hyperglycemia induced changes in zip7 and znt7 expression cause zn 2 release from the sarco endo plasmic reticulum and mediate er stress in the heart

Page of 43 Diabetes Manuscript #: DB16-1099 Hyperglycemia-induced Changes in ZIP7 and ZnT7 Expression Cause Zn2+ Release from the Sarco(endo)plasmic Reticulum and Mediate ER-stress in the Heart Erkan Tuncay1, Verda C Bitirim1, Aysegul Durak1, Gaelle R J Carrat2, Kathryn Taylor3, Guy A Rutter2* and Belma Turan1*† Department of Biophysics, Ankara University, Faculty of Medicine, Ankara, Turkey; Section of Cell Biology and Functional Genomics, Division of Diabetes Endocrinology and Metabolism, Department of Medicine, Imperial College London, London, UK, and 3School of Pharmacy and Pharmaceutical Sciences, College of Biomedical and Life Sciences, Cardiff University, Cardiff, UK Running title: Hyperglycemia and zinc-transporters in mammalian heart Key words: Zinc transporters, cytosolic zinc, diabetic cardiomyopathy, heart, ER stress, sarco(endo)plasmic reticulum, FRET, Protein kinase-2 * equal senior scientists *† Correspondence: Belma Turan, PhD (†lead) Department of Biophysics, Faculty of Medicine, Ankara University, Ankara, Turkey Tel: +90 312 5958186 Fax: +90 312 3106370 Email: belma.turan@medicine.ankara.edu.tr or Prof Guy A Rutter Section of Cell Biology and Functional Genomics Department of Medicine Imperial College London Du Cane Rad London W12 0NN, U.K Diabetes Publish Ahead of Print, published online February 23, 2017 Diabetes Abstract Changes in cellular free Zn2+ concentration, including those in the sarco(endo)plasmic reticulum [S(E)R], are primarily coordinated by Zn2+-transporters whose identity and role in the heart is not well established Here, we hypothesized that ZIP7 and ZnT7 transport Zn2+ in opposing directions across the S(E)R membrane in cardiomyocytes and that changes in their activity may play an important role in the development of ER-stress during hyperglycemia The subcellular S(E)R-localization of ZIP7 and ZnT7 was determined in cardiomyocytes and in isolated S(E)R-preparations Markedly increased mRNA and protein levels of ZIP7 were observed in ventricular cardiomyocytes from diabetic rats or high glucose-treated H9c2 cells whilst ZnT7 expression was low Additionally, we observed increased ZIP7-phosphorylation in response to high glucose in vivo and in vitro Using recombinant targeted FRET-based sensors, we showed that hyperglycemia induced a marked redistribution of cellular free Zn2+, increasing cytosolic free Zn2+ and lowering free Zn2+ in the S(E)R These changes involve alterations in ZIP7-phosphorylation and were suppressed by siRNA-mediated silencing of CK2α Opposing changes in the expression of ZIP7 and ZnT7 were also observed in hyperglycemia We conclude that sub-cellular free Zn2+ re-distribution in the hyperglycemic heart, resulting from altered ZIP7 and ZnT7 activity, contributes to cardiac dysfunction in diabetes Page of 43 Page of 43 Diabetes Introduction Diabetes is an important risk factor for cardiovascular dysfunction via defective Ca2+signaling (1; 2) However, we have previously shown that Zn2+ release during cardiac-cycle results in cytosolic free Zn2+ increase (3), further triggering higher pro-oxidant speciesproduction leading to oxidative damage (4) Conversely, oxidant exposure induces marked cytosolic free Zn2+ increases in cardiomyocytes (5) while hyperglycemia causes oxidative stress and increased cytosolic Zn2+ via underling cardiac dysfunction (6) Similar to Ca2+, Zn2+ is essential for cellular functions in mammalian heart (7), serving up as an important secondary-messenger (8) Excess Zn2+ can be detrimental to cells, particularly that of cardiomyocytes (3; 5-7) Cytosolic Zn2+ has an important role in excitation-contraction coupling in cardiomyocytes by shaping Ca2+ dynamics (3; 4; 9) Its level in cardiomyocytes is calculated less than 1-nM while ~5-fold higher in sarco(endo)plasmic reticulum [S(E)R] and less than cytosolic-level in mitochondria demonstrated previously using FRET-based recombinant-targeted Zn2+-probes (10) Elevated cytosolic Zn2+ appears to contribute to deleterious changes in many cellular signalingpathways including hyperglycemia-challenged cardiomyocytes (3-6; 11) Cellular Zn2+-fluxes are achieved and controlled by Zn2+-transporters (ZnTs) and importers (ZIPs) (12; 13) while their distributions and functions are not yet well-clarified in cardiomyocytes The Zn2+-selective ion-channel ZIP7 has important role for releasing Zn2+ from S(E)R and Zn2+-associated induction of unfolded-protein-response in yeast (14) and is localized to Golgi apparatus in Chinese-Hamster Ovary-cells, allowing Zn2+-release from Golgi lumen into cytosol (15) ZIP7 facilitates release of Zn2+ from ER (16) and behaves as a critical component in sub-cellular re-distribution of Zn2+ in other systems (17) Additionally, it has been hypothesized that protein kinase-2 (CK2) triggers cytosolic Zn2+-signaling-pathways Diabetes by phosphorylating ZIP7 (18) while some studies have also highlighted its important contribution to Zn2+-homeostasis under pathological conditions (19-21) Although studies have shown the presence of weakly expressed ZIP7 and ZnT7 in mammalian heart (22; 23), their subcellular localizations and functional roles are not yet known well In that regard, previous studies have suggested that either increase or inhibition of one of them might contribute to cellular dysfunction (11), including defective insulin- mediated signaling-pathways under hyperglycemia (24) or altered insulin-secretion (25; 26) ER-stress is one of underlying mechanisms of cardiac dysfunction including diabetic- cardiomyopathy (27-29) Studies suggest that there is relationship between S(E)R function and cytosolic Zn2+ level in diabetic rat cardiomyocytes (29; 30) In particular, the latter studies identified a close association between oxidative-stress, cytosolic Zn2+ increase, ER- stress and cardiac dysfunction in diabetes However, experimental evidence suggests a requirement for Zn2+ for proper ER-function, with Zn2+ deficiency leading to ER-stress (14; 31) via decreased Zn2+ in the ER via hypoxia or hypoglycemia (14) However, there are no clear data as to which Zn2+-transporters play roles in controlling cytosolic Zn2+ increases in cardiomyocytes during hyperglycemia It is therefore tempting to hypothesize that disruption of Zn2+-transporters and Zn2+-axis may contribute to deleterious changes in diabetic cardiomyocytes Here, we aimed first to clarified their subcellular localizations and then to explore their functional roles in Zn2+-homeostasis Additionally, we tested their roles in cytosolic Zn2+ re-distribution and development of ERstress in hyperglycemic conditions, at most due to activation of CK2(α) Research Design and Methods Diabetes Induction Page of 43 Page of 43 Diabetes Our study was approved by Ankara University ethic committee (115-449) Type diabetes was mimiced by single injection of streptozotocin (50 mg/kg, i.p.; Sigma-Aldrich) in 3month-old 15-male Wistar rats while others (CON-group; 10) were injected with vehicle, as described previously (2) Following STZ-injection (7-day), rats with 3-fold higher blood- glucose level comparison to pre-injection level were used as diabetics (DM-group; 13 rats kept for12-week) Cardiomyocyte Isolation Cardiomyocytes were isolated from left ventricle using enzymatic-method, as described previously (5) Hearts were cannulated on a Langendorff-apparatus leaving pre-perfusion through the coronary artery with a Ca2+-free solution Following pre-perfusion, it was followed with 1-mg/mL collagenase (Type2, Worthington, USA) containing solution for 3035 Only Ca2+ tolerant rod-shaped cells were used in order to ensure cell viability and excitability, as well to avoid SR Ca2+-overload and terminal-contracture Cell Culture The embryonic rat heart-derived H9c2 cell-line was purchased from American Type Culture Collection (Manassas, VA) and was cultured in Dulbecco's modified Eagle's medium, as described previously (10) Cytosolic and S(E)R Free Zn2+ Levels Cytosolic and S(E)R free Zn2+ levels ([Zn2+]Cyt and [Zn2+]ER) in H9c2 cells were measured using eCALWY sensors (Cyt-eCALWY4 and ER-eCALWY6) delivered with plasmids expressing Cyt-eCALWY4 and ER-eCALWY6 Measurements were performed as described previously (10) Images were captured at 433-nm monochromatic excitation-wavelength and image-analysis was performed with ImageJ-software using a homemade-macro To calculate free Zn2+, maximum (Rmax using a heavy-metal-chelator N,N,N’,N’-tetrakis(2-pyridylmethyl) Diabetes Page of 43 ethylenediamine (TPEN, Sigma-Aldrich, USA; 50-µM) and minimum (Rmin using Zn2+ saturation with 100-µM ZnCl2 and Zn2+-ionophore pyrithione (Zn2+/Pyr, 5-µM) fluorescence ratios were used as described, previously (13) Imaging Sub-Cellular Localization of ZIP7 and ZnT7 ZIP7 and ZnT7 localizations were determined using anti-ZIP7 and anti-ZnT7 antibodies (Thermofisher PA5-21072 and Santa-Cruz SC-160946 as 1:50, respectively) in confocal microscopy (Zeiss LSM510) S(E)R localization was determined by transfection of H9c2 cells with dsRED-ER (red) plasmid for 24-h After general procedures, cells were incubated with specific-antibodies to monitor their localizations Following overnight-incubation, cells were incubated with appropriate secondary-antibodies in presence of BSA (5%; Alexa Fluor-488 Donkey anti-Rabbit and Donkey anti-Goat for ZIP7 and ZnT7 respectively; 1:1000) The Golgi was labeled with Anti-GM130 antibody cis-Golgi Marker (Abcam; ab52649; 1:750) Then, cells were incubated either with anti-ZIP7 or anti-ZnT7 and Golgi-marker GM130-antibody for ZIP7 and ZnT7 (secondary-antibodies: Alexa Fluor 488 Donkey antiRabbit for ZIP7; 1:1000 and Alexa Fluor 568 Goat anti-Mouse for GM130; 1:1000, Alexa Fluor 488 Donkey anti-Goat for ZnT7; 1:1000 and Alexa Fluor 647 Rabbit anti-Mouse for GM130; 1:1000) Finally, cells were mounted with medium containing DAPI (blue) Images were deconvolved and analyzed for their colocalizations using Huygens-software and processed with ImageJ (https://svi.nl/HuygensProfessional) Sarco(E)R Isolation Left ventricular S(E)R-fractionation of hearts was performed using ER-isolation kit (Sigma, E0100) Briefly, hearts were homogenized in isotonic extraction-buffer and then centrifuged Crude microsomal-fraction was isolated from post-mitochondrial fraction using ultracentrifugation For further purification and separation for RER (rough-ER) and SER Page of 43 Diabetes (smooth-ER), self-generating density-gradient procedure was performed according to manufacturer’s instructions Western (immuno-) blot analysis was carried out using primary antibodies against ZIP7 and ZnT7 To confirm S(E)R-isolation, SERCA2 (Santa Cruz, SC8094), Golgi 58K Protein (Abcam, ab-27043) and cyclin E (Santa Cruz, SC481) were used as S(E)R, Golgi or nuclear markers ZIP7-silencing in H9c2-Cells with Stable Lentiviral-Infection H9c2 cells were stably transfected with 4-unique 29-mer shRNA constructs in lentiviral RFPvector (Origene, SR02938179A, B, C and D) and non-effective 29-mer scrambled shRNA cassette in pRFP-CB-shLenti Vector as control (Origene, TR30033) Following 24-h before transfection, cells were seeded into separate dishes Every shRNA construct with packaging and enveloping plasmids (psPAX; Addgene-12260 and pMD2G; Addgen-12259) were mixed into a solution contained CaCl2 (375-mM) and then incubated for 30-min DNA mixtures were added into HBS-buffer (mM; 12 Dextrose, 50 HEPES, 10 KCl, 280 NaCl, 1.5 Na2HPO4.H2O) while every mixture added into separate 15-cm dishes and incubated for 12-h Viral supernatants were harvested following 24-h and 48-h and then cells were infected with each lentivirus produced from every shRNA-construct including scrambled-sequences at 3PFU/cell (incubation with 10-µg/mL blasticidin for antibiotic selection) They were seeded into 6-well plates and harvested for knock-down efficiency measuring ZIP7 mRNA level (Suppl Table 1) A mixture of 4-ZIP7 gene-specific shRNA-constructs was used QRT-PCR Analysis Total-RNA was prepared using RNA Isolation-kit (Macherey–Nagel, 740955.10) and purified total-RNA was reverse transcribed with ProtoScript First-Strand cDNA Synthesis-kit (New England Biolobs, E6300S) First strand-cDNAs were quantified with GoTaq® qPCR Master Mix (Promega, A6001) The amplified fragment size of PCR-products for each primer and primers’ specificity were controlled with NCBI and ENSEMBL databases Primer sequences Diabetes for cyclophilin, ZIP7 and ZnT7 are listed in Suppl.Table2 The fold changes in the genes were analyzed based on comparative (2-∆∆Ct) method Western (immuno-) blot Analysis The lysates were extracted with NP-40 lysis buffer (250 mM NaCl, 1% NP-40, and 50 mM Tris-HCl; pH 8.0 and 1X PIC) from homogenized samples Protein concentration of supernatants (centrifuged 12,000×g, 5-min, at 4°C) was measured with BCA assay-kit (Pierce) Equal amount of protein were separated on 12% SDS-PAGE Tris-glycine or 4-12% Bis-Tris gels (Life Technologies) The membranes were probed with antibodies against GRP78 (Santa-Cruz sc-13968; 1:200), Calregulin (Santa-Cruz sc-11398; 1:200), ZIP7 (SantaCruz sc-83858; 1:200), ZnT7 (Santa Cruz sc-160946; 1:200), SERCA-2 (Santa-Cruz sc-8094, 1:200), 58K Golgi Protein (Abcam ab-27043; 1µg/ml), cyclin E (Santa-Cruz SC481), GAPDH (Santa-Cruz sc-365062; 1:1000) and β-actin (Santa-Cruz sc-47778; 1:500) in BSA/PBS/Tween-20 solution Specific bands were visualized with HRP-conjugated compatible secondary antibodies (anti-mouse: 1:2000, anti-goat: 1:7500, anti-rabbit: 1:7500) and detected by ImmunoCruz Western-Blotting Luminol-Reagent (Santa Cruz, sc-2048) The band densities were analyzed using ImageJ-software Co-immunoprecipitation Cells were treated as indicated, lysed in co-immunoprecipitation (co-IP) buffer (mM: 50 Tris, 100 NaCl, EDTA, 1% Triton-X-100, 10% glycerol, pH=7.4) containing protease inhibitors (1-mM PMSF, 1-µg/mL each of leupeptin, aprotinin and pepstatin) and phosphatase inhibitors (mM: 10 sodium-fluoride, sodium-orthovanadate) for 30-min at 4°C The 600-µg protein lysates from aliquots (1-mL lysis buffer) were pre-cleared via incubation with 30-µL of protein A/G Sepharose (Sigma USA) for 1-h at 4°C The pre-cleared samples were incubated with specific primary antibody (anti-CK2α, 10-µg/mL; Santa-Cruz sc-6480) in lysis-buffer Page of 43 Page of 43 Diabetes for 2-h at 4°C and then 30-µL of protein A/G beads were added Then, samples were incubated for overnight at 4°C and then beads were washed times with lysis-buffer, boiled and separated by 10% SDS-PAGE CK2α- silencing in H9c2 Cells CK2α (1 and 2) was silenced in H9c2 cells using Lipofectamine2000 ™ according to the manufacturer’s siRNA transfection protocol Briefly, cells were seeded into 6-well plates and cultured for 48- or 72-h with a mixture of 25 nM CK2α1 and CKα2 or non-targeted siRNAs (Dharmacon; ON-TARGETplus SMARTpool Csnk2a1 and Csnk2a2-siRNA, ON- TARGETplus Non-targeting Pool; L-096197-02-0005, L-092756-02-0005 and D-001810-1005 respectively) with serum-free medium including 5-µL/mL Lipofectamine After incubation, the cells were extracted into buffers to examine protein and mRNA expression levels The primer sequences designed for CK2α1 and CKα2 are given in Suppl.Table2 Statistics Data are presented as mean ± SEM unless otherwise stated Differences were determined using Student’s t-tests with Bonferroni correction for multiple comparisons as required, and GraphPad Prism 6.0 P-values < 0.05 were considered statistically significant Results Regulation of ZIP7 and ZnT7 Expressions by High-Glucose Protein and mRNA levels of ZIP7 (at 50-kDa) and ZnT7 (at 42-kDa) in isolated rat ventricular-cardiomyocytes are given in Fig.1A and B Both mRNA and protein levels of ZIP7 were significantly increased in diabetic (DM) rat cardiomyocytes with significantly decreased ZnT7 levels To test these changes directly arising via hyperglycemia, we incubated isolated-cardiomyocytes with high-glucose (33-mM) for 3-h and then examined ZIP7 and ZnT7 comparison to those of mannitol (23-mM)-incubated cells There were similar changes Diabetes Page 10 of 43 in mRNAs to those of DM-cells except their protein levels (about 10%) (Suppl.Fig.1), most probably due to shorter high-glucose expose comparison to diabetes For further validation, we used high-glucose (25-mM) incubated (24-h)-H9c2 cells and measured protein and mRNA levels As can be seen from Fig.1C and D, both levels of ZIP7 increased significantly in high-glucose incubated cells while ZnT7 mRNA level (Fig.1D) is markedly (∼75%) decreased with relatively small decrease (∼25%) in its protein level Next we performed experiments to determine whether the expression of other Zn2+transporters, such as ZIP1, ZIP6, ZnT1, ZnT5, may be affected in hyperglycemiccardiomyocytes Using QPCR, we demonstrated that mRNA levels of these transporters were not significantly altered in high-glucose incubated versus control cells (25-mM for 24-h; Suppl.Fig.2A and B) High-Glucose Induces ZIP7-Phosphorylation Since using a specific antibody developed by one of us (KT) in breast-cancer cells (18), ZIP7phosphorylation, we examined possible dependency of ZIP7-phosphorylation to hyperglycemia in both diabetic-rat cardiomyocytes and high-glucose incubated H9c2 cells (25-mM for 24-h or 48-h) As shown in Fig.1E, phospho-ZIP7 level measured at about 50kDa in DM-cells was about 7-fold higher comparison to the controls Furthermore, the phospho-ZIP7 level in high-glucose incubated H9c2 cells was higher comparison to nonincubated cells, as a time-dependent manner (Fig.1F) The pZIP7/ZIP7 ratio was similar in high glucose-incubated H9c2 cells while higher for diabetic heart (0.96±0.04 vs 4.79±0.39, respectively) Zn2+-transporters ZIP7 and ZnT7 Localize to the S(E)R Since the existence of ZIP7 and ZnT7 has previously been reported in mammalian heart (22; 23) and proposed to localize to ER (17; 21; 25) and/or perinuclear-vesicles associated with 10 ZIP7 50 kDa ZnT7 42 kDa β-actin 43 kDa GAPDH 37 kDa 3 37 kDa 0 D C D * M N N O C HG GAPDH 0 M 0 C CON C * D O M D C O N 0 N 0 * O M 50 kDa 0 le v e l ( fo ld ) le v e l ( fo ld ) 1 pZIP7 le v e l ( fo ld ) e x p r e s s io n ( f o ld ) * CON DM E R e la t iv e Z n T p r o te in * R e la tiv e Z n T m R N A R e la tiv e Z IP p r o t e in e x p r e s s io n ( f o ld ) R e la tiv e Z IP m R N A CON DiabetesDM B R e la tiv e p Z IP p r o t e in DM CON Page 29 of 43 A F HG CON D CON HG24 CON HG48 ZIP7 50 kDa ZnT7 42 kDa pZIP7 50 kDa β-actin 43 kDa GAPDH 37 kDa β-actin 42 kDa G N H O C le v e l ( f o l d ) G H C O N G H N O H G 0 C C O N G H N O C 0 0 G 0 * H 0 N * * O 1 C e x p r e s s io n ( f o ld ) R e la tiv e Z n T m R N A 5 le v e l ( fo ld ) * R e la t iv e Z n T p r o te in * le v e l ( fo ld ) e x p r e s s io n ( f o ld ) R e la tiv e Z IP p r o t e in R e la tiv e Z IP m R N A R e la t iv e p Z IP p r o t e in Fig.1 A Diabetes E Page 30 of 43 ZIP7 (50kDa) DAPI dsRED-ER ZIP7 MERGE ZNT7 ( 42 kDa) fr1 B fr2 fr3 fr4 SERCA2 (110 kDa) DAPI dsRED-ER ZnT7 MERGE C 58 K (58kDa) Cyclin E1 (53kDa) Total Cell fr1 fr2 fr3 fr4 Lysate DAPI GM130 ZIP7 MERGE DAPI GM130 ZnT7 MERGE D Fig Page 31 of 43 Diabetes A (-) +TPEN +Zn/Pyr CON TPEN Zn 2+ /P y r * ] C y t (n M ) 2+ [Z n C it /C e r HG C y t- e C A W Y 5 B (-) +TPEN H 15 N 10 O C G 0 T im e (m in ) +Zn/Pyr TPEN 2+ /P y r ] E R (n M ) Zn 6 2+ 5 [Z n * 10 15 G C O N H E R -e C A L W Y HG C it/C e r CON T im e (m in ) Fig 0 5 * 0 * 0 sc-shRNA B Page 32 of 43 ] C y t (n M ) e x p r e s s io n ( f o ld ) R e la tiv e Z n T m R N A Z IP -s h R N A e x p r e s s io n ( f o ld ) R e la tiv e Z IP m R N A C Diabetes 2+ s c -s h R N A [Z n A 0 ZIP7-shRNA ZIP7 50 kDa ZnT7 42 kDa D s c -s h R N A s c -s h R N A (H G ) Z IP -s h R N A 5 * 0 ] E R (n M ) 2+ [Z n R e la t iv e Z n T p r o te in 0 e x p r e s s io n ( f o ld ) e x p r e s s io n ( f o ld ) R e la tiv e Z IP p r o t e in Z IP - s h R N A (H G ) 37 kDa GAPDH 0 Fig CON β-actin 43 kDa CALR GRP78 ZIP7 55 kDa 78 kDa 50 kDa β-actin β-actin β-actin 43 kDa 43 kDa 43 kDa 0 0 0 F CON +TUN CON +TUN 0 0 E D * 0 sc-shRNA CON HG ZIP7-shRNA CON HG G 42 kDa 50 kDa 78kDa 55 kDa GAPDH GAPDH β-actin β-actin 43 kDa 43kDa 0 2 * 0 0 le v e l ( fo ld ) C A L R p r o t e in 5 le v e l ( fo ld ) G R P p r o t e in * le v e l ( fo ld ) R e la tiv e p Z IP p r o t e in le v e l ( fo ld ) R e la t iv e Z n T p r o te in 1 ZIP7-shRNA CON HG CALR GRP78 5 sc-shRNA CON HG pZIP7 37 kDa 0 ZnT7 37 kDa CON +TUN * le v e l ( fo ld ) R e la t iv e C A L R p r o t e in * le v e l ( fo ld ) R e la t iv e G R P p r o t e in C CON +TUN le v e l ( fo ld ) 78 kDa B R e la tiv e Z IP p r o t e in CON HG le v e l ( fo ld ) GRP78 Diabetes HG R e la t iv e G R P p r o t e in Page 33 of 43 A 0 0 Fig +Zn2+/ CON DM Pyr A B CK2α 43 kDa GAPDH 37 kDa Diabetes CON GAPDH 37 kDa CK2α 43kD * le v e l ( fo ld ) IgG IP: CK 2α ZIP7 50kDa 10 * Page 34 of 43 input 43 kDa R e la tiv e C K  p r o t e in le v e l ( fo ld ) R e la tiv e C K  p r o t e in C CK2α * HG +Zn2+/ Pyr 0 D NT CK2α siRNA siRNA 50 kDa CK2α * β-actin 42 kDa E F N T - s iR N A ( C O N ) N T - s iR N A ( H G ) β-actin 50 kDa 42 kDa 50 kDa * 0 42 kDa 0 10 s iC K  - s iR N A ( H G ) † le v e l ( fo ld ) pZIP7 p Z IP p r o t e in β-actin s iC K  - s iR N A ( C O N ) le v e l ( fo ld ) ZIP7 CK2α-siRNA CON HG Z IP p r o t e in NT-siRNA CON HG * Fig.6 Page 35 of 43 Diabetes Fig Diabetes Page 36 of 43 Online Supplementary Tables Supplementary Table Effect of ZIP7-shRNA constructs upon ZIP7-expression in the cells Supplementary Table Sequences of primers used for qRT-PCR Sense (5’-3’) Antisense (5’-3’) ZIP1 CATGTGACGCTTCAGTTCCC GGATGTGGTGGACTGGACTG ZnT1 ACACGCTAGTGGCTAACACC TCTCAACTTCTCTGGCTