Experimental Cell Research (xxxx) xxxx–xxxx Contents lists available at ScienceDirect Experimental Cell Research journal homepage: www.elsevier.com/locate/yexcr Platelet rich plasma (PRP) induces chondroprotection via increasing autophagy, anti-inflammatory markers, and decreasing apoptosis in human osteoarthritic cartilage Mayssam Moussaa, Daniel Lajeunesseb, George Hilalc, Oula El Atata, Gaby Haykald, Rim Serhala, ⁎ Antonio Chalhoube, Charbel Khalila, Nada Alaaeddinea, a Regenerative medicine and inflammation Laboratory, Faculty of Medicine, Saint-Joseph University, Beirut, Lebanon Research Centre in Osteoarthritis, Research Centre in Monteral University, Canada Cancer and metabolism Laboratory, Faculty of Medicine, Saint-Joseph University, Beirut, Lebanon d Hotel Dieu de France, Faculty of Medicine, Saint-Joseph University, Beirut, Lebanon e Carantina Hospital, Beirut, Lebanon b c A R T I C L E I N F O A BS T RAC T Keywords: Platelet rich plasma Osteoarthritis Autophagy Apoptosis Anti-inflammatory cytokines Objectives: Autophagy constitutes a defense mechanism to overcome aging and apoptosis in osteoarthritic cartilage Several cytokines and transcription factors are linked to autophagy and play an important role in the degradative cascade in osteoarthritis (OA) Cell therapy such as platelet rich plasma (PRP) has recently emerged as a promising therapeutic tool for many diseases including OA However, its mechanism of action on improving cartilage repair remains to be determined The purpose of this study is to investigate the effect of PRP on osteoarthritic chondrocytes and to elucidate the mechanism by which PRP contributes to cartilage regeneration Methods: Osteoarthritic chondrocytes were co-cultured with an increasing concentration of PRP obtained from healthy donors The effect of PRP on the proliferation of chondrocytes was performed using cell counting and WST8 proliferation assays Autophagy, apoptosis and intracellular level of IL-4, IL-10, and IL-13 were determined using flow cytometry analyses Autophagy markers BECLIN and LC3II were also determined using quantitative polymerase chain reaction (qPCR) qPCR and ELISA were used to measure the expression of ADAMDTS-5, MMP3, MMP13, TIMP-1–2–3, aggregan, Collagen type 2, TGF-β, Cox-2, Il-6, FOXO1, FOXO3, and HIF-1 in tissues and co-cultured media Results: PRP increased significantly the proliferation of chondrocytes, decreased apoptosis and increased autophagy and its markers along with its regulators FOXO1, FOXO3 and HIF-1 in osteoarthritic chondrocytes Furthermore, PRP caused a dose-dependent significant decrease in MMP3, MMP13, and ADAMTS-5, IL-6 and COX-2 while increasing TGF-β, aggregan, and collagen type 2, TIMPs and intracellular IL-4, IL-10, IL-13 Conclusion: These results suggest that PRP could be a potential therapeutic tool for the treatment of OA Introduction Osteoarthritis (OA) is a chronic debilitating disease which mainly affects the diarthrodial joints The pathophysiology of OA involves a cross talk between cartilage, bone and synovial tissue leading to the vicious circle of inflammation and cartilage degradation [1,2] Preserving the integrity of cartilage involves maintaining healthy chondrocytes Autophagy regulates the chondrocyte lifecycle and it constitutes a defense mechanism used by articular cartilage to overcome aging and apoptosis in OA cartilage [3,4] List of abbreviations: OA, osteoarthritis; PRP, Platelet rich plasma; TGFβ, Transforming growth factor β; IL-4, Interleukin 4; IL-10, Interleukin 10;; IL-13, Interleukin 13;; IL-1β, Interleukin 1β; IL-6, Interleukin 6; TNF-α, Tumor necrosis factor α; FOXO, Forkhead box protein O; MMPs, metalloproteases; ADAMTS, disintegrin and metalloproteinase with thrombospondin motifs; TIMPS, Tissue inhibitor of metalloproteinase; COX2, cyclooxygenase2; COL2A1, collagen type alpha-1 chain; PDGF, platelet derived growth factors; IGF, insulin like growth factors; PF-4, Platelet factor 4; FGF, fibroblast growth factor; VEGF, vascular endothelial growth factor; HIF-1, Hypoxia-inducible factor 1-alpha; BAD, Bcl-2associated death promoter; BCL-2, B-cell lymphoma 2; LC3II, microtubule-associated light chain 3; BECLIN, mammalian orthologue of yeast Atg6; Caspase, cysteine-aspartic proteases, cysteine aspartases or cysteine-dependent aspartate-directed proteases ⁎ Corresponding author E-mail addresses: Moussa-mayssam@hotmail.com (M Moussa), daniel.lajeunesse@umontreal.ca (D Lajeunesse), George2266@gmail.com (G Hilal), oulaatat@hotmail.com (O El Atat), Gaby.haykal@hdf.usj.edu.lb (G Haykal), rim.basbous@gmail.com (R Serhal), Mava.o@hotmail.com (A Chalhoub), charbelk3@hotmail.com (C Khalil), Nada.aladdin@gmail.com (N Alaaeddine) http://dx.doi.org/10.1016/j.yexcr.2017.02.012 Received 28 October 2016; Received in revised form 19 January 2017; Accepted February 2017 0014-4827/ © 2017 Elsevier Inc All rights reserved Please cite this article as: Moussa, M., Experimental Cell Research (2017), http://dx.doi.org/10.1016/j.yexcr.2017.02.012 Experimental Cell Research (xxxx) xxxx–xxxx M Moussa et al 2.2 PRP preparation The interplay between catabolic factors and anabolic factors describes the events occurring in osteoarthritic cartilage with a shift towards catabolic mediators Several anabolic factors such as TGF-β1 and anti-inflammatory cytokines (interleukins IL-4, IL-10 and IL-13) are secreted by chondrocytes, which stimulate the synthesis of extracellular matrix, therefore cartilage repair [5,6] Yet, the secretion of these factors is not enough to counterbalance the effect of inflammatory mediators IL-1β and TNF-α, two major pro-inflammatory cytokines, play the role of stimulators of the inflammatory and degradative cascades in OA [7] They reduce the transcription factors FOXO protein expression, habitually expressed in normal human cartilage and linked to autophagy [8] They increase the expression of proteinases MMPs and ADAMTS such as MMP-3/MMP-13/ADAMTS5 inhibit the synthesis of natural protease inhibitors (TIMPs), and increase the synthesis and release of eicosanoids (E2 prostaglandins) to further degrade the joint tissues [9–14] Most of the treatments for