCR was carried out in 100 lL final volume including 10 m M KCl, 6 m M ammonium sulfate, 20 m M Tris/HCl, pH 8, 2.5 m M MgCl 2 with 2.5 U High Expand Fidelity DNA polymerase (Boerhinger Mannheim) and 25% of the cDNA pro duced by reverse transcription o f the total RNAs. The degenerate primers ED1 5¢-forward primer (5¢-AARTGYCARGARTGYMGNYT-3¢), ER1 5¢-reverse primer (5¢-CARNCCYTTNGCRAAYTCNAC-3¢) at 1 l M and each dNTP at 0.8 m M were then added. Following an initial 5 min denaturation at 94 °C, the thermal amplification procedure included 5 cycles of denaturation 1 m in at 94 °C, annealing at 55 °Cfor 1minandanelongationat72°C for 1 min. The reaction was repeated for 30 cycles with an annealing t emperature of 45 °C. The blunt-ended PCR product was purified by agarose gel electrophoresis and cloned with Stratagene’s pCR-Script TM SK(+) cloning kit following the manufac- turer’s instructions. After colony isolatio n, DNA m inipreps were prepared and correct insertion was determined by restriction e nzyme a nalysis. The DNA clone containing the proper insert was se quenced by the dideoxy chain termin- ation method [28] (Genome Express, Grenoble, France). One 477-bp RT/PCR product w as isolated and s equenced. Rapid amplification of cDNA 5¢/3¢-terminal ends (5¢/3¢-RACE) The 5¢-and3¢-regions of the corresponding cDNA were obtained by 5¢-and3¢-RACE(SMARTRACEcDNA amplification kit) following the manufacturer’s instructions. For 5¢-RACE, we used 2 lLof5¢-RACE-ready cDNA with a s pecific reverse primer 5¢-Race PIX (5¢-CCTGGC G GCCTCTGGTGGTGGCGG-3¢) and Universal primer Mix (UPM, Clontech) as the forward anchor primer. The 3¢-RACE amplification was carried out with UPM as the reverse primer and a specific forward primer 3018 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004 3¢-Race PIY (5-¢GCGGGGCTCGTGTGGTACCAG GACG-3¢). Touchdown PCR was performed using hot start as follows: after 1 min at 94 °C, five cycles of 30 s at 94 °C and 5 min at 72 °C, then five cycles of 30 s at 94 °C, 30 s at 70 °Cand3minat72°C, then 25 cycles of 30 s at 94 °C, 30 s at 68 °C and 5 min at 72 °C, then 7 m in at 72 °C. The PCR products were purified and cloned as described above. By merging the overlapping sequences obtained from the 5¢-and3¢-RACE, a 6081-bp cDNA fragment was generated and n amed PIEcR. Generation of DIG -labelled probe PIEcR cDNA was digoxigenin (DIG)-labelled by PCR using the PCR DIG probe synthesis kit (Roche) w ith a pair of specific primers CED 5¢-forward primer (5¢-CGCTGGTCCAACAACGGAGGG-3¢), CER 5 ¢-reverse primer (5¢-TGCCGGTGACAACTCCTCACG-3¢). The DIG-labelled probe was used at a concentration of 25 ngÆmL )1 in hybridization solution. Northern blotting Northern blot hybridization analysis was performed according t o the manufacturer’s instructions. RNA sam- ples (15 lg) were denatured with formamide (50%) a nd formaldehyde (2.2 M ), separated on 1% denaturating agarose gel and transferred to a Boerhinger Mannheim positively charged nylon membrane. Blotted RNA was hybridized overnight at 55 °C with the PIEcR-B1 probe, at 42 °CwithPHR3probeandat45°C w ith PIE75-B specific probe located in the N-terminal region of A/B domain. A DIG-labelled fragment o f the cDNA encoding the RpL8 ribosomal protein of P. interpunctella was used as control probe. An immunological signal detection by cheluminescence was performed as described in Roche’s DIG system User’s Guide for filter hybridization. A molecular RNA ma rker ladder DIG-labelled (Roche) was runinparalleltodeterminethemolecularmassof bybridizing RNAs. Results Effects of JH II on 20E-induced late responses in IAL-PID2 cells We first tested the sensitivity of cells to JH II by studying the effects of this hormone on the 20E-induced late responses such as proliferative arrest and m orphological differenti- ation of IAL-P ID2 cells. Proliferative arrest. The I AL-PID2 cells were seeded at 1.5 · 10 6 per flask and cultured under normal growth conditions for 36 h, in our model this period of time corresponded to t he population doubling t ime [29,30]. Cells were then treated with only 20E at 10 )7 M or in combination with JH II at various concentrations for 36 h. At the end of treatment, the c ell density w as evaluated . Fig. 1 indicates that 20E alone induced a striking decrease of cell p rolifer- ation. By contrast, in combination with JH II at 10 )6 or 10 )7 M , cells grew at almost the normal rate. Intermediate levels of cell proliferation were attained at 5 · 10 )8 ,10 )8 and 10 )9 M JH II. We checked that 0.1% ethanol or dimethly sulfoxide or JH II at 10 )6 M alone had no effect on cell growth (Fig. 1). Morphological changes. After 48 h of 20E treatment at 10 )7 M , the tr eated cultures (Fig. 2C) appeared t o b e m uch less dense than control cultures (Fig. 2A). The cells were elongated and aggregated, often producing long processes which formed connections between different aggregates (Fig. 2 C). I n c ombination with JH II at 5 · 10 )8 ,10 )8 and 10 )9 M , the cultures were always composed of pseudo- epithelial aggregate structures (Fig. 2F, G and H). How- ever, we noted an increase in the size of aggregate s that w as related to an increase in cell density as compared to cultures treated by 20E alone (Fig. 2 C). At the highest concentra- tions of JH II (10 )6 ,10 )7 M ), the cultures did not show any cell aggregation, or cell cytoplasmic extensions and the cell density was slightly lower than in the control cultures (Fig. 2 D and E). In the presence of JH II alone at 10 )6 M , the shape and the distribution of the cells in culture were similar to t hose of control cultures (Fig. 2B). T hese results showed that JH II was able to inhibit efficien tly the effects of 20E both on cell proliferation and morphological changes of IAL-PID2 cells. Isolation and characterization of P. interpunctella EcR-B1 mRNA Cloning of a PIEcR cDNA frament. We wondered whether the inhibitory effect of JH II could imply an action of this hormone on molecular events which occur very early in the cellular re sponse t o 20E. Therefore, we examined the effects o f JH II o n the 20E-induced genetic cascade and decided to clone a P. interpunc tella ecdysone receptor. Usinga5¢/3¢-RACE/PCR-based strategy, a 6081-bp cDNA fragment was gener ated and named PIEcR (Fig. 3). The 3¢-untranslated region (3¢UTR) is long (4074 bp) and two putative polyadenylation signals are present (Fig. 3). The Fig. 1. Effect of 20E and JH II on the proliferation of IAL-PID2 cells. The IAL-PID2 cells were seeded at 1.5 · 10 6 per flask and cultured under normal gro wth conditions f or 36 h. Cells were th en grown f or 36 h in Grace’s medium containing no ho rmone or only 20E at 10 )7 M or in combinat ion with JH II at various concentrations. At the end of treatment, the c ell density was e valuated. Ó FEBS 2004 Effects of JH II on 20E-inducible EcR, HR3, E75 genes (Eur. J. Biochem. 271) 3019 ORF which starts from AUG consistent with the transla- tion start consensus sequences among general eukaryotes [31] and D. melanogaster [32] encodes 541 amino acids, predicting a 62-kDa protein. This ORF includes five domains (A/B, C, D , E, F ) that a re characteristic members of the steroid hormone nuclear receptor superfamily (Fig. 3 ). Sequence comparison. Ahighdegreeofaminoacid identity with C. fumiferana EcR (CfEcR) [33], M. sexta EcR (MsEcR) [34,35], B. mori EcR (BmEcR) [36,37], T. molitor EcR (TmEcR) [38] and D. melanogaster EcR (DmEcR) [12,39] was observed in both the DNA binding region (C region) and t he ligand b inding domain (E region) of PIEcR (Table 1 ). Therefore, PIEcR was a member of the Fig. 2. Effect of 20E and J H I I on t he morphology of IAL-PID2 c ells. IAL-PID2 c ells were grown for 48 h in Grace’s m edium containing 0.1% ethanol (A) o r 10 )6 M JH II (B) o r 10 )7 M 20E (C) or 10 )7 M 20E in combination with J H I I at v arious concentrations 1 0 )6 M (D), 10 )7 M (E), 5 · 10 )8 M (F), 10 )8 M (G) and 10 )9 M (H). Each panel shows the representative area of three replicates. The bar in A represents 40 lminA,B,C, D, E, F, G and H. 3020 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004 steroid hormone nuclear receptor superfamily and was clearly assigned to the EcR subfamily. EcR exists in different isoforms ) Ec R-A, EcR-B1 an d EcR-B2 [39]. All three share common DNA- and ligand- binding domains, but each has its own isoform-specific segment in the N-terminal region of A/B domain which contains a transactivating domain [40]. The predicted sequence of A/B domain of PIEcR exhibited significant amino acid identities w ith the corresponding r egion of B1 isoform of other insect EcRs, d espite differences in the domain length (Fig. 4). Overall in the A/B region, there was 91, 87, 82, 52, and 42% amino acid identity based on t he Plodia sequence with CfEcR-B1, BmEcR-B1, M sEcR-B1, DmEcR-B1, and TmEcR-B1, respectively (Fig. 4). The strongest s imilarities were confined to the two ends of the B1 isoform s pecific segment in the N-terminal region (Fig. 4). There was no similarity to the N-terminal specific regions of either the A or the B2 isoform (data not shown). All of these results indicate that PIEcR is a B1 type isoform. Effect of 20E and anisomycin on induction of PIEcR-B1 mRNA. Using a PIEcR-B1 specific probe located in the N-terminal region of A/B domain, the Northern blot hybridization on total RNAs revealed a 6-kb transcript whose expression level was higher i n presence of 20E. T he size of this transcript is in agreement with the le ngth of the corresponding cDNA. This 20E-induced transcript could thus encode a putative P. interpunctella ecdysone receptor- B1 isoform (PIEcR-B1). To analyse how the expression of PIEcR-B1 is regulated by 20E, IAL-PID2 cells were cultured in Grace’s medium containing 20E at 10 )7 M for different c ontinuous