Báo cáo khoa học: The Runx3 distal transcript encodes an additional transcriptional activation domain doc

The Runx3 distal transcript encodes an additional transcriptional activation domain David D. Chung 1 , Kazuho Honda 2, *, Lorraine Cafuir 2 , Marcia McDuffie 2,3 and David Wotton 1 1 Center for Cell Signaling and Department of Biochemistry, and Molecular Genetics, University of Virginia School of Medicine, Charlottesville, VA, USA 2 Department of Microbiology, University of Virginia School of Medicine, Charlottesville, VA, USA 3 Department of Medicine, University of Virginia School of Medicine, Charlottesville, VA, USA The transcriptional regulator Runx3 is expressed in several hematopoietic cell lineages at different stages of development, including CD8 + thymocytes and periph- eral CD8 + T cells. Two independent lines of Runx3 mutant mice, in which Runx3 targets different molecu- lar domains, have been established via induced muta- tions [1,2]. Hematopoietic precursors from both lines produce decreased numbers of peripheral CD8 + T cells that aberrantly coexpress CD4 [3,4]. These cells fail to expand into functional cytotoxic CD8 + T-cell populations in vivo or in vitro. Mutational analysis of the CD4 silencer has shown that transcriptional repres- sion in CD8 + T cells requires binding of Runx3 to runt-specific binding sites in the first intron of Cd4. Keywords cell differentiation; runt domain; Runx3; transcription Correspondence M. McDuffie, University of Virginia School of Medicine, Aurbach Medical Research Building, Box 801390 (FedEx: room 1253), Charlottesville, VA 22908, USA Fax: +1 434 243 9143, Tel: +1 434 924 1707 E-mail: mjm7e@virginia.edu D. Wotton, Center for Cell Signaling, University of Virginia, Room 7008, Hospital West, Hsc 800577, Charlottesville, VA 22908, USA Fax: +1 434 924 1236, Tel: +1 434 243 6752 E-mail: dw2p@virginia.edu *Present address Department of Pathology, Tokyo Women’s Medical University, Tokyo, Japan (Received 5 February 2007, revised 5 April 2007, accepted 9 May 2007) doi:10.1111/j.1742-4658.2007.05875.x The runt family transcriptional regulator, Runx3, is upregulated during the differentiation of CD8 single-positive thymocytes and is expressed in peri- pheral CD8 + T cells. Mice carrying targeted deletions in Runx3 have severe defects in the development and activation of CD8 + T cells, resulting in decreased CD8 + T-cell numbers, aberrant coexpression of CD4, and failure to expand CD8 + effector cells after activation in vivo or in vitro. Expression of each of the three vertebrate runt family members, including Runx3, is controlled by two promoters that generate proteins with alter- native N-terminal sequences. The longer N-terminal region of Runx3, expressed from the distal promoter, is highly conserved among family members and across species. We show that transcripts from the distal Runx3 promoter are selectively expressed in mature CD8 + T cells and are upregulated upon activation. We show that the N-terminal region encoded by these transcripts carries an independent transcriptional activation domain. This domain can activate transcription in isolation, and contri- butes to the increased transcriptional activity observed with this isoform as compared to those expressed from the ancestral, proximal promoter. Together, these data suggest an important role for the additional N-ter- minal Runx3 activation domain in CD8 + T-cell function. Abbreviations eYFP, enhanced yellow fluorescent protein; GBD, Gal4 DNA-binding domain; HDAC5, class II histone deacetylase; Ig-Ca, IgG a-chain constant region; TGF, transforming growth factor; YFP, yellow fluorescent protein. FEBS Journal 274 (2007) 3429–3439 ª 2007 The Authors Journal compilation ª 2007 FEBS 3429 However, the mechanism(s) by which Runx3 selectively promotes CD8 single-positive development in the thy- mus and the expansion of CD8 + effector cells in the periphery is not yet clear. Runx3 is one of a large family of transcriptional reg- ulators, closely related in both structure and function to the Drosophila runt protein [5]. Found in all animals from worms to humans, this gene family was originally defined by the presence of the DNA-binding runt domain, which is essentially invariant among all family members throughout evolution and results in similar target-binding motifs for all family members [6]. In addition to DNA-binding affinity, nuclear import or retention and protein half-life are also regulated through this domain [7–11]. Vertebrates have three runt family genes, Runx1–3 (also referred to as CBFa1–3 or PEBP2aA–C [12]). Runx3 has been shown to recruit other transcription factors to sites of transcriptional regulation, integrating signaling path- ways critical for hematopoietic cell development and activation. Documented interactions include those with transforming growth factor (TGF)-b-activated Smads and several Ets family members, as well as repressor complexes from the mSin3a and Groucho ⁄ TLE famil- ies [13–17]. Recruitment of TLE repressor complexes has been shown to be essential for silencing of Cd4 by Runx3 