OA are palliative and not stop the progression of the disease nor replace the degrading cartilage Cell therapy such as platelet rich plasma has recently emerged as a promising therapeutic tool for many diseases including Osteoarthritis Platelet rich plasma (PRP) consists of a high concentration of autologous platelets [15] Dense granules in platelets store and release more than 300 molecules after activation by exposure to collagen or calcium/thrombin [16] The potential therapeutic effect of PRP is due to various cytokines, growth factors such as platelet derived growth factors (PDGF), transforming growth factors β1 (TGFβ1), insulin like growth factors (IGF), platelet factor (PF-4), fibroblast growth factor (FGF-2) and vascular endothelial growth factor (VEGF) which are thought to accelerate natural healing process and promote cartilage repair [17–19] Those cytokines and growth factors recruit resident stem cells to the site of injury, where they are stimulated to secrete additional growth factors and anti-inflammatory cytokines, causing more increase in collagen and matrix synthesis Furthermore the recruited stem cells will react with the environment to differentiate into cartilage and replace the injured one [20,21] Although numerous clinical trials indicate that PRP is a promising treatment for cartilage injuries and joint inflammation in OA, its mechanism of action on improving cartilage repair remains to be determined The purpose of this study is to investigate the effect of PRP on osteoarthritic chondrocytes including autophagy and apoptosis, and to elucidate the mechanism by which PRP contributes to cartilage repair and regeneration In order to prepare different samples of PRP, venous blood was collected from healthy donors (mean age 20 ± 15 years) using a sterile 20 ml syringe containing 3.8% sodium citrate solution Under a laminar flow hood, the blood from the syringe was transferred gently to a 50 ml centrifuge tube The PRP preparation procedure consisted of two centrifugation steps The initial centrifugation at 1500 rpm for 15 at room temperature separates the whole blood into three layers: an upper layer containing mostly platelets and WBC (White Blood Cells), an intermediate thin layer known as the buffy coat rich in WBC, and a bottom layer that consists mostly of RBCs (Red Blood Cells) Most of the red blood cells were eliminated and the upper layer and buffy coat are transferred to an empty sterile tube and centrifuged at 2800 rpm for for PRP collection 2.3 Cells treatment and morphological observation To determine the effect of PRP on osteoarthritic chondrocytes a coculture system was created Osteoarthritic chondrocytes cells were plated in 6-well plates with ml of DMEM: F12, and 10%FBS at a concentration of 105 cells/ml After 48 h, the media was discarded and cells were treated with free serum DMEM or free serum DMEM supplemented with increasing concentration of PRP (5%, 10% and 20%) for another 48 h Morphological observations were performed under phase-contrast microscope 2.4 Giemsa staining Cells were seeded on cover slips at density 5ì103 per slide suspended in 50 àl of serum free media with or without PRP and incubated for 48 h at 37 °C The cells were then washed with phosphate-buffered saline (PBS), and fixed with 1:2 methanol/PBS for then with methanol 100% for 15 at room temperature Cells were immersed in a Giemsa solution for at room temperature Staining was followed by rinsing the coverslips for in water, air-dried, and observing the slides under microscope 2.5 Autophagy detection We first used propidium iodide staining to detect autophagy After 48 h of PRP treatment, chondrocytes were harvested and washed by cold phosphate-buffered saline and fixed by cold ethanol Cells were suspended in 0.3 ml of propidium iodide solution (69 µM propidium iodide (Sigma catalog #P4170) in 38 mM sodium Citrate), then incubated with 10 µl of RNAse (Invitrogen catalog #12091-039) at 37 °C for 30–45 The fluorescence was read on a Macsquant analyzer device Next, we used the autophagy assay kit (sigma Aldrich #MAK 138) to determine the formation of autophagosomes by flow cytometry analysis Last, we used Real-time PCR to detect the autophagy marker BECLIN and the autophagy initiation maker LC3II Real-time PCR was performed as described below and primers are indicated in the Table Materials and methods 2.1 Chondrocyte Isolation and Culture Osteoarthritic knee cartilage was obtained from 12 patients undergoing total knee replacement surgery who were diagnosed based on the criteria developed by the American College of Rheumatology Diagnostic Subcommittee for OA/RA (mean age 55 ± 15 years; women and men) and the diagnosis of Kellgren-Lawrence grade osteoarthritis of the knee joint [22] Saint Joseph University and Hotel Dieu de France (Beirut, Lebanon) Ethics Review Board approved the use of specimens obtained surgically OA patients were asked to read the consent forms and approve/sign them prior to surgery Cartilage slices were cut into pieces (2–3 mm2), washed with DMEM (Whittaker MAB Bioproducts, Walkerville, MD), and treated for 15 with trypsin (10% vol/vol) in a 37 °C water bath The tissues were transferred to DMEM, 5% FBS(Fetal Bovine Serum), penicillin– streptomycin– fungizone, and mg/ml clostridial collagenase type IV (Sigma, St Louis, MO) and digested overnight on a gyratory shaker Then, the cells were washed three times with Hank's buffer and cultured in DMEM F12 supplemented with 10% FBS with a cell density 106 cells per flask 75 cm2 For all experiments, cells were used in primary or first passage culture 2.6 Proliferation test The effect of PRP on the proliferation of osteoarthritic chondrocytes was evaluated using a cell -counting kit (CCK-8, sigma Aldrich) according to the manufacturer recommendations Chondrocytes were treated with different concentration of PRP (5%, 10% and 20%) in 96 well plates Cells cultured in serum free media without PRP were considered as control At the indicated time points, the proliferation was evaluated by recording the absorbance at 450 nm of reduced WST8 (2-(2-methoxy-4-nitrophenyl)−3-(4-nitrophenyl)−5-(2, 