time exposures. I n the absence of 20E, Fig. 3. Nucleotide and deduced amino acid sequences o f PIEcR. Nucleotide numbers are givenontheleftandtheaminoacidnumbers on the r ight. Letters in the r ight margin des- ignate d omains. The DNA binding domain (C region) is underlined and the ligand binding domain (E region) is u nderlined with dashes. The helix–turn–zipper motif is do uble-un der- lined a nd two p olyadenylation signals in the 3¢UTR a re designed in bold type. D egen erate primers(ED1)and(ER1)(showninboldtype) were used to generate a cDNA fragment of 477 b p by RT/PCR. The PIX and PIY pri- mers used for t h e 5¢/3¢)RACE are s hown in italic and b old type. The PIEcR-B1 specific probe was ge nerate d by PCR wit h the two primers, CED and CER, shown in italic type. Ó FEBS 2004 Effects of JH II on 20E-inducible EcR, HR3, E75 genes (Eur. J. Biochem. 271) 3021 PIEcR-B1 was c onstitutively expressed a t low level over time (data n ot shown). B y contrast, the pattern of PIEcR- B1 mRNA induction by 20E was characterized by a biphasic r esponse w ith p eaks at 2 h and 1 8 h (Fig. 5A). To define the minimal concentration of 20E required for an induction of PIEcR-B1 mRNA, IAL-PID2 cells were exposed to various concentrations of 20E for 18 h. As shown in F ig. 5B, a significant indu ction of PIEcR-B1 mRNA was first observed at 10 )7 M 20E with an increase up to 10 )5 M . To determine whether 20E directly initiated the tran- scription of PIEcR-B1, we stud ied t he effects of protein synthesis inhibitor, ANS on the induction of PIEcR-B1 mRNA. The IAL-PID2 cells were cultured in Grace’s medium containing 20E (10 )7 M )withANS(5lgÆmL )1 )for different c ontinuous time exposures. Under these culture conditions, the presence of ANS caused 9 4% inhibition of protein synthesis (n ¼ 4) and the cells remained viable even 24 h after A NS removal (data not shown). The Fig. 6 shows that ANS caused a slight reduction in the level of PIEcR-B1 mRNA within the first 2 h but neither completely prevented the initial increase induced by 20E. This observation suggested that the majority of the induction of PIEcR-B1 mRNA by 20E w as independent from protein synthesis and thus p robably due to direct action of 20E on the PIEcR-B1 gene. The most su rprising result was that the o bserved declines in the level of PIEcR-B1 mRNA did not occur in the presence of ANS, suggesting that a 20E-induced protein(s) synthesis was involved in these decreases. Regulation of 20E-induced PIEcR-B1 , PIE75-B , PHR3 transcripts by JH II The Plodia HR3 and E75 transcription factors have been identified recently as putative ÔactorsÕ of a 20E-induced genetic cascade leading t o the inhibition of cell proliferation and long-term morphological changes of I AL-PID2 cells [23,24,41]. To examine the effects of J H II on this genetic cascade, IAL-PID2 cells were cultured in Grace’s medium containing bo th 20E at 10 )7 M and JH II at 1 0 )7 M for different continuous time exposures. The induction patterns of PIE75-B, PHR3, PIEcR-B1 mRNAs were determined under these experimental conditions. We remarked that in presence of JH II alone at 10 )7 M or in absence of hormone, PIE75-B and PIEcR-B1 were constitutively expressed at a low level over time (Fig. 7A and C) whereas PHR3 mRNA was never detectable (Fig. 7 B). In the presence of 20E alone, PHR3 mRNA was d etectable at 2 h, reached a maximum by 8 h a nd then declined (Fig. 7B) whereas PIE75-B mRNA was already highly induced after 1 h, rapidly disappeared by 2 h , then peaked again at 8 h and was maintained at a high level (Fig. 7 C). In c ombination with JH II, PHR3 and PIE75-B transcripts showed temporal patterns similar to those obtained in response to 20E alone. Furthermore, the presence of JH II induced an increase in induction level of these two transcripts (Fig. 7B and C). We also noticed that the overexpression of PIE75-B occurred only within t he first 4hwhereasthatofPHR3 was maintained during the 32-h culture period. As concerns PIEcR-B1, JH II had no effe ct Table 1. Comparison of amino acid sequences of C and E regions between PIEcR and homologs. D. melanogaster EcR (Dm EcR [12]), B. mori EcR (BmEcR [37]), M. sexta EcR (MsEcR [35]), C. fumiferana EcR (CfEcR- [33]), and T. molitor EcR (TmEcR [38]). Indicated are the lengths of C and E regions of the EcR nuclear rec eptors (number o f amino acids) and the identity vs. PIEcR expressed as percentage of the PIEcR sequence. C region E region Identity (%) Length (amino acids) Identity (%) Length (amino acids) PiECR 100 66 100 222 BmEcR 98 66 87 218 CfEcR 98 66 88 222 MsEcR 98 66 91 222 TmEcR 88 66 66 218 DmEcR 94 66 71 220 Fig. 4. Alignment of the amino a cid sequence of A/B region of PIEcR with D. melanogaster EcR-B1 (DmEcR-B1 [12]), B. mori EcR-B1 (BmEcR-B1 [37]), M. sexta EcR-B1 (MsEcR-B1 [35]), C. fumiferana EcR-B1 (CfEcR-B1 [33]), and T. molitor EcR-B1 (TmEcR-B1 [38]). Gaps are in troduced to optimize alignm ent. Aste risks indicate identical residu es and dots indicate co nservative su bstitutions. Multiple sequence a lignment was performed using CLUSTAL [58]. 