in CD8 + T cells [13]. In vertebrates, all runt family genes contain two highly conserved alternative promoters, proximal (P) and distal (D). The 5¢-coding sequence of invertebrate runt family members is homologous to the sequence controlled by the vertebrate proximal promoter, sug- gesting that acquisition of the distal promoter was associated with the evolution of more complex require- ments for control of this essential developmental regu- lator early in vertebrate evolution [6]. To date, the activity of runt family members has been characterized primarily using transcripts generated from the prox- imal (ancestral) promoter, with attention focused on C-terminal functional domains. Previous reports have suggested that transcripts from the two alternative pro- moters are differentially expressed [18,19]. However, no studies specifically testing for functional differences between Runx3 isoforms have been published, and the function of the longer N-terminal domain in Runx3 has not been extensively analyzed. Here we show that Runx3 transcripts from the distal promoter are largely restricted to CD8 + T cells in the periphery, clearly distinguishing them from CD4 + T cells. Additionally, splenocytes from C57BL ⁄ 6 (B6) mice selectively upregulate the transcript from the distal promoter after culture with activating antibody to CD3. In contrast, differences in expression of total Runx3 transcripts in CD4 + and CD8 + T cells are small, suggesting that transcripts from the proximal promoter are unlikely to explain the marked differ- ences in dependence on Runx3 activity in the two sub- sets. Analysis of the function of the longer Runx3 isoform, expressed from the distal promoter, demon- strates that the N-terminal region contains an independent transcriptional activation domain that contributes to increased transcriptional activity by this Runx3 isoform. We suggest that the N-terminal activa- tion domain, encoded by transcripts from the Runx3 distal promoter, is required for normal function of per- ipheral T cells, particularly those of the CD8 + subset. Results Differential expression of Runx3 transcripts The highly homologous mouse and human RUNX3 genes are transcribed from two alternative promoters (human homolog shown in Fig. 1A). Transcripts encode distinct five amino acid or 19 amino acid N-terminal sequences from the proximal (P) and distal (D) promoters, respectively (Fig. 1B). A high level of sequence conservation is present within the N-termini of proteins generated from each of the two promoters across vertebrate species, suggesting a critical func- tional distinction between the two isoforms (Fig. 1C). Data from two independent targeted mutant mouse strains show that normal Runx3 activity is absolutely required for the normal development and clonal expansion of CD8 + T cells but has no detectable impact on CD4 + T-cell development or proliferation. Although no disruption of CD4 + T-cell development or activation was noted in mice carrying deletion mutations of Runx3, a recent report [20] showed that Runx3 is upregulated by the transcription factor T-bet during the functional maturation of T H 1 cells, and subsequently cooperates with T-bet in the repression of interleukin-4 expression and, to a lesser degree, in the upregulation of interferon-c characteristic of this subset. Using primers binding to a sequence in the runt domain conserved among all runt family members (exon 4) and a Runx3-specific sequence in the C-termi- nus (exon 6), we compared expression levels for all full-length Runx3 transcripts in positively selected CD4 + and CD8 + splenocytes. Both quantitative den- sitometry (data not shown) and real-time quantitative PCR (Fig. 2A) revealed only a modest overall differ- ence in expression of Runx3 between the CD4 + and CD8 + subsets (< 1.6-fold), which seemed unlikely to explain a selective effect of Runx3 deficiency on CD8 + Transcriptional activation by Runx3 D. D. Chung et al. 3430 FEBS Journal 274 (2007) 3429–3439 ª 2007 The Authors Journal compilation ª 2007 FEBS survival and activation. We were therefore interested to test whether there were differences in expression from the two promoters between the CD4 + and CD8 + T-cell subsets. No primers suitable for real-time quantitative PCR specific for transcripts from either the proximal or distal promoter were identified, probably because of the extremely high G ⁄ C content of these exons. How- ever, we were able to amplify a 433 bp fragment from the 5¢-UTR of the distal transcript that could be used for quantitation through densitometry of PCR prod- ucts on serial dilutions of template. Using this method, we found that distal transcripts are more highly expressed in the CD8 + subset, suggesting that differen- tial effects of Runx3 deletion on CD4 + and CD8 + T cells may result selectively from loss of the Runx3 isoform generated from this promoter (Fig. 2A). With culture conditions that produced optimal B6 splenocyte proliferation at 72 h in response to plate- bound anti-CD3, CD8 + T cells reproducibly expanded more efficiently than CD4 + T