4-disulfophenyl)−2-H-tetrazolium, monosodium salt) in triplicate wells per condition Experimental Cell Research (xxxx) xxxx–xxxx M Moussa et al Table1 List of primer sequences for real time PCR Primers Forward Reverse ADAMTS5 COX2 IL6 Col 2A1 Aggrecan TIMP TIMP TIMP3 MMP3 MMP13 TGFβ Bad Caspace−3 Bcl2 FOXO1 FOXO3 HIF1-α BECLIN1 LC3II GAPDH 5′-GTCCAAATGCACTTCAGCCA−3′ 5′-TGACCAGAGCAGGCAGATGAA−3′ 5′ -GGTACATCCTCGACGGCATCT−3′ 5′-TGCCGGATCTGTGTCTGTGA−3′ 5′-AGGCAGCGTGATCCTTACC−3′ 5′-GACCAAGATGTATAAAGGGTTCCAA−3′ 5′-AGGCGTTTTGCAATGCAGAT−3′ 5′-CAGGACGCCTTCTGCAACTC−3′ 5′-TCGTTGCTGCTCATGAAATTG−3′ 5′-CCGAGGAGAAACAATGATCT−3′ 5′-CGCGTGCTAATGGTGGAAA−3′ 5′-ACTGAGGTCCTGAGCCGACA−3′ 5′-CTCTGGTTTCGGTGGGTGT−3′ 5′-GAACTGGGGGAGGATTGTGG−3′ 5′-CCGATACTCTGAGAAGTGCCT−3′ 5′-TCTTCAGGTCCTCCTGTTCCTG−3′ 5′-TTGGCAATTGGATTGGATG−3′ 5′-AGCTGCCGTTATACTGTTCTG−3′ 5′-GATGTCCGACTTATTCGAGAGC−3′ 5′-GCACCACCAACTGCTTAGCA−3′ 5′-GGTGGCATCGTAGGTCTGTC−3′ 5′-CCACAGCATCGATGTCACCATAG−3′ 5′ -GTGCCTCTTTGCTGCTTTCAC−3′ 5′-GGCAGCAAAGTTTCCACCAA−3′ 5′-GGCCTCTCCAGTCTCATTCTC−3′ 5′-GAAGTATCCGCAGACACTCTCCAT−3′ 5′-TCCAGAGTCCACTTCCTTCTCACT−3′ 5′-AGCTTCTTCCCCACCACCTT−3′ 5′-GCTTCAGTGTTGGCTGAGTGAA−3′ 5′-GCCTGTATCCTCAAAGTGAA−3′ 5′-TGTGTGTACTCTGCTTGAACTTGTCA−3′ 5′TCTGGGCTGTGAGGACAAGAT−3′ 5′TCCAGAGTCCATTGATTCGCT−3′ 5′-CCGTACAGTTCCACAAAGGC−3′ 5′-GTGGCTGACAAGACTTAACTCAA−3′ 5′GGAAGCACCAAAGAAGAGAAG−3′ 5′-CTCCGACATTGGGAGCTCAT−3′ 5′-ACTGCCTCCTGTGTCTTCAATCTT−3′ 5′- TTGAGCTGTAAGCGCCTTCTA−3′ 5′-CTTCCACGATACCAAAGTTGTCAT−3′ treated and control cells supernatants, quantitative enzyme linked immunosorbent assays (R & D, Abingdon,-United Kingdom) were performed according to the manufacturer's protocol The optical density is determined using an ELISA plate reader at 450 nm 2.7 Apoptosis To determine the effect of PRP on the apoptosis of osteoarthritic chondrocytes, an annexin V/FITC kit (Miltenyi Biotec) was used according to the manufacturer's instructions 106 of freshly obtained cells were washed and re-suspended in 100 µl of binding buffer 10 µl of annexin V-FITC were then added to each sample After a 15 incubation in the dark, 500 µl of binding buffer and µl of propidium iodide solution per sample were added The flow cytometry analyses were carried out using a Macsquant analyzer device For each sample, 104 cells were analyzed Calculation of apoptotic cells was performed using the computer program Macsquant software 2.11 RNA extraction and Real-time PCR Total RNA from samples were extracted using QIAamp RNA extraction Kit (Qiagen Inc., Valencia, CA, USA) RNA quality and yields were analyzed using nanodrop Complementary DNA (cDNA) was synthesized from 500 ng of total RNA in a 20 µl reaction solution using iScript™ Cdna-synthesis Kit (Bio-Rad Laboratories, CA) Real-time PCR was performed with the iQ™ SYBR® Green Supermix (Bio-Rad Laboratories, CA) in triplicate The reaction conditions were: Polymerase Activation at 95 °C for min, 40 cycles of denaturation at, 95 °C for 20 s and annealing and extension at 62 °C for 20 s The relative quantification of gene expression was normalized to the expression of endogenous GAPDH 2.8 Examination of apoptosis by 4,6-diamidino-2-phenylindole, dihydrochloride (DAPI) staining Osteoarthritic chondrocytes were cultured on glass slides for 48 h then treated by different concentrations of PRP, while the control chondrocytes were cultured in serum free media without PRP After a 48-h incubation, the slides were rinsed with PBS and fixed in 3.7% formaldehyde for 10 at room temperature Following two washes with PBS, cells were stained with 1x DAPI staining diluted in PBS for 15 The slides were then visualized on a fluorescence microscope 2.12 Statistical analysis The experimental data was expressed as mean ± standard deviation The differences between the groups were analyzed by ANOVA for multiple comparisons followed by appropriate sub-tests when statistical difference was reached A p < 0.005 value was considered as statistically significant 2.9 Measure of IL-10/IL-4/IL-13 intracellular interleukins To determine the intracellular expression of IL-10/ IL-4/ IL-13 by the osteoarthritic chondrocytes and to detect the effect of PRP on the expression of IL-10/ IL-4/ IL-13, cells were washed twice with PBS, then fixed and permeabilized using the Cytofix/Cytoperm™ Kit (BD, USA) according to the manufacturer's instructions Briefly, cells were incubated with a fixation permeabilization solution for 20 at °C After incubation, cells were washed twice with Perm/Wash™ buffer, and then stained with the appropriate PE-conjugated monoclonal antibodies against human IL-10/ IL-4/ IL-13 (Milteny Biotec) for 30 at °C in the dark Finally, the cells were washed twice with Perm/Wash™ buffer and re-suspended in ranging buffer for the flow cytometry analysis Results 3.1 Effect of PRP on osteoarthritic chondrocytes proliferation In order to study the effect of PRP on chondrocytes proliferation, chondrocytes were isolated and treated for 48 h with different concentrations of PRP (5%, 10% and 20%) The microscopic observation showed that the chondrocytes kept their normal morphology following PRP treatments, and showed a dose dependent increase in number, indicating an increase in chondrocyte proliferation (Fig 1A) We found a dose-dependent induction of the proliferation of chondrocytes in response to increasing doses of PRP and a significant enhancement with 10% and 20% concentrations This result was similar for both tests, trypan blue cell count (Fig 1B) and WST-8 test (Fig 1C) (P≤0.005) 2.10 Human protease (MMPs-ADAMTS-5)/protease inhibitor (TIMPs) levels To test the level of MMP-3, MMP13, ADAMTS5 and TIMP1-2–3 in Experimental Cell Research (xxxx) xxxx–xxxx M Moussa et al Fig Effect of PRP on the proliferation of chondrocytes 105 chondrocytes were seeded in well plates in presence or absence of different concentration of PRP (5%, 10% and 20%) for 48 h (A) Microscopic observation of chondrocytes showed normal morphology and increased cell number with PRP treatment (B) The proliferation of chondrocytes was assessed by Cell count assay and (C) WST-8 proliferation test Both tests showed a significant augmentation in the proliferation rate of