3022 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004 on the i nitial 20E-induced increase of PIEcR-B1 mRNA whereas it prevented the second increase (Fig. 7A). To determine the effectiveness of JH II, we cultured IAL-PID2 cells with 10 )7 M 20E alone and in combination with JH II at various concentrations. Based on the times required for the maximum inductio n of mRNAs, the l evel of PIE75-B, PHR3 and PIEcR-B1 mRNAs was assessed after 1, 8 and 18 h exposure, respectively. Fig. 8B and C show that after 1 h a nd 8 h exposure to 20E, the amount of accumulated PIE75-B and PHR3 mRNAs increased in parallel with concentration of JH II up to 10 )6 M . Thus, the suppressive effect of JH II on the second 20E-induced increase in PIEcR-B1 mRNA was also concentration- dependent when assayed after 18 h exposure to 20E (Fig. 8 A). These results indicated that the effects of JH II on PHR3, PIEcR-B1, PIE75-B mRNAs induction by 20E were both dependent on the amount o f J H II present and significant from 10 )8 M JH II. Finally, all of th ese results demonstrated that JH II acts on the 20E-induced genetic cascade by differential modu- lating of the expression of PIEcR-B1, PIE75-B and PHR 3. Discussion Our main objective w as to identify some specific molecular mechanisms through which in vitro JH II was able to Fig. 6. Effect of anisomycin o n PIEc R-B1 mRNA ind uction. Fifteen micrograms of total RNAs from I AL-PID2 cells cultured in Grace’s medium with 20E at 10 )7 M or with 10 )7 M 20E a nd 5 lgÆmL )1 aniso- mycin for various t imes of exposure were analysed by Northern blots andhybridizedwithPIEcR-B1probe.mRNAlevelsofPIEcR-B1 are shown a s percentage of its mRNA level in IAL-PID2 cells cultured with 10 )7 M 20E for 18 h. Points are means ± SD (n ¼ 5–11). Fig. 7. Effect of 20E an d J H II on induct ion of PIE 75-B, PHR3 and PIEcR-B1 mRNA. Fifteen micrograms of total RNAs from IAL-PID2 cells cultured in Grace’s medium with 20E at 10 )7 M alone or in combina tio n with 10 )7 M JH II for various times were analysed by Northern blots hybridized with PIEcR-B1 (A), PHR3 (B) or PIE75- B (C) probes. Levels of the m RNAs of PIE 75-B, PHR3 and PIEcR-B1 are shown as percentages of their respective mRNA levels in IAL- PID2 cells cultured with 10 )7 M 20E for 1 h, 8 h and 18 h. Points are means ± SD (n ¼ 5–14). Fig. 5. Induction of PIEcR-B1 mRNA by 20E. Fifteen micrograms of total R NAs from IAL-PID2 c ells cultured in Grace’s medium with 20E at 10 )7 M for various times of exposure (A) or with 20E for 18 h at different c oncentrations (B) were separated on agarose (1%) formal- dehyde gel, transferred to nylon membrane and hybridized with PIEcR-B1 probe. A f ragment of the cDNA encoding the RpL8 ribo- somal protein of P. int erpuntella was used as c on trol probe. Ó FEBS 2004 Effects of JH II on 20E-inducible EcR, HR3, E75 genes (Eur. J. Biochem. 271) 3023 counteract 20E-induced differentiation of imaginal discs. To accomplish t his w ork, we used a 20E responsive IAL-PID2 cell line established from mesothoracic imaginal wing discs isolated at the last larval instar of P. interpunctella lepidop- tera [25]. These imaginal cells respond to 20E at 10 )7 M by an arrest of cell proliferation and long-term m orphological changes marked b y the formation of pseudoepithelial aggregates structures. These 20E-induced late responses of IAL-PID2 cells resemble, in general terms, the metamorphic transformation of many different imaginal cell types in D. melanogaster and other holometabolous insects [42,43]. A10 )7 M concentration of 20E was both close to physio- logical levels of 20E (in the order of 10 )7 to 10 )6 M [44] or 2 · 10 )8 to 6 · 10 )6 M [45]) a nd sufficient t o induce in vitro eversion and differentiation of imaginal discs [9,46]. First, we tested the sensitivity of IAL-PID2 cel ls to JH II a nd showed that in combination with 20E, JH II inhibited significantly the 20E-induced late responses from 10 )8 M as already reported in D. melanogaster Kc cells [44]. This concentration of JH II was close to physiological levels which were estimated at 4 · 10 )9 to 2 · 10 )7 M [45]. To examine the effects of JH II on the 20E-induced genetic cascade, we first cloned a 6081-bp cDNA encoding a putative P. interpunctella ecdysone receptor named PIEcR. The deduced amino acid sequence of PIEcR was most highly similar to those of EcR proteins from other lepidopterans, M. sexta [34,35], C. fumiferana [33] and B. mori [36,37]. The highest identity was located in the C and E domains. The C domain was identical i n length (66 aminoacids)toDmEcR,CfEcR,MsEcR,TmEcR,BmEcR and has two C ys2–Cys2 type zinc finger motifs that serve as interfaces in both DNA–protein and p rotein–protein