cells (Fig. 2B). Forty hours after initiation of the cultures, when viable CD4 + and CD8 + T-cell numbers had not changed sig- nificantly from the input numbers (data not shown), we detected only small increases in total Runx3 tran- scripts, which seemed unlikely to explain the require- ment for Runx3 in the clonal expansion or functional maturation of CD8 + T cells (Fig. 2C). However, quantification of distal transcripts alone again showed a dramatic increase in expression levels after anti-CD3 stimulation. Thus, it appears that Runx3 distal tran- scripts are more highly expressed in CD8 + T cells and are specifically further upregulated on T-cell stimulation. Increased transcriptional activity from protein expressed from the distal promoter As little was known about functional differences between the two isoforms of Runx3, we compared A B C Fig. 1. Structure of the RUNX3 gene. (A) The RUNX3 gene consists of seven exons. Expression of alternative transcripts is regulated by TATA-less promoters upstream of exons 1 and 3 (arrows; P, proximal promoter; D, distal promoter). The two transcripts are produced from translational start sites in exon 3 (transcript 1) and exon 2 (transcript 2), resulting in protein-coding sequences (marked in gray) differing only at the N-terminus. (B) The DNA and corresponding amino acid sequences of the N-termini of the two alternative transcripts are shown. The splice site between exons 2 and 3 in transcript 2 is underlined. (C) An alignment of vertebrate P2-RUNX3 N-terminal sequences is shown. Amino acids that are identical or similar in at least two sequences are shaded black and gray, respectively. The start of the runt domain is indicated. The region unique to P2-RUNX3, and the C-terminal ends of the two GBD fusions (encoding amino acids 1–31 or 1–66 of P2-RUNX3) are shown. D. D. Chung et al. Transcriptional activation by Runx3 FEBS Journal 274 (2007) 3429–3439 ª 2007 The Authors Journal compilation ª 2007 FEBS 3431 their ability to activate transcription of known runt family target promoters. Using clones for both tran- scripts from the highly homologous human RUNX3 gene (Fig. 1C [19]), we first tested the ability of full- length P-RUNX3 and D-RUNX3 to activate the p6OSE2 reporter construct. This synthetic promoter, consisting of a tandem array of six runt domain-bind- ing sites derived from the osteocalcin gene promoter, is a sensitive reporter for all runt family members. The activity of p6OSE2 in the presence of Flag–D-Runx3 was consistently two-fold higher than with Flag–P- Runx3 (Fig. 3A). Higher transcriptional activity of D-RUNX3 was also observed using both Myc epitope- tagged and untagged expression constructs (Fig. 3B,C), ruling out possible differential effects of the N-terminal epitope tags. Both isoforms were expressed at similar levels [a P-RUNX3 ⁄ D-RUNX3 ratio of 1.09 : 1 (Myc) and 1.12 : 1 (Flag)], suggesting that this difference in transcriptional activity was not due to differences in expression levels (Fig. 3F). Although DNA binding by all runt family members is similar in vitro, the osteocalcin promoter is a natural target for the runt family member Runx2 in vivo.To analyze transcriptional activation by P-RUNX3 and D-RUNX3 using a known RUNX3 target, we used a reporter driving luciferase expression by the IgG a-chain constant region (Ig-Ca) promoter. This pro- moter is regulated by Runx3 together with TGF-b- activated Smad complexes in vivo [21,22]. Although both RUNX3 isoforms enhanced the response to increasing levels of added TGF-b, D-RUNX3 increased activation of the Ig-Ca-luciferase reporter more effectively than P-RUNX3 (Fig. 3D), confirming a general increase in the activity of D-RUNX3 as com- pared to P-RUNX3. With this reporter, the difference between P-RUNX3 and D-RUNX3 was less dramatic than with p6OSE2, possibly because p6OSE2 is entirely dependent on RUNX3 for activation. Interactions between p300 ⁄ CBP and a C-terminal domain in RUNX3 have been shown to regulate nuclear localization and transcriptional activity of RUNX3 via acetylation of residues in and flanking the runt domain [10]. Overexpression of the adenovirus E1a protein blocks numerous transcriptional responses through its dose-dependent inhibition of p300 ⁄ CBP activity [22]. We used this titratable inhibition to deter- mine whether the two RUNX3 isoforms differed in A B C Fig. 2. Selective expression of distal transcripts of Runx3 in mature, peripheral CD8 + T cells and activated splenocytes. Real- time quantitative PCR (all transcripts) or densitometry of PCR prod- ucts (distal transcripts) was performed on RNA isolated from the relevant tissues in order to determine the relative representation of transcripts from the two promoters. (A) RNA from bead-purified splenic CD4 + and CD8 + T cells was compared in two separate experiments on RNA from two mice (Expt 1) or RNA from a single mouse (Expt 2). A representative gel used for densitometry is shown below. For each test sample: lane 1 shows a control tem- plate with no reverse transcriptase; lanes 2–4 show the results of RT-PCR on decreasing concentrations of template. (B) B6 spleno- cytes from three individual 4-month-old female mice were cultured for 72 h, with or without anti-CD3. Cells were counted and ana- lyzed by flow cytometry. Absolute numbers were calculated from viable total cell counts using the frequency of cells in each subset after exclusion of dead cells via 7-amino-actinomycin D staining (SD in parentheses). (C) Runx3 expression was quantitated in RNA pooled from the splenocytes of two individual mice in each of two experiments after 40 h of culture, with or without anti-CD3. Expression was normalized by levels of 18S RNA to ensure comparisons based on equal amounts of input total RNA and is shown relative to that in CD4 + T cells (A) or unstimulated, cultured splenocytes (C). Transcriptional activation by Runx3 D. D. Chung et al. 3432 FEBS Journal 274 (2007) 3429–3439 ª 2007 The Authors Journal compilation ª 2007 FEBS their dependence on p300 by coexpressing P-RUNX3 or D-RUNX3 with increasing amounts of E1a. As shown in Fig. 3E, transcriptional activation by both P-RUNX3 and D-RUNX3 was inhibited equally well by coexpressed E1a, suggesting that both depend on p300 ⁄ CBP for their ability to activate transcription. To rule out a general alteration in RUNX3 activity caused by the presence of alternative N-terminal regions, we tested a selection of known RUNX3 func- tions. As shown in Fig. 4A, when expressed as fusions to enhanced yellow fluorescent protein (eYFP), both RUNX3 isoforms were localized predominantly to the AB C D E F Fig. 3. Transcriptional activation by P-RUNX3 and D-RUNX3. HepG2 cells were transfected with the p6OSE2 luciferase reporter, together with Flag epitope-tagged P-RUNX3 and D-RUNX3 (A), Myc epitope-tagged P-RUNX3 and D-RUNX3 (B), or untagged expression vectors enco- ding P-RUNX3 and D-RUNX3 (C). (D) HepG2 cells were transfected with the Ig-Ca luciferase reporter, and either P-RUNX3 or D-RUNX3, as indicated; 18 h before analysis, cells were treated with the indicated concentration of TGF-b. (E) HepG2 cells were transfected with the p6OSE2 luciferase reporter and untagged P-RUNX3 and D-RUNX3 with increasing amounts of an E1a expression plasmid. Luciferase activity in all panels is shown in arbitrary units, as the mean ± SD of duplicate transfections. (F) Relative expression of transfected Myc- or Flag- tagged P-RUNX3 and D-RUNX3 was assayed by western blotting with an antibody against the Myc or Flag epitopes. D. D. Chung et al. Transcriptional activation by Runx3 FEBS Journal 274 (2007) 3429–3439 ª 2007 The Authors Journal compilation ª 2007 FEBS 3433 nucleus, with no apparent differences in subnuclear localization. Next, we analyzed the interaction of RUNX3 with two known partners by coimmunoprecip- itation from transfected cells. COS1 cells were trans- fected with expression plasmids encoding Smad3 and Flag-tagged RUNX3, and immunocomplexes were iso- lated on anti-Flag agarose. Despite the difference in the activation of the Ig-Ca reporter, we found no significant differences in the ability of the two isoforms to interact with the TGF-b-responsive Smad3, which interacts with both p300 and RUNX3 to initiate class switching to IgA production in B lymphocytes (Fig. 4B). Activation and stabilization of Runx3 by p300 ⁄ CBP can be reversed through Runx-dependent recruitment of the class II histone deacetylase, HDAC5, to transcriptional complexes containing runt family proteins [10]. There- fore, we tested for interaction of HDAC5 with Runx3 using COS1 cells transfected with Myc-tagged P-RUNX3 or D-RUNX3, with or without Flag-tagged HDAC5. Flag immunocomplexes were analyzed for coprecipitating RUNX3. As with the Smad3 interac- tion, we observed no significant difference in the ability of the RUNX3 isoforms to interact with HDAC5, sug- gesting that the potential for destabilization of RUNX3 binding through deacetylation, and the potential for transcriptional repression through HDAC5-mediated histone deacetylation, is similar for both isoforms (Fig. 4C). Taken together, these results imply that the enhanced transcriptional activation by D-RUNX3 does not simply result from altered interactions with known binding partners or protein localization, and suggest the possibility that the longer N-terminal region present in D-RUNX3 contributes directly to transcriptional activation. A novel activation domain in D-RUNX3 To analyze the transcriptional activation potential of the RUNX3 isoforms, independent of the runt domain binding to DNA, we created a series of RUNX3 fusions to the Gal4 DNA-binding domain (GBD), and tested them using a heterologous promoter. Full-length P-RUNX3 and D-RUNX3 constructs, fused to the GBD, were cotransfected into HepG2 cells together with the (Gal) 5 -TATA-luc reporter, which contains five Gal4 operators upstream of a minimal TATA element. As seen with the Runx binding site reporters, D-RUNX3 was significantly more active than P-RUNX3, particularly at low levels of the transfected GBD fusion construct (Fig. 5A). Thus, at the lowest level of transfected plasmid, GBD–D-RUNX3 increased activation