chondrocytes Data is representative of five independent experiments Data is represented as mean ± SD Significantly different groups *P < 0.05, **P < 0.005, ***P < 0.001 Fig Effect of increasing concentration of PRP on autophagy in chondrocytes Autophagy was evaluated following different approaches: (A) Giemsa staining showed a dose dependent increase in the formation of vacuoles; (B) Flow cytometry following treatments with autophagosome detection reactifs revealed an increase in autophagosome formation Real time PCR experiments showed a significant dose-dependent increase of (C) BECLIN and (D) LC3II mRNA levels in response to increasing doses of PRP Similar results were observed for (E) FOXO1, FOXO3 and (F) for HIF-1 in response to increasing doses of PRP Data is representative of five independent experiments Data is represented as mean ± SD Significantly different groups *P < 0.05, **P < 0.005, ***P < 0.001 Experimental Cell Research (xxxx) xxxx–xxxx M Moussa et al Fig Effect of PRP on chondrocytes quiescence Cell death levels in chondrocytes treated with different PRP concentrations was determined by the iodide propidium (PI) method The staining revealed a dose dependent increase in quiescent cells percentage Data is representative of five independent experiments Data is represented as mean ± SD 3.2 PRP enhanced chondrocytes autophagy 3.3 PRP induces chondrocytes quiescence In order to investigate if PRP modulate autophagy in osteoarthritic chondrocyte, Giemsa staining was performed The light microscopic observation of the cells revealed the formation of vacuoles in the cytoplasm It showed a dose-dependent increase in vacuoles formation with increasing PRP concentration This suggests the induction of autophagy in OA chondrocytes by PRP (Fig 2A) The flow cytometry analysis performed following treatments with autophagosome detection reactifs (autophagy assay kit sigma Aldrich) also demonstrated an increase in autophagosome formation in response to increasing PRP doses (Fig 2B) Next, we determined the expression of autophagy markers, BECLIN and LC3II, by real-time PCR in response to PRP Fig 2C and D show the data for BECLIN and LC3II expression respectively Moreover, in order to elucidate if PRP affects the regulators of aging involved in cartilage a qPCR analysis for the expression of FOXO1 and FOXO3 and HIF-1 was performed Our results showed an upregulation in FOXO1/FOXO3 and HIF-1 mRNA expression respectively with all PRP concentration (P≤0.005) (Fig 2EF) Since PRP increased autophagy and autophagy is known to maintain quiescence and reverse senescence, we studied the effect of PRP on chondrocytes quiescence Chondrocytes were cultured with increasing concentrations of PRP and a flow cytometry analysis was assessed using propidium iodide Ours results showed that the percentage of quiescent cells which increased from control values of 13.5% to values equal to 25,4%, 60,2%, 92% in response to 5%, 10% and 20% PRP concentration respectively (P≤0.001) (Fig 3) 3.4 PRP inhibited chondrocytes apoptosis Since autophagy and apoptosis are inter-related, we wanted to determine if PRP had also an effect on chondrocytes apoptosis Chondrocytes were harvested after 48 h of culture in presence of increasing concentrations of PRP to perform apoptotic cell death analysis by flow cytometry Our results showed that 5%, 10% and 20% PRP significantly decreased the apoptotic ratios of osteoarthritic chondrocytes by 37.63%, 37.97% and 38.65% respectively compared to the control (Fig 4A) (P≤0.001) Consistent with these results a DAPI blue fluorescence staining Experimental Cell Research (xxxx) xxxx–xxxx M Moussa et al Fig Effect of PRP on chondrocytes cell death (A) Flow cytometry analysis using Annexin V/PI showed a decrease in cell death percentage The decrease rate was calculated by subtracting the value from the control (B) Dapi Staining revealed a decrease in blue fluorescence relative to the increase in PRP concentration (C) real time PCR showed an increase in BCL2 mRNA levels and a decrease in BAD and Caspace-3 mRNA levels The results were displayed as percentage of controls Data is representative of five independent experiments as mean ± SD Significantly different groups *P < 0.05, **P < 0.005, ***P < 0.001 3.5 Effect of PRP on inflammatory mediators revealed a reduction of chondrocytes apoptosis with all PRP concentration with highest cell reduction seen at 20% PRP (Fig 4B) Furthermore, to examine if PRP induces an alteration in the expression of apoptosis-related genes, we studied the expression of BAD, Caspase-3 and BCL-2 by real time PCR We observed that PRP significantly decreased the mRNA level of BAD and Caspase-3 and increased the mRNA level of BCL-2 (P≤0.05) (Fig 4C) Upregulation of inflammatory mediators in the early and late stages of OA is linked to caspases and inflammasome-dependent responses contributing to the structural changes observed in OA joints In osteoarthritis, the increase of IL-6 and COX-2 levels and the decrease of TGF-β and intracellular interleukin, IL-4, IL-10 and IL-13, levels expose the cartilage to chronic inflammatory conditions Hence, we determined the effect of PRP on the above mentioned cytokines levels we compared TGF-β, IL-6 and COX-2 mRNA levels between control Experimental Cell Research (xxxx) xxxx–xxxx M Moussa et al cartilage matrix via a decrease of the expression of collagen and aggrecan The expression of collagen and aggrecan is associated with a balance between protease and protease inhibitors To determine whether PRP has an effect on the chondrocytes response in terms of protease/protease inhibitor release, chondrocytes were stimulated with PRP at varying concentrations and the effects on the expression at the mRNA and protein level were screened by q-PCR and ELISA respectively The relative expression of MMP3 decreased with different PRP concentrations but it was only significant with 20% PRP (P=0.005) at the mRNA level (Fig 7-A) and with 10% and 20% at the protein level (P≤0.005) (Fig 7-B) Conversely, the mRNA and protein expressions of MMP13 and ADAMTS5 decreased significantly in a dose-dependent manner with all PRP concentrations (P≤0.001) (Fig 7A-B respectively) Moreover, the protein expression of tissue inhibitor metalloproteinase TIMP1/3 was significantly increased with 10% and 20% PRP (P≤0.005) mRNA expression of TIMP1 was increased significantly by all PRP concentrations used (P≤0.005) contrary to TIMP2 mRNA expression which was not affected by PRP TIMP3 mRNA expression increased significantly with 10% and 20% PRP (P≤0.005) (Fig 7C-D) The regulation of MMPs and TIMPs was associated with a variation in the expression of extracellular matrix components collagen type and aggrecan The expression of these markers detected by q-PCR was higher in treated cells compared to control cells (P≤0.005) (Fig 7E) Discussion The amalgam between apoptosis, autophagy and the keys regulators of autophagy such as ADAMDTS-5, MMPs and collagen determine the degree of cartilage degradation and severity of osteoarthritis Till today no medical treatment is capable considerably of reducing cartilage degradation, inflammation and progression of the disease All present treatments are palliative Recently, platelet rich plasma was reported to have anabolic effects on cartilage and is being used in clinical practice for the treatment of degenerative articular lesions in osteoarthritis, in tendinitis and other sports injuries [23–27] whereas we still have limited information on its mechanism of action In our study, we found that platelet rich plasma increased the proliferation of chondrocytes, decreased apoptosis and increased autophagy in human osteoarthritic chondrocytes Furthermore, PRP caused a dose-dependent decrease in MMP3, MMP13, and ADAMDTS-5, IL-6 and COX-2 while increased TGF-β, aggregan, collagen, TIMPs and intracellular anti-inflammatory cytokines IL-4, IL-10, and IL-13 Autophagy is a mechanism of cell survival It has been reported that it can protect against diverse diseases such as cancer [28–31], heart diseases [32–35], and aging [36,37] In tissues with little turnover such as articular cartilage, reversible quiescence is the normal stem-cell state throughout life With aging cartilage, this quiescence will be lost due to intrinsic alterations [38,39] Senescence and autophagy are interrelated, and Garcia-Prat et al showed that re-establishment of autophagy will reverse senescence and restores regenerative functions in aged cells [40] Here we show that PRP induced a dose-dependent increase in chondrocytes quiescence thus reversing senescence of chondrocytes Hence, we propose that the same mechanism described by Garcia-Prat et al is taking place in OA cartilage, where autophagic cell death in aged OA chondrocytes [41] contributes to cartilage degradation and synovial inflammation PRP is reversing this mechanism by revamping autophagy and, thus reversing senescence In in situ articular cartilage, it could activate resident stem cells to renew this tissue Our study is the first to demonstrate a role for PRP in restoring autophagy and promoting autophagosome formation In addition, the transcription factors FOXO1 and FOXO3 were also significantly increased in a dosedependent manner when chondrocytes were cultured with PRP We observed similar results with HIF-1 which is an accelerator of autophagy A direct protein-protein interaction of HIF-1 and FOXO3 Fig Effect of PRP on TGFβ, IL-6 and COX2 expression The expression of (A) TGFβ, (B) IL-6 and (C) COX2 was analyzed by quantitative real time PCR in OA cartilage from OA donors Values are representative of eight independent experiments Data is represented as mean ± SD Significantly different groups *P < 0.05, **P < 0.005, ***P < 0.001 and treated chondrocytes Interestingly, a q-PCR analysis showed a decrease in COX-2 and IL-6 expression in a dose dependent manner (P≤0.005) In contrast, a significant increase in TGF-β expression was only observed in response to 10% and 20% PRP (P≤0.001) (Fig 5A-B-C respectively) In addition, flow cytometry analyses showed a significant upregulation of the intracellular anti-inflammatory cytokines IL-10, IL-4 and IL-13 with all PRP concentrations (P≤0.005) (Fig 6A-B-C respectively) 3.6 Regulation of Protease/protease inhibitor, collagen and aggrecan expression in OA chondrocytes by PRP The inflammatory mediators in OA decrease the production of the Experimental Cell Research (xxxx) xxxx–xxxx M Moussa et al Fig Expression of Intracellular Interleukin IL-4, IL-10 and IL-13 Flow cytometry analysis showed an increase in intracellular IL-10 (A), IL-13 (B) and IL-4 (C) levels with PRP increasing concentration Values are representative of three independent experiments Data is represented as mean ± SD aggregan This suggests that PRP has a role in cartilage formation while inhibiting cartilage degradation The decrease in MMPs, upregulation of TIMPs, collagen and aggregan by PRP was confirmed by various research groups while others mention either no effect, or a decrease in these parameters [51–54] The discrepancy in the results might be due to PRP preparations, the time of incubation and most importantly to the stage and severity of OA We obtained our cartilage samples from severe osteoarthritic cases, mostly grade IV Our results therefore indicate a potential therapeutic catabolic anti-inflammatory role for PRP on osteoarthritic cartilage; this role is consistent with our findings on the increase of anti-inflammatory mediators, IL-4, IL-10, IL-13 and TGF-β To our knowledge there is no other report on the effect of PRP on anti-inflammatory cytokines in vitro PRP increased significantly the intracellular expression of the three key cytokines known to play a major role in inhibiting inflammation and decreasing IL-1β mediated catabolic effect Current treatments for OA are palliative and focused on alleviating the symptoms but not stopping the progression or curing the disease We think that PRP has a major role in modulating all the factors playing a role in the disease mechanism leading to cartilage degradation and perpetuating inflammations namely apoptosis, autophagy, MMPs, and ADAMDTs among others We suggest that PRP through the activation of the alpha granule and degranulation of its proteins such as PDGF, TGF-β, CTGF and