inter- actions [47]. The E domain is known to be involved i n ligand binding, transcriptional activation (or repression), nuclear translocation a nd dimerization [48]. It h as been demonstra- ted that EcR needs to form a heterodimer with the ultraspiracle p rotein for binding to the EcRE sequence and transactivation [13]. The helix–turn–zipper motif which seems to be essential for receptor dimerization [49] is present in PIEcR (Fig. 3). PiEcR had significant amino acid identities (especially with the B1 i soform) o f other insect EcRs and a strong degree of identity was confined to the two ends of N-terminal region of the A/B domain. Using a B1 isoform-specific probe from the A/B region of PIEcR, we detected by Northern hybridization one transcript of 6 kb, closeinsizetothoseofDmEcR-B1 (6 .8 kb), MsEcR-B1 (6 kb), CfEcR-B1 (6 kb), BmEcR-B1 (6.2 kb) and TmEcR- B1 (6.5 kb) mRNAs. This result revealed the expression of ecdysone receptor B1 isoform in imaginal wing cells of P. inte rpunctella at the last larval instar. In the fifth larval instar of M. sexta, i t has been reported in vitro that 20E i nduced a c oexpression of MsEcR-B1 and MsEcR-A during t he metamorphic s witching of abdominal epidermis. The two isoforms were directly upregulated by 20E but differed in their responsiveness to 20E and to protein synthesis inhibitor s [34]. The pattern of PIEcR-B1 mRNA induction by 20E showed a biphasic response which was similar t o that o f MsEcR-B1 mRNA. Inhibition of protein synthesis slowed the rapid accumulation of PIEcR-B1 mRNA and prevented its subsequent decline. This result agrees with the effects of anisomycin on the induction of MsEcR-B1 mRNA by 20E. Therefore, during the differen- tiation of imaginal wing cells, the expression of PIEcR-B1 was regulated both by 20E and 20E-induced protein(s), presumably transcription factors in the same manner as MsEcR-B1 at the time of metamorphic switching of abdominal epidermis. Some developmental studies have shown that EcR isoforms are expressed in a tissue- and stage-specific manner, thus contributing to the spatial and temporal diversity of the response t o 20E [33,34,37–39,50,51]. Our study revealed that EcR-B1 seemed to be the single form associated with 20E-induced morphological changes of imaginal wing cells of Plodia. Using a probe common to all EcR isoforms, we succeeded to detect a second 20E- inducible transcript whose e xpression level was much lower Fig. 8. Concentration–respons e curves for the effectiveness of JH II. IAL-PID2 cells cultured in Grace’s medium with 10 )7 M 20E alo ne or in combination with J H II a t various concentrations and the levels of expression of PIE75-B, PHR3 and PIEcR-B1 were a ssessed b y N or- thern blotting after 1, 8 and 18 h exposure, respectively. mRNA levels of PIE75-B, PHR3 an d PIEcR-B1 are shown as percentages of the ir respective mRNA levels in IAL-PID2 cells c ultured with 10 )7 M 20E for 1 , 8 and 18 h. Points a re means ± SD (n ¼ 7–13). 3024 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004 than that of PIEcR-B1 mRNA (data not shown). If this transcript is the Plodia EcR-A isoform, then Plodia imaginal discs would be similar t o t hose o f Manduca during the pupal predifferentiative phase necessary for eversion and cuticle synthesis [34]. In several holometabolous insects, at t he end of last instar larvae, i maginal discs are characterized by a high proportion of cells blocked in the G 2 phase in response to the rising ecdysteroid titre prior to pupation [52,53]. In IAL-PID2 imaginal cells, recent works have shown that the G 2 arrest is associated with high induction of PHR3 mRNA and a decrease in the expression level of A and B cyclins which occurred after 8 h of 20E continuous treatment [41]. We noticed that the induction of PIEcR-B1, PIE75-B, PHR3 mRNAsby20Ewasenhancedasearlyas2hof20E exposure an d thus prior to the inhibition of A and B cyclin expression. According to all these d ata, we suggest that 2 0E could i nitiate a genetic cascade involving EcR-B1, HR3, E75-B to regulate the expression of cyclins and ultimately the G 2 /M transition. Some RNA interference experiments are in progress to identify the sequence of the molecular events linking the 20E action with proliferative arrest. It has been reported that in combination with 20E, JH II was able to increase the induction level o f PHR3 mRNA, restore the expression of A and B cyclins a nd consequently prevent G 2 arrest [41]. Our study confirmed the effect of JH II on the 20E inducibility of P HR3 and re vealed that this hormone also modulated the induction level of PIEcR-B1 and PIE75- B mR NAs. This action of JH II provided an argument for the existence of a strong correlation between the 20E-induced genetic cascade, c yclins and proliferative arrest. JH II had no e ffect on th e initial 20E-induced increase in PIEcR-B1 mRNA whereas it p revented the second