more than two-fold, whereas GBD–P-RUNX3 increased activity by only 30%. This suggests that transcripts from the distal promoter encode a transcriptional activation function independ- ent of DNA binding by the runt domain, or recruit- ment of additional transcriptional activators by the rest of the protein. In confirmation of this, GBD fusion constructs that excluded the runt domain and everything C-terminal to it showed similar differences in reporter activation (Fig. 5B). The N-terminal region of D-RUNX3 encompassing amino acids 1–66 activa- ted expression of the (Gal) 5 -TATA-luc reporter up to eight-fold, whereas the comparable P construct (amino acids 1–52; Figs 1C and 5D) performed little better than the GBD alone. Further analysis of the D-RUNX3 N-terminal domain demonstrated that either the N-terminal 19 or 31 amino acids were suffi- cient to activate transcription when targeted via the ABC Fig. 4. RUNX3 interactions with Smad3 and HDAC5. (A) RUNX3 proteins are nuclear. COS1 cells were transfected with YFP fused P-RUNX3 and D-RUNX3 expression constructs. Hoechst and YFP images are shown. (B) COS1 cells were transfected with SMAD3 together with Flag tagged P-RUNX3 or D-RUNX3 expression constructs. Protein complexes were collected on anti-Flag agarose, and coprecipitating SMAD3 was visualized by western blot. (C) COS1 cells were cotransfected with Flag-tagged HDAC5 Myc-tagged P-RUNX3 or D-RUNX3, as indica- ted, and the presence of RUNX3 proteins in Flag immunocomplexes detected by Myc western blot. Transcriptional activation by Runx3 D. D. Chung et al. 3434 FEBS Journal 274 (2007) 3429–3439 ª 2007 The Authors Journal compilation ª 2007 FEBS GBD (Fig. 5B). These constructs contain only the most highly conserved region of the D-RUNX3 N-ter- minus (Figs 1C and 5D). Importantly, all of the trun- cated GBD fusion constructs were expressed at very similar levels (Fig. 5D). Thus, the extreme N-terminus, contained within amino acids 1–19 of D-RUNX3, constitutes an independent transcriptional activation domain that contributes to overall transcriptional acti- vation by this RUNX3 isoform. Discussion We have shown that transcripts from the distal Runx3 promoter are clearly more highly expressed in the CD8 + T-cell subset than in the CD4 + subset in mice. In contrast, little difference in total Runx3 transcripts is observed between these two cell types. As Runx3 has been shown to be absolutely required for the nor- mal phenotype and function of CD8 + T cells, our results suggest that this subset may specifically require the longer D-Runx3 isoform. Transcripts from the distal promoter are also selectively upregulated in splenocytes stimulated with anti-CD3, further support- ing a critical role for this Runx3 isoform in T-cell activation. Functional comparison of the proteins encoded by each transcript demonstrates that both P and D iso- forms of highly homologous human RUNX3 isoforms A CD B Fig. 5. The N-terminus of D-RUNX3 contains an activation domain. HepG2 cells were transfected with the (Gal) 5 -TATA-luc reporter, together with the indicated fusions between the GBD and P-RUNX3 and D-RUNX3. Luciferase activity was assayed and is presented as in Fig. 3. (A) Increasing amounts of GBD and GBD–P-RUNX3 or GBD–D-RUNX3 fusions, encoding full length P-RUNX3 or D-RUNX3, were transfected. (B) GBD alone or fusions to the N-terminal 52 amino acids of P-RUNX3 or the N-terminal 66 amino acids of D-RUNX3, and two fusions to the N-terminal 31 or 19 amino acids of D-RUNX3, were assayed as in (A). (C) The relative expression of transfected GBD, GBD–P(1–52), GBD–D(1–66), GBD–D(1–31) and GBD–D(1–19) fusions was assayed by western blot with an antibody against GBD. (D) The GBD fusions used in this figure are shown schematically. D. D. Chung et al. Transcriptional activation by Runx3 FEBS Journal 274 (2007) 3429–3439 ª 2007 The Authors Journal compilation ª 2007 FEBS 3435 interact similarly with Smad3 and HDAC5, and that transcriptional activation by both is dependent on the CBP ⁄ p300 complex. However, we show that the D iso- form, generated from transcripts of the distal RUNX3 promoter, is consistently more active in transcriptional reporter assays. This is true whether it is targeted to DNA via its own runt domain or by fusion to the heterologous Gal4 DNA-binding domain, suggesting that differences in transcriptional activity are not due to differences in DNA binding between the two iso- forms. Deletion analyses revealed that D-RUNX3 contains a previously uncharacterized transcriptional activation domain within the first 19 amino acids. This domain can act in isolation, when targeted to a pro- moter via a heterologous DNA-binding domain, suggesting that it is a functionally independent tran- scriptional activation domain. This domain clearly functions to enhance the activity of the more C-terminal activation domain in Runx3. However, it is also possible that it may have distinct functions at specific target promoters. The N-terminal sequence encoded by distal Runx3 transcripts is highly conserved in runt family members from vertebrate