FGF will bind to their respective receptors on collagen, osteoclast and chondrocytes to stimulate cartilage matrix synthesis and tissue regeneration hence inducing chondroprotection It will also stimulate the resident cells to secrete other growth factors and anti-inflammatory cytokines to reduce inflammation and have similar protective effect on has been demonstrated in other studies where HIF-1 increases the FOXO3 protein synthesis, confirming the boosting effect of FOXO on autophagy [42] Dysregulation in the expression and activation of FOXO is involved in cartilage aging and osteoarthritis [8] It has been reported that FOXO regulates the mechanisms of cellular aging including autophagy [43,44], and apoptosis [45–47] The downregulation of FOXO increases the susceptibility to cell death [46] In our study the increase in FOXO1 and FOXO3 and HIF-1 was accompanied by a decrease in apoptosis The addition of increasing doses of PRP induced a significant decrease in the expression of caspase and Bad while increasing significantly Bcl2 expression The effect of PRP on apoptosis of osteoarthritic chondrocytes was not investigated directly before Limited in vitro studies were performed on the role of PRP on chondrocytes apoptosis but they were combined with other molecules such as self-assembled peptide or stem cells [48,49] and both studies described decreased apoptosis in the presence of PRP A strict interplay between apoptosis and inflammation is observed, such as when apoptosis increases, inflammatory mediators increase [50] The inflammation of the synovial membrane occurring in both the early and late phases of OA is associated with alterations in the adjacent cartilage The degradation of cartilage will perpetuate the inflammatory loop and lead to more degradation of cartilage and the non-stop of this vicious circle The therapeutic aims in osteoarthritis are to interrupt this vicious circle, inhibit the inflammatory mediators, decrease the mediators of cartilage degradation and stimulate new cartilage formation In our study PRP increased cell proliferation, decreased MMP-3, MMP-13 and ADAMDTS-5 expression at both the protein and mRNA levels while increasing TIMPS, collagen and Experimental Cell Research (xxxx) xxxx–xxxx M Moussa et al Fig Effect of PRP on metalloproteases, tissue inhibitor metalloproteases expression and extracellular matrix components (A-C) MMPs, ADAMTS-5 and TIMPs mRNA levels was analyzed by quantitative PCR (B-D) Protein level was quantified on the supernatant of PRP treated chondrocytes by Elisa (E) AGG and COL2A1 expression was analyzed by quantitative PCR Values are representative of eight independent experiments Data is represented as mean ± SD Significantly different groups *P < 0.05, **P < 0.005, ***P < 0.001 Author contributions chondrocytes contributing to the reparative mechanism We speculate that, in vivo, the effect will be much stronger and effective due to the presence of stem cells PRP increase the proliferation and the secretion of anti-inflammatory cytokines and growth factors [55] such as TGF-β that will bind to these resident stem cells which will be activated and triggered to secrete their anti-inflammatory and other growth factors which will potentiate further the chondroprotective effect through their paracrine and trophic effect Furthermore, the activation of the resident stem cells will push them to differentiate into new articular cartilage restoring the defect caused by the disease In conclusion, we think that PRP could be a potential therapeutic target for the treatment of osteoarthritis with or without the addition of stem cells depending on the age and the condition of the patient Nada Alaaeddine: conception and design, data analysis and interpretation, manuscript writing, final approval of manuscript Mayssam Moussa: conception and design, collection or assembly of data, data analysis and interpretation, manuscript writing Daniel Lajeunesse: conception and design, data analysis and interpretation Oula El Atat: collection or assembly of data, George Hilal: conception and design Gaby Haykal: provision of study material Rim Serhal: collection or assembly of data, data analysis and interpretation Antonio Chalhoub: Provision of study material Charbel Khalil: collection of data Declarations Funding This work was supported by the Research Council of Saint-Joseph University (Grant no FM 250) The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript Competing interests The authors have no conflicts of interests Experimental Cell Research (xxxx) xxxx–xxxx M Moussa et al [24] G Filardo, E Kon, R Buda, A Timoncini, A Di Martino, A Cenacchi, et al., Platelet-rich plasma intra-articular knee injections for the treatment of degenerative cartilage lesions and osteoarthritis, Knee Surg Sports Trauma Arthrosc J ESSKA 19 (2011) 528–535 http://dx.doi.org/10.1007/s00167-010-1238-6 [25] A.F Manunta, A Manconi, The treatment of chondral lesions of the knee with the microfracture technique and platelet-rich plasma, Joints (2013) 167–170 [26] E.P Palacio, R.R Schiavetti, M Kanematsu, T.M Ikeda, R.R Mizobuchi, J.A Galbiatti, Effects of platelet-rich plasma on lateral epicondylitis of the elbow: prospective randomized controlled trial, Rev Bras Ortop 51 (2016) 90–95 http:// dx.doi.org/10.1016/j.rboe.2015.03.014 [27] V Salini, D Vanni, A Pantalone, M Abate, Platelet Rich Plasma Therapy in Noninsertional Achilles Tendinopathy: the Efficacy is Reduced in 60-years Old People Compared to Young and Middle-Age Individuals, Front Aging Neurosci (2015) 228 http://dx.doi.org/10.3389/fnagi.2015.00228 [28] Y Zhang, H Song, T Guo, Y Zhu, H Tang, Z Qi, et al., Overexpression of Annexin II Receptor-Induced Autophagy Protects Against Apoptosis in Uveal Melanoma Cells, Cancer Biother Radiopharm 31 (2016) 145–151 http://dx.doi.org/10.1089/ cbr.2016.1991 [29] Q Wang, L Xue, X Zhang, S Bu, X Zhu, D Lai, Autophagy protects ovarian cancer-associated fibroblasts against oxidative stress, Cell Cycle Georg Tex 15 (2016) 1376–1385 http://dx.doi.org/10.1080/15384101.2016.1170269 [30] Y Messai, M.Z Noman, M Hasmim, B Janji, A Tittarelli, M Boutet, et al., ITPR1 protects renal cancer cells against natural killer cells by inducing autophagy, Cancer Res 74 (2014) 6820–6832 http://dx.doi.org/10.1158/0008-5472.CAN-14-0303 [31] W Liu, W Otkur, L Li, Q Wang, H He, Y Ye, et al., Autophagy induced by silibinin protects human epidermoid carcinoma A431 cells from UVB-induced apoptosis, J Photochem Photobio B 123 (2013) 23–31 http://dx.doi.org/ 10.1016/j.jphotobiol.2013.03.014 [32] D Dutta, J Xu, J.-S Kim, W.A Dunn, C Leeuwenburgh, Upregulated autophagy protects cardiomyocytes from oxidative stress-induced toxicity, Autophagy (2013) 328–344 http://dx.doi.org/10.4161/auto.22971 [33] C He, H Zhu, H Li, M.-H Zou, Z Xie, Dissociation of Bcl-2-Beclin1 complex by activated AMPK enhances cardiac autophagy and protects against cardiomyocyte apoptosis in diabetes, Diabetes 62 (2013) 1270–1281 http://dx.doi.org/10.2337/ db12-0533 [34] J McCormick, N Suleman, T.M Scarabelli, R.A Knight, D.S Latchman, A Stephanou, STAT1 deficiency in the heart protects against myocardial infarction by enhancing autophagy, J Cell Mol Med 16 (2012) 386–393 http://dx.doi.org/ 10.1111/j.1582-4934.2011.01323.x [35] A Hamacher-Brady, N.R Brady, R.A Gottlieb, Enhancing macroautophagy protects against ischemia/reperfusion injury in cardiac myocytes, J Biol Chem 281 (2006) 29776–29787 http://dx.doi.org/10.1074/jbc.M603783200 [36] M.K Lotz, B Caramés, Autophagy and cartilage homeostasis mechanisms in joint health, aging and OA, Nat Rev Rheumatol (2011) 579–587 http://dx.doi.org/ 10.1038/nrrheum.2011.109 [37] S Portal-Núñez, P Esbrit, M.J Alcaraz, R Largo, Oxidative stress, autophagy, epigenetic changes and regulation by miRNAs as potential therapeutic targets in osteoarthritis, Biochem Pharmacol 108 (2016) 1–10 http://dx.doi.org/10.1016/ j.bcp.2015.12.012 [38] G Comai, S Tajbakhsh, Molecular and cellular regulation of skeletal myogenesis, Curr Top Dev Biol 110 (2014) 1–73 http://dx.doi.org/10.1016/B978-0-12405943-6.00001-4 [39] J.V Chakkalakal, K.M Jones, M.A Basson, A.S Brack, The aged niche disrupts muscle stem cell quiescence, Nature 490 (2012) 355–360 http://dx.doi.org/ 10.1038/nature11438 [40] L García-Prat, M Martínez-Vicente, E Perdiguero, L Ortet, J Rodríguez-Ubreva, E Rebollo, et al., Autophagy maintains stemness by preventing senescence, Nature 529 (2016) 37–42 http://dx.doi.org/10.1038/nature16187 [41] J Chang, W Wang, H Zhang, Y Hu, M Wang, Z Yin, The dual role of autophagy in chondrocyte responses in the pathogenesis of articular cartilage degeneration in osteoarthritis, Int J Mol Med 32 (2013) 1311–1318 http://dx.doi.org/10.3892/ ijmm.2013.1520 [42] S Zhang, Y Zhao, M Xu, L Yu, Y Zhao, J Chen, et al., FoxO3a modulates hypoxia stress induced oxidative stress and apoptosis in cardiac microvascular endothelial cells, PloS One (2013) e80342 http://dx.doi.org/10.1371/journal.pone.0080342 [43] J Zhao, J.J Brault, A Schild, P Cao, M Sandri, S Schiaffino, et al., FoxO3 coordinately activates protein degradation by the autophagic/lysosomal and proteasomal pathways in atrophying muscle cells, Cell Metab (2007) 472–483 http://dx.doi.org/10.1016/j.cmet.2007.11.004 [44] M Sandri, C Sandri, A Gilbert, C Skurk, E Calabria, A Picard, et al., Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy, Cell 117 (2004) 399–412 [45] C Shen, G.-Q Cai, J.-P Peng, X.-D Chen, Autophagy protects chondrocytes from glucocorticoids-induced apoptosis via ROS/Akt/FOXO3 signaling, Osteoarthr Cartil OARS Osteoarthr Res Soc 23 (2015) 2279–2287 http://dx.doi.org/ 10.1016/j.joca.2015.06.020 [46] Y Akasaki, O Alvarez-Garcia, M Saito, B Caramés, Y Iwamoto, M.K Lotz, FoxO transcription factors support oxidative stress resistance in human chondrocytes, Arthritis Rheuma Hoboken Nj 66 (2014) 3349–3358 http://dx.doi.org/10.1002/ art.38868 [47] F Li, H Qu, H.-C Cao, M.-H Li, C Chen, X.-F Chen, et al., Both FOXO3a and FOXO1 are involved in the HGF-protective pathway against apoptosis in endothelial cells, Cell Biol Int 39 (2015) 1131–1137 http://dx.doi.org/10.1002/ cbin.10486 [48] Y Mifune, T Matsumoto, K Takayama, S Ota, H Li, L.B Meszaros, et al., The effect of platelet-rich plasma on the regenerative therapy of muscle derived stem References [1] S.B Abramson, M Attur, Developments in the scientific understanding of osteoarthritis, Arthritis Res Ther 11 (2009) 227 http://dx.doi.org/10.1186/ ar2655 [2] E.V Tchetina, Developmental mechanisms in articular cartilage degradation in osteoarthritis, Arthritis 2011 (2011) 683970 http://dx.doi.org/10.1155/2011/ 683970 [3] N Liu, W Wang, Z Zhao, T Zhang, Y Song, Autophagy in human articular chondrocytes is cytoprotective following glucocorticoid stimulation, Mol Med Rep (2014) 2166–2172 http://dx.doi.org/10.3892/mmr.2014.2102 [4] B Caramés, N Taniguchi, S Otsuki, F.J Blanco, M Lotz, Autophagy is a protective mechanism in normal cartilage, and its aging-related loss is linked with cell death and osteoarthritis, Arthritis Rheum 62 (2010) 791–801 http://dx.doi.org/ 10.1002/art.27305 [5] B Qiao, S.R Padilla, P.D Benya, Transforming growth factor (TGF)-beta-activated kinase mimics and mediates TGF-beta-induced stimulation of type II collagen synthesis in chondrocytes independent of Col2a1 transcription and Smad3 signaling, J Biol Chem 280 (2005) 17562–17571 http://dx.doi.org/10.1074/ jbc.M500646200 [6] P Wojdasiewicz, Poniatowski ŁA, D Szukiewicz, The role of inflammatory and anti-inflammatory cytokines in the pathogenesis of osteoarthritis, Mediat Inflamm 2014 (2014) 561459 http://dx.doi.org/10.1155/2014/561459 [7] M Kapoor, J Martel-Pelletier, D Lajeunesse, J.-P Pelletier, H Fahmi, Role of proinflammatory cytokines in the pathophysiology of osteoarthritis, Nat Rev Rheumatol (2011) 33–42 http://dx.doi.org/10.1038/nrrheum.2010.196 [8] Y Akasaki, A Hasegawa, M Saito, H Asahara, Y Iwamoto, M.K Lotz, Dysregulated FOXO transcription factors in articular cartilage in aging and osteoarthritis, Osteoarthr Cartil OARS Osteoarthr Res Soc 22 (2014) 162–170 http://dx.doi.org/10.1016/j.joca.2013.11.004 [9] J Stöve, K Huch, K.P Günther, H.P Scharf, Interleukin-1beta induces different gene expression of stromelysin, aggrecan and tumor-necrosis-factor-stimulated gene in human osteoarthritic chondrocytes in vitro, Pathobiol J Immunopathol Mol Cell Biol 68 (2000) 144–149 (doi:55915) [10] M Shakibaei, G Schulze-Tanzil, T John, A Mobasheri, Curcumin protects human chondrocytes from IL-l1beta-induced inhibition of collagen type II and beta1integrin expression and activation of caspase-3: an immunomorphological study, Ann Anat Anat Anz Organ Anat Ges 187 (2005) 487–497 [11] J.A Mengshol, M.P Vincenti, C.I Coon, A Barchowsky, C.E Brinckerhoff, Interleukin-1 induction of collagenase (matrix metalloproteinase 13) gene expression in chondrocytes requires p38, c-Jun N-terminal kinase, and nuclear factor kappaB: differential regulation of collagenase and collagenase 3, Arthritis Rheum 43 (2000) 801–811 http://dx.doi.org/10.1002/1529-0131(200004)43:4 < 801::AID-ANR10 > 3.0.CO;2-4 [12] M.P Vincenti, C.E Brinckerhoff, Transcriptional regulation of collagenase (MMP1, MMP-13) genes in arthritis: integration of complex signaling pathways for the recruitment of gene-specific transcription factors, Arthritis Res (2002) 157–164 [13] E Meszaros, C.J Malemud, Prospects for treating osteoarthritis: enzyme-protein interactions regulating matrix metalloproteinase activity, Ther Adv Chronic Dis (2012) 219–229 http://dx.doi.org/10.1177/2040622312454157 [14] P Verma, K.A.D.A.M.T.S.-4 Dalal, ADAMTS-5: key enzymes in osteoarthritis, J Cell Biochem 112 (2011) 3507–3514 http://dx.doi.org/10.1002/jcb.23298 [15] J.C Peerbooms, J Sluimer, D.J Bruijn, T Gosens, Positive effect of an autologous platelet concentrate in lateral epicondylitis in a double-blind randomized controlled trial: platelet-rich plasma versus corticosteroid injection with a 1-year follow-up, Am J Sports Med 38 (2010) 255–262 http://dx.doi.org/10.1177/ 0363546509355445 [16] J.A Coppinger, G Cagney, S Toomey, T Kislinger, O Belton, J.P McRedmond, et al., Characterization of the proteins released from activated platelets leads to localization of novel platelet proteins in human atherosclerotic lesions, Blood 103 (2004) 2096–2104 http://dx.doi.org/10.1182/blood-2003-08-2804 [17] I Andia, M Abate, Knee osteoarthritis: hyaluronic acid, platelet-rich plasma or both in association?, Expert Opin Biol Ther 14 (2014) 635–649 http:// dx.doi.org/10.1517/14712598.2014.889677 [18] I Andia, N Maffulli, Platelet-rich plasma for managing pain and inflammation in osteoarthritis, Nat Rev Rheumatol (2013) 721–730 http://dx.doi.org/ 10.1038/nrrheum.2013.141 [19] Y Zhu, M Yuan, H.Y Meng, A.Y Wang, Q.Y Guo, Y Wang, et al., Basic science and clinical application of platelet-rich plasma for cartilage defects and osteoarthritis: a review, Osteoarthr Cartil OARS Osteoarthr Res Soc 21 (2013) 1627–1637 http://dx.doi.org/10.1016/j.joca.2013.07.017 [20] A Spreafico, F Chellini, B Frediani, G Bernardini, S Niccolini, T Serchi, et al., Biochemical investigation of the effects of human platelet releasates on human articular chondrocytes, J Cell Biochem 108 (2009) 1153–1165 http://dx.doi.org/ 10.1002/jcb.22344 [21] P Ornetti, G Nourissat, F Berenbaum, J Sellam, P Richette, X Chevalier, et al., Does platelet-rich plasma have a role in the treatment of osteoarthritis?, Jt Bone Spine Rev Rhum 83 (2016) 31–36 http://dx.doi.org/10.1016/ j.jbspin.2015.05.002 [22] J.H Kellgren, J.S Lawrence, Radiological assessment of osteo-arthrosis, Ann Rheum Dis 16 (1957) 494–502 [23] M Dhillon, S Patel, K Bali, Platelet-rich plasma intra-articular knee injections for the treatment of degenerative cartilage lesions and osteoarthritis, Knee Surg Sports Trauma Arthrosc J ESSKA 19 (2011) 863–864-866 http://dx.doi.org/10.1007/ s00167-010-1339-2 10 Experimental Cell Research (xxxx) xxxx–xxxx M Moussa et al [49] [50] [51] [52] of platelet-rich plasma in osteoarthritis, Am J Sports Med 42 (2014) 35–41 http://dx.doi.org/10.1177/0363546513507766 [53] G.M van Buul, W.L.M Koevoet, N Kops, P.K Bos, J.A.N Verhaar, H Weinans, et al., Platelet-rich plasma releasate inhibits inflammatory processes in osteoarthritic chondrocytes, Am J Sports Med 39 (2011) 2362–2370 http://dx.doi.org/ 10.1177/0363546511419278 [54] C Osterman, M.B.R McCarthy, M.P Cote, K Beitzel, J Bradley, G Polkowski, et al., Platelet-rich plasma increases anti-inflammatory markers in a human coculture model for osteoarthritis, Am J Sports Med 43 (2015) 1474–1484 http://dx.doi.org/10.1177/0363546515570463 [55] Amaral RJFC, da Silva, N.P Haddad, N.F Lopes, L.S Ferreira, F.D Filho RB, et al., platelet-rich plasma obtained with different anticoagulants and their Effect on platelet numbers and mesenchymal stromal cells behavior In vitro, Stem Cells Int 2016 (2016) 7414036 http://dx.doi.org/10.1155/2016/7414036 cells for articular cartilage repair, Osteoarthr Cartil 21 (2013) 175–185 http:// dx.doi.org/10.1016/j.joca.2012.09.018 S.J Kim, S.M Lee, J.E Kim, S.H Kim, Y Jung, Effect of platelet-rich plasma with self-assembled peptide on the rotator cuff tear model in rat, J Tissue Eng Regen Med (2015) http://dx.doi.org/10.1002/term.1984 Y Kiraz, A Adan, M Kartal Yandim, Y Baran, Major apoptotic mechanisms and genes involved in apoptosis, Tumour Biol J Int Soc Oncodev Biol Med (2016) http://dx.doi.org/10.1007/s13277-016-5035-9 C Cavallo, G Filardo, E Mariani, E Kon, M Marcacci, M.T Pereira Ruiz, et al., Comparison of platelet-rich plasma formulations for cartilage healing: an in vitro study, J Bone Jt Surg Am 96 (2014) 423–429 http://dx.doi.org/10.2106/ JBJS.M.00726 E.A Sundman, B.J Cole, V Karas, C Della Valle, M.W Tetreault, H.O Mohammed, et al., The anti-inflammatory and matrix restorative mechanisms 11 ... differentiate into cartilage and replace the injured one [20,21] Although numerous clinical trials indicate that PRP is a promising treatment for cartilage injuries and joint in? ??ammation in OA, its... on improving cartilage repair remains to be determined The purpose of this study is to investigate the effect of PRP on osteoarthritic chondrocytes including autophagy and apoptosis, and to elucidate... action In our study, we found that platelet rich plasma increased the proliferation of chondrocytes, decreased apoptosis and increased autophagy in human osteoarthritic chondrocytes Furthermore, PRP