increase. This result was agreement with that obtained on EcR homologous gene in the M. se xta epidermis. In this tissue, JH II prevented the 20E-induced metamorphic switching b y regulating the induction of EcR by 20E [21,22]. On the other hand, our study demonstrated that JH II increased the level of PIE75-B without modifying its induction pattern by 20E. This JH II effect was similar to that reported on the 20E inducibility of the E75-A isoform in the cultured silk gland of Galleria mellonella and in M. sexta epidermis [21,22,54]. The JH II effects on 20E-induced PHR3, PIE75-B, PIEcR- B1 mRNAs were concentration dependent and significant at 10 )8 M . This JH II concentration was identical to that found in the hemolymph at the onset of the fi fth larval molt of M. sexta [55]. Molecular data f rom Manduca wing discs have demon- strated that B R-C transcription factor plays a key role for their differentiation and that its expression is clearly controlled by JH II [56]. Therefore, in order to complete our work, some experiments are in progress to characterize a Plodia BR-C and then t o examine the effects of JH II on its induction pattern by 20E in our IAL-PID2 imaginal wing cells. The i ncreased amounts of both PIE75-B and PHR3 mRNAs by JH II were most probably due to an increased transcription rate. One possible action of JH II is to stabilize the open chromatin structure of the PIE75-B and PHR3 promoters around the ecdysone respon se element (EcRE) so that 20E can readily access t he binding site of EcR and thus induce an increase in transcription level. Our studies, however, have not ruled out a possible additional e ffect of JH II on increasing the stability of HR3 and E75-B mRNAs. We noticed that JH II had no early effect on the response of PIEcR-B1 while it regulated quantitative ly t he level of PIE75-B and PHR3 mRNAs induced by 20E. These results suggested that the later effect of JH II on the expression pattern of PIEcR-B1 could be due to differences in induction level of PIE75-B and PHR3 mRNAs by 20E in the presence of JH II or to some other factors not yet identified. It has been suggested that HR 3 genes are candidates for the feedback repression of EcR [57]. In M. sexta and D. melanogaster, some studies have shown that DmEcR and MsEcR were rep ressed when DmHR3 and MsHR3 beguntobehighlyexpressed[33,51].Sucha correlation was fo und in our IAL-PID2 cells for the expression of PIEcR-B1 and PHR3.Therefore,inthe presence of JH II, the increased accumulation of PH R3 mRNA could inhibit the second increase in PIEcR-B1 mRNA and block the 20E-induced molecular cascade leading to proliferative a rrest and morphological differen- tiation of IAL-PID2 cells. This second rise in EcR-B1 mRNA seen in response to 10 )7 M 20E in vitro is probably required for the differentiative cellular c hanges of lepidopteran wing discs. Finally, we demonstrated that in vitro JH II was a ble to prevent the 20E-induced differentiation o f imaginal wing cells. In addition, for the fi rst time, our study revealed that JH II also modulates differently the 20E inducibility o f EcR-B1 and E75-B isoforms in imaginal cells. This JH II effect on 20E-induced genetic cascade could be associated with its action in prevention of differentiative program of imaginal wing discs at the onset of metamorphosis. References 1. Cohen, S. (1993) Imaginal Discs Development. Cold Spring Harbor Press, Cold Spring Harbor, N Y. 9, 74 7–841. 2. Oberlander, H. (1985) The imaginal discs. Comp. I nse ct P hys iol. Biochem. Phar macol. 2, 151–182. 3. Oberlander, H. & Ferkovich, S.M. (1994) Physiological and developmental capacities of insect cell lines. In Insect Cell Biotechnology (Maramorosch,K.&McIntosh,A.H.,eds),pp. 129–140. CRC Press, Boca Raton. 4. Lynn,D.E.,Oberlander,H.&Porcheron, P. (19 88) Tissues and cells in culture. In Microsocopy Anatomy of Invertebrates (Locke, M., ed.), 11C, 1 1 19–1141. Wiley-Liss Inc, New Yor k. 5. Oberlander, H. (1983) Imaginal disks. In Endocrinology of Insects. (Downs, R.G.H and Laufer, H., e ds), pp. 503–507. A lan R. Liss, New York. 6. Dinan, L., Spindler-Barth, M. & Spindler, K D. (1990) Insect cell lines a s tools for studying ecdysteroid action. I nverte brate Reprod. Dev. 18 , 43–53. 7. Oberlander, H. & Fulco, L. (1967) Growth and partial meta- morphosis of imaginal disks of the Greater Wax Mo th Galleria mellonella in v itro. Nature 216, 1 140–1141. 8. Silhacek, D.L., Oberlander, H. & Porcheron, P. (1990) Action of RH 5849, a non-steroidal ecdysteroid mimic, on Plodia inter- punctella (H u ¨ bner) in vivo and in vit ro. Arch. Insect Biochem. Physiol. 15 , 201–212. 9. Milner, M.J. & Sang, J.H. (1974) Relative activities of a-ecdysone and b-ecdysone for the differentiation in vitro of Drosophila melanogaster imaginal discs. Cell 3, 141 –143. Ó FEBS 2004 Effects of JH II on 20E-inducible EcR, HR3, E75 genes (Eur. J. Biochem. 271) 3025 10. Oberlander, H. & Tomblin, C. (1972) Cuticule deposition in imaginal d isks: effects of juvenile hormone and fat body in vitro. Science 177, 441–442. 11. Chihara, C.J., Petri, W.H., Fristrom , J.W. & King, D.S. (1972) The assay of ecdysones and juvenile hormones on Drosophila imaginal d iscs in vitro . J. Insect Phys iol. 18, 1115–1123. 12. Koelle, M.R., Talbot, W.S., Segraves, W.A., Bender, M.T., Cherbas, P. & Hogness, D.S. (1991) The Drosophila EcR gen e encodes a n ecdysone recep tor, a new member of the s tero id receptor superfamily. Cell 67, 5 9–77. 13. Yao, T.P., Segraves, W.A., Oro, A.E., McKeown, M. & E vans, R.M. (1992) Drosophila ultrasp iracle modulates ecdysone receptor function via heterodimer formation. Cell 71 , 63–72. 14. Andres, A.J. & T hummel, C.S. (1992) Hormones, puffs and flies: The molecular control of metamorphosis by ecdysone. Trends Genet. 8, 132–138. 15. Thummel, C.S. (1995) From embryogenesis to metamorphosis: The re gulation and function of Drosophila nuclear receptor superfamily members. Cell. 83, 871–877. 16. Cherbas, P. & Cherbas, L. (1996) Molecular aspects of ecdysteroid hormone action. In Metamorphosis: Postembryonic Reprogramming of Gene Exp ression in Amphibian and Insect Cells (Gilbert, L.I., Tata, J.R. & Atkinson, B.G ., eds), pp. 175 –221. Aca demy Press, San Diego. 17. Segraves, W.A. & H ogness, D.S. (1990) The E75 ecdysone - inducible gene responsible for the 75B early puff in Drosophila encodes tw o new m embers of the steroid receptor su perf amily. Genes Dev. 4, 2 04–219. 18. Thummel, C.S., Burtis, K.C. & Hogne ss, D.S. (1990) Sp acial and temporal patterns of E 74 transcription during Drosophila devel- opment. Cell 61, 101–111. 19. Koelle, M.R., Se graves, W.A. & Hogness, D.S. (1992 ) D HR3: a Drosophila ste roid receptor h omolog. Proc. Natl Acad. Sci. USA 89, 6167–6171. 20. Dibello, P.R. , Withers, D. A., Bayer, C.A ., Fristom, J. W. & Guild, G. M. (1991) The Drosophila Broad-Com plex encodes a f amily of related proteins containing, zinc fi ng er. Genetics 129 , 385–397. 21. Hiruma,K.,Shinoda,T.,Malone,F.&Riddiforf,L.M.(1999) Juvenile hormone modulates 20-hydroxyecdysone-inducib le ecdysone receptor and ultraspiracle gene expression in the tobacco hornworm, Manduca s exta. Dev. Genes E vol. 209, 1 8–30. 22. Zhou, B., Hiruma, K., J indra, M., Shinoda, T., S e graves, W.A., Malone, F. & Riddiford, L.M. (1998) Regulation of the tran- scription factor E75 by 20-hydroxyecdysone and juvenile hormone in the e pidermis of the tobacco hornworm, Manduca sexta,during larval molting a nd metamorphosis. Dev. Bio l. 193, 1 27–138. 23. Debernard, S., Boz zolan, F., Du portets, L. & Porche ron, P. (2001) Periodic expression o f an ecdysteroid-induced n uclear receptor in a lepidopteran cell line (IAL-PID2). Insect Biochem. Mol. Biol. 31, 1057–1064. 24. Siaussat, D., Mottier, V ., Bozzolan, F., Porcheron, P . & Debernard, S. (2004) Synchronization of Plodia interpunctella lepidopteran cells a nd effects of 20-hydroxyecdysone. Insect Mol. Biol. 13, 179– 187. 25. Lynn, D.E. & Oberlander, H. (1983) The establishment of cell lines from imaginal wing discs of Spodoptera frugiperda and Plodia interpunctella. J. Insect Physiol. 29, 591 –596. 26. Riddiford, L.M., Curtis, A.T. & Kiguchi, K. (1979) Culture of the epidermis of t he tobacco h o rnworm Manduca sexta. Tissue Cult. Assoc. Man. 5, 9 75–985. 27. Kramer, K.J., Sanburg, L.L., Kezdy, F.J. & Law, J.H. (1974) The juvenile hormone bindin g protein in the hemolymph of Manduca s exta. Proc. Natl Acad. Sci. USA 71, 4 93–497. 28. Sanger, F., Nicklen, S. & Coulson, A.R. ( 1977) DNA sequencing with ch ain termination inhibitors. Proc . Natl Acad. Sci. USA 74, 5463–5467. 29. Hatt, P J., Liebon, C., Morinie ` re,M.,Oberlander,H.& Porcheron, P. (1997) Activity of insulin growth factors and shrimp neurosecretory o rgan extracts on a lepidopteran cell line. Arch. Insect Bioc hem. Physiol. 34, 313–328. 30. Auzoux-Bordenave, S., Hatt, P J. & Porc heron, P. (2002) A nti- proliferative effect of 20-h ydroxyecdysone in a lepidopteran cell line. Insect Biochem. Mol. Biol . 32, 217 –223. 31. Kozak, M. (1984) Complilation and analysis of sequences upstream from the translational star t site in eukaryotic mRNAs. Nucl. A cids. Res. 12 , 857–872. 32. Caverner, D.R. (1987) Comparison of the consensus sequence flanking translational start sites in Drosophila and v ertebrates. Nucl. A cids Res. 15 , 1353–1362. 33. Perera, S.C., Ladd, T .R., Dhadi alla, T.S., Krell, P.J., Sohi, S.S., Retnakaran, A. & Palli, S.R. (1999) Studies on two ecdysone receptor isoforms of the spruce budworm, Christoneura fumiferan. Mol Cell. Endocrinol. 152, 73–84. 34. Jindra, M., Malone, F., H iruma, K. & Ridd iford, L.M. (1996) Developmental profiles and ecdysteroid regulation of the mRNAsfortwoecdysonereceptorisoformsintheepidermisand wings of the tobacco hornworm, Man duca s exta. Dev. Biol. 180, 258–272. 35. Fujiwara, H., Jindra, M., Newitt, R., Palli, S.R., Hiruma, K. & Riddiford, L.M. (1995) Clon ing of an ecdysone receptor homolog from Manduca sexta and the developmental p rofi le of its mRNA in wings. Insect Biochem. Mol. Biol. 25, 845–856. 36. Swevers, L., Drevet, J.R., Lunke, M .D. & Iatrou, K . (1995) The silkmoth homolog of the Drosophila ecdysone receptor (B1 iso- form): cloning and analysis of expression during follicular cell differentiation. Insect Bioc hem. Mol. Biol. 25, 857–866. 37. Kamimura, M., Tomi ta, S. & Fujiwara, H. (19 96) Molecular cloning of an e cdysone receptor (B1 isoform) homologue from the silkworm, Bombyx mori, a nd its m RNA expression during wing disc development. Comp.Biochem.Physiol.113B, 341–347. 38. Mouillet, J.F., Delbecque, J.P., Quennedey, B. & Delachambre, J. (1997) Cloning of two putative ecdysteroid receptor isoforms from Tenebrio molitor and their de velopme ntal expres- sion in th e epidermis during metamorphosis. Eur. J. Biochem. 248, 856–863. 39. Talbot, W.S., Swyryd, E.A. & Hogness, D.S. (1993) Drosophila tissues with d ifferent metamorphic responses to ec dysone express different ecdysone receptor isoforms. Cell. 73, 1323–1337. 40. Tora, L., Gronemeyer, H., Turcotte, B., Gaub, M.P. & Chambon, P. (1988) The amin o- terminal region of the chicken progesterone receptor s pecifies target gene activation. Na ture 333, 1 85–188. 41.Mottier,V.,Siaussat,D.,Bozzolan,F.,Porcheron,P.& Debernard, S. (2004) The 20-hydroxyecdysone-induced cellular arrest in G2 phase i s p receded by an i nhibition o f c yclin expres- sion. Insect. Biochem. Mol. Biol. 34, 5 1–60. 42. Lynn, D .E. & Oberlander, H. (1981) The effect of cytoskeletal disrupting agents on the morp hological response of a cloned Manduca sexta cell line to 20-hydrox yecd yso ne. Rouxs Arch. Dev. Biol. 190, 150–155. 43. Peel, D.J. & Milner, M.J. (1992) T he response of Drosophila imaginal disc cell lines to ecdysteroids. Roux’s Arch. D ev Biol. 202, 23–35. 44. Cherbas, L., Koehler, M.M. & Cherbas, P. (1989) Effects of juvenile hormone on the ecdysone response of Drosophila Kc cells. Dev. Gen et. 10,188. 45. Ni J.H. & Iiout, H.F. (1994) Insect Hormones. Princeton Uni- versity Press, Princeton, NJ. 46. Milner, M.J. (1977) The time during which b-ecdysone is required for the differentiation in vitro and in situ of wing imaginal wing discs of Dros ophila melanogaster. Dev. Biol . 56, 206 –212. 47. Freedmann, L.P. (1992) Anatomy of the steroid receptor zinc finger region. Endo. R ev. 13, 1 29–145. 3026 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004 [...]... and Mode of Action of Invertebrates Hormones (Hoffmann, J & Porchet, M., eds), pp 245–254 Springer-Verlag, Berlin 53 Fain, M.J & Stevens, B (1982) Alterations in the cell cycle of Drosophila imaginal disc cells precede metamorphosis Dev Biol 92, 247–258 54 Jindra, M & Riddiford, L.M (1996) Expression of ecdysteroidregulated transcripts in the silk gland of the wax moth, Galleria mellonella Dev Genes Evol... Effects of JH II on 20E-inducible EcR, HR3, E75 genes (Eur J Biochem 271) 3027 48 Truss, M & Beato, M (1993) Steroid hormone receptors: Interaction with deoxyribonucleic acid and transcription factors Endo Rev 14, 459–479 49 Maksymowych, A.B., Hsu, T.C & Litwack, G (1993) A novel, highly conserved structural motif is present in all members of the steroid receptor superfamily Receptor 2, 225–240 50 Robinow,... L.W., Reuter, C.C & Schooley, D.A (1987) In vivo fluctuation of JH II, JH II acid, and ecdysteroid titer, and JH II esterase activity, during development of fifth stadium Manduca sexta Insect Biochem 17, 989–996 56 Zhou, B., Hiruma, K., Shinoda, T & Riddiford, L.M (1998) Juvenile hormone prevents ecysteroid-induced expression of Broad-complex RNA in the epidermis of the tobacco hornworm, Manduca sexta... death in the Drosophila CNS is ecdysone-regulated and coupled with a specific ecdysone receptor isoform Development 119, 1251–1259 51 Huet, F., Ruiz, C & Richards, G (1995) Sequential gene activation by ecdysone in Drosophila melanogaster: the hierarchical equivalence of early and early late genes Development 121, 1195–1204 52 Delachambre, J., Besson, M.T., Quennedey, A & Delbecque, J.P (1984) In Biosynthesis,... sexta Dev Biol 203, 233–244 57 White, K.P., Hurban, P., Watanabe, T & Hogness, D.S (1997) Coordination of Drosophila metamorphosis by two ecdysoneinduced nuclear receptors Science 276, 114–117 58 Higgins, D.G & Sharp, P.M (1988) CLUSTAL: a package for performing multiple sequence alignment on a microcomputer Gene 73, 237–244 . Effects of juvenile hormone on 20-hydroxyecdysone-inducible EcR , HR3 , E75 gene expression in imaginal wing cells of Plodia interpunctella lepidoptera David. revealed the expression of ecdysone receptor B1 isoform in imaginal wing cells of P. inte rpunctella at the last larval instar. In the fifth larval instar of M.