species, suggesting that the alternative N-termini of vertebrate Runx proteins control critical functions. In support of this idea, the D isoform of the family member Runx1 has been shown to bind with higher affinity than the P isoform to runt domain- binding elements from both myeloperoxidase and T-cell receptor b-chain promoters [23]. Moreover, the two isoforms were shown to have differential effects on precursor expansion and myeloid differentiation during induced maturation of the promyelocytic 32Dcl.3 cell line. Granulocyte colony-stimulating factor-mediated maturation occured rapidly in 32Dcl.3 cells transfected with control vector or D-Runx1, whereas P-Runx1 promoted ongoing expansion prior to terminal differentiation and thus produced a seven- fold increase in the final number of mature granulo- cytes. Interpretation of these results is complicated by subsequent studies that showed an inverse relationship between DNA-binding affinity and transcriptional acti- vation for Runx1 [24]. However, the clear functional difference between isoforms of Runx1 supports the hypothesis that selective expression of D-Runx3 in CD8 + T cells plays a critical role in the normal func- tion of this subset. Interestingly, deletion analyses of Runx2 demonstra- ted that the 19 amino acid region in the longer isoform of this runt family member was required for full tran- scriptional activation in a reporter assay. In contrast to our results, however, the isolated N-terminus of the longer Runx2, or the entire region N-terminal to the runt domain, was only able to very weakly activate transcription of a heterologous DNA-binding element [25]. Differential activation of Runx2 target genes by alternative Runx2 isoforms was also confirmed in two later studies, although the differences were promoter specific [26,27]. Additionally, functional differences were seen in transgenic rescue models that tested the recovery of bone formation by each isoform in Runx2 null mice [28]. More recently, the N-terminal region of the shorter Runx1 isoform has also been shown to contribute to transcriptional activation [24]. Thus it appears that for all three vertebrate Runx proteins, the N-termini play a role in their ability to activate transcription. Taken together, the results of analysis of the func- tional differences between long and short isoforms of the vertebrate runt family members clearly suggest dif- ferences in overall transcriptional activity. In addition, it is likely that some specific target genes are more sensitive to these differences. We hypothesize that increased expression of D-Runx3 in CD8 + T cells may result simply in an overall increase in the expression of Runx3 target genes, with an increased sensitivity to signals such as TGF-b. However, it is also possible that the control of CD8 + T-cell development and activation may require the activation of a unique set of target genes controlled by the activation domain in D-Runx3. In either case, specific identification of D-Runx3-dependent transcriptional targets is likely to provide a productive strategy for uncovering the function of this isoform, which is specifically required for normal CD8 + T-cell development and activation. Experimental procedures Mice C57BL ⁄ 6 mice were bred and maintained in the vivarium at the University of Virginia, using founders obtained from The Jackson Laboratory (Bar Harbor, ME). All protocols using mice were reviewed and approved by the Animal Care and Use Committee of the University of Virginia. Splenocyte culture and flow cytometry Splenocytes were processed for flow cytometry after culture for up to 72 h in modified Dulbecco’s medium containing 10% heat-inactivated fetal bovine serum, with or without with plate-bound purified anti-CD3 (145-2C11). Samples stained with allophycocyanin-labeled GK1.5 (CD4) and fluorescein isothiocyanate-labeled 53-6.72 (CD8) (BD Bio- sciences ⁄ Pharmingen, San Jose, CA) were analyzed using a Transcriptional activation by Runx3 D. D. Chung et al. 3436 FEBS Journal 274 (2007) 3429–3439 ª 2007 The Authors Journal compilation ª 2007 FEBS FACScan cytometer equipped with cellquest software (BD Biosciences ⁄ Pharmingen). Quantitation of RUNX3 transcripts RNA was isolated from cells after 40 h in culture using a QIAshredder Mini Spin Column and RNeasy Mini Kit (Qiagen, Valencia, CA). cDNA was synthesized using the First-Strand cDNA Synthesis Kit (GE Healthcare Life Sciences, Piscataway, NJ). Real-time quantitative PCR for total Runx3 transcript levels was performed in triplicate using the QuantiTect SYBR Green RT-PCR Kit (Qiagen) in an iCycler (Bio-Rad, Hercules, CA), with the following prim- ers: CAGGTTCAACGACCTTCGAT (exon 4) and AGGC CTTGGTCTGGTCTTCT (exon 6). Quantitative determin- ation of mRNA levels from the distal promoter was per- formed using the primers GGTGAGCCTCGTTCATTCAT (sense) and GGTCAGACCCACTTGGTTGG (antisense) to generate a single 433 bp product from the 5¢-UTR of the distal promoter, followed by electrophoresis through 1% agarose and visualization using ethidium bromide. Densito- metry of PCR products was performed using genesnap software (SynGene, Frederick, MD). For both methods, Runx3 transcript levels were standardized to expression of ribosomal 18S RNA using TaqMan Ribosomal RNA Control Reagents (Applied Biosystems, Foster City, CA). Plasmids An expressed sequence tag clone (IMAGE: 3615873) for human D-Runx3 was obtained from the American Type Culture Collection. 6Myc-D-Runx3 was generated by PCR from 6Myc-P-Runx3 (gift of Y. Ito, Kyoto University, Japan). Untagged human SMAD3 and P-Runx3 and D- Runx3 were expressed from pCMV5. Flag-tagged P-Runx3 and D-Runx3 constructs were generated in a modified pCMV5. GBD fusions were created within pM (Clontech, Mountain View, CA). Yellow fluorescent protein (YFP) fusions were created within a modified pCS2 vector, containing an N-terminal enhanced eYFP tag (BD Biosciences ⁄ Pharmingen). p6OSE2-luc was a kind gift from R. Derynck (UCSF, CA). pBJ5-Flag-HDAC5 was a gift from S. Schreiber (Harvard, MA). Luciferase assays HepG2 cells were transfected with firefly luciferase report- ers, a phCMVRLuc control (Promega, Madison, WI) and Runx3 expression constructs using Exgen 500 (MBI Fer- mentas, Hanover, MD). HepG2 cells were chosen specific- ally because they express negligible levels of runt family members. After 48 h, promoter activity was assayed with a luciferase assay kit (Promega), using a Berthold (Oak Ridge, TN) LB953 luminometer. Results were standardized using renilla luciferase activity, assayed with 0.09 lm colen- terazine (Biosynth, Naperville, IL). Immunoprecipitation and western blotting COS1 cells were maintained in DMEM with 10% bovine growth serum (Hyclone, Logan, UT) and were transfected using LipofectAmine (Invitrogen, Carlsbad, CA). Thirty-six hours after transfection, cells were lysed by sonication in 75 mm NaCl, 50 mm Hepes (pH 7.8), 20% glycerol, 0.1% Tween020, 0.5% Nonidet-P40 with protease and phospha- tase inhibitors. Immunocomplexes were precipitated with Flag M2–agarose (Sigma, St Louis, MO). Following SDS ⁄ PAGE, proteins were electroblotted to Immobilon-P (Millipore, Billerica, MA) and incubated with antisera spe- cific for Flag (Sigma), Smad2 ⁄ 3 (Chemicon, Temecula, CA), and Myc (9E10; University of Virginia, Lymphocyte Culture Center). RUNX3 levels were quantified using Alexa Fluor 680 anti-(mouse IgG) (1 : 2000) as secondary anti- bodies. Membranes were scanned and analyzed using odys- sey software (LI-COR). Fluorescence microscopy COS1 cells were split onto four-well chamber slides (Nunc, Rochester, NY) and transfected with eYFP-tagged fusion proteins using Fugene 6 (Roche, Indianapolis, IN). After 22–26 h, cells were stained with Hoechst 33342 and imaged with a Zeiss (Thornwood, NY) Axiovert 135T inverted fluorescence microscope on a heated stage with YFP and 4’,6-diamidino-2-phenylindole filter sets (Omega Opticals, Brattleboro, VT). Images were visualized, captured, and converted to 8-bit.tif files with a Zeiss 32·⁄0.40 objective and a Hamamatsu (Bridgewater, NJ) Orca II cooled charge-coupled device camera controlled by openlab soft- ware (Improvision, Lexington, MA). Acknowledgements This work was supported by the University of Virginia SCOR in Systemic Lupus Erythematosus (P50 AR45222). The authors would like to thank R. Dery- nck, Y. Ito and S. Schreiber for generously providing plasmids. References 1 Li QL, Ito K, Sakakura C, Fukamachi H, Inoue K, Chi XZ, Lee KY, Nomura S, Lee CW, Han SB et al. (2002) Causal relationship between the loss of RUNX3 expres- sion and gastric cancer. Cell 109, 113–124. 2 Levanon D, Bettoun D, Harris-Cerruti C, Woolf E, Negreanu V, Eilam R, Bernstein Y, Goldenberg D, D. D. Chung et al. Transcriptional activation by Runx3 FEBS Journal 274 (2007) 3429–3439 ª 2007 The Authors Journal compilation ª 2007 FEBS 3437 Xiao C, Fliegauf M et al. (2002) The Runx3 transcrip- tion factor regulates development and survival of TrkC dorsal root ganglia neurons. EMBO J 21, 3454–3463. 3 Taniuchi I, Osato M, Egawa T, Sunshine MJ, Bae SC, Komori T, Ito Y & Littman DR (2002) Differential requirements for Runx proteins in CD4 repression and epigenetic silencing during T lymphocyte development. Cell 111, 621–633. 4 Woolf E, Xiao C, Fainaru O, Lotem J, Rosen D, Negreanu V, Bernstein Y, Goldenberg D, Brenner O, Berke G et al. (2003) Runx3 and Runx1 are required for CD8 T cell development during thymopoiesis. Proc Natl Acad Sci USA 100 , 7731–7736. 5 Kagoshima H, Shigesada K, Satake M, Ito Y, Miyoshi H, Ohki M, Pepling M & Gergen P (1993) The Runt domain identifies a new family of hetero- meric transcriptional regulators. Trends Genet 9, 338–341. 6 Rennert J, Coffman JA, Mushegian AR & Robertson AJ (2003) The evolution of Runx genes I. A comparat- ive study of sequences from phylogenetically diverse model organisms. BMC Evol Biol 3,4. 7 Tang YY, Shi J, Zhang L, Davis A, Bravo J, Warren AJ, Speck NA & Bushweller JH (2000) Energetic and functional contribution of residues in the core binding factor beta (CBFbeta) subunit to heterodimerization with CBFalpha. J Biol Chem 275, 39579–39588. 8 Zhang L, Li Z, Yan J, Pradhan P, Corpora T, Cheney MD, Bravo J, Warren AJ, Bushweller JH & Speck NA (2003) Mutagenesis of the Runt domain defines two energetic hot spots for heterodimerization with the core binding factor beta subunit. J Biol Chem 278, 33097– 33104. 9 Huang G, Shigesada K, Ito K, Wee HJ, Yokomizo T & Ito Y (2001) Dimerization with PEBP2beta protects RUNX1 ⁄ AML1 from ubiquitin-proteasome-mediated degradation. EMBO J 20, 723–733. 10 Jin YH, Jeon EJ, Li QL, Lee YH, Choi JK, Kim WJ, Lee KY & Bae SC (2004) Transforming growth factor- beta stimulates p300-dependent RUNX3 acetylation, which inhibits ubiquitination-mediated degradation. J Biol Chem 279, 29409–29417. 11 Chakraborty S, Sinha KK, Senyuk V & Nucifora G (2003) SUV39H1 interacts with AML1 and abrogates AML1 transactivity. AML1 is methylated in vivo. Oncogene 22, 5229–5237. 12 van Wijnen AJ, Stein GS, Gergen JP, Groner Y, Hie- bert SW, Ito Y, Liu P, Neil JC, Ohki M & Speck N (2004) Nomenclature for Runt-related (RUNX) pro- teins. Oncogene 23, 4209–4210. 13 Yarmus M, Woolf E, Bernstein Y, Fainaru O, Negrean- u V, Levanon D & Groner Y (2006) Groucho ⁄ transduc- in-like Enhancer-of-split (TLE)-dependent and -independent transcriptional regulation by Runx3. Proc Natl Acad Sci USA 103, 7384–7389. 14 Erman B, Cortes M, Nikolajczyk BS, Speck NA & Sen R (1998) ETS-core binding factor: a common composite motif in antigen receptor gene enhancers. Mol Cell Biol 18, 1322–1330. 15 Miyazono K, Maeda S & Imamura T (2004) Coordinate regulation of cell growth and differentiation by TGF- beta superfamily and Runx proteins. Oncogene 23, 4232–4237. 16 Lutterbach B, Westendorf JJ, Linggi B, Isaac S, Seto E & Hiebert SW (2000) A mechanism of repression by acute myeloid leukemia-1, the target of multiple chro- mosomal translocations in acute leukemia. J Biol Chem 275, 651–656. 17 Javed A, Guo B, Hiebert S, Choi JY, Green J, Zhao SC, Osborne MA, Stifani S, Stein JL, Lian JB et al. (2000) Groucho ⁄ TLE ⁄ R-esp proteins associate with the nuclear matrix and repress RUNX (CBF(alpha) ⁄ AML ⁄ PEBP2(alpha) dependent activation of tissue-specific gene transcription. J Cell Sci 113(12), 2221–2231. 18 Rini D & Calabi F (2001) Identification and comparat- ive analysis of a second runx3 promoter. Gene 273, 13–22. 19 Bangsow C, Rubins N, Glusman G, Bernstein Y, Negreanu V, Goldenberg D, Lotem J, Ben-Asher E, Lancet D, Levanon D et al. (2001) The RUNX3 gene ) sequence, structure and regulated expression. Gene 279, 221–232. 20 Djuretic IM, Levanon D, Negreanu V, Groner Y, Rao A & Ansel KM (2007) Transcription factors T-bet and Runx3 cooperate to activate Ifng and silence Il4 in T helper type 1 cells. Nat Immunol 8, 145–153. 21 Hanai J, Chen LF, Kanno T, Ohtani-Fujita N, Kim WY, Guo WH, Imamura T, Ishidou Y, Fukuchi M, Shi MJ et al. (1999) Interaction and functional cooperation of PEBP2 ⁄ CBF with Smads. Synergistic induction of the immunoglobulin germline Calpha promoter. J Biol Chem 274, 31577–31582. 22 Park SR, Seo GY, Choi AJ, Stavnezer J & Kim PH (2005) Analysis of transforming growth factor-beta1- induced Ig germ-line gamma2b transcription and its implication for IgA isotype switching. Eur J Immunol 35, 946–956. 23 Telfer JC & Rothenberg EV (2001) Expression and function of a stem cell promoter for the murine CBFalpha2 gene: distinct roles and regulation in natural killer and T cell development. Dev Biol 229, 363–382. 24 Liu H, Carlsson L & Grundstrom T (2006) Identi- fication of an N-terminal transactivation domain of Runx1 that separates molecular function from global differentiation function. J Biol Chem 281, 25659– 25669. Transcriptional activation by Runx3 D. D. Chung et al. 3438 FEBS Journal 274 (2007) 3429–3439 ª 2007 The Authors Journal compilation ª 2007 FEBS [...]... Thirunavukkarasu K, Mahajan M, McLarren KW, Stifani S & Karsenty G (1998) Two domains unique to osteoblast-specific transcription factor Osf2 ⁄ Cbfa1 contribute to its transactivation function and its inability to heterodimerize with Cbfbeta Mol Cell Biol 18, 4197–4208 26 Xiao ZS, Hinson TK & Quarles LD (1999) Cbfa1 isoform overexpression upregulates osteocalcin gene expression in non-osteoblastic and pre-osteoblastic... pre-osteoblastic cells J Cell Biochem 74, 596–605 Transcriptional activation by Runx3 27 Harada H, Tagashira S, Fujiwara M, Ogawa S, Katsumata T, Yamaguchi A, Komori T & Nakatsuka M (1999) Cbfa1 isoforms exert functional differences in osteoblast differentiation J Biol Chem 274, 6972–6978 28 Kanatani N, Fujita T, Fukuyama R, Liu W, Yoshida CA, Moriishi T, Yamana K, Miyazaki T, Toyosawa S & Komori T (2006)... Moriishi T, Yamana K, Miyazaki T, Toyosawa S & Komori T (2006) Cbf beta regulates Runx2 function isoform-dependently in postnatal bone development Dev Biol 296, 48–61 FEBS Journal 274 (2007) 3429–3439 ª 2007 The Authors Journal compilation ª 2007 FEBS 3439 . The Runx3 distal transcript encodes an additional transcriptional activation domain David D. Chung 1 , Kazuho Honda 2, *,. novel activation domain in D -RUNX3 To analyze the transcriptional activation potential of the RUNX3 isoforms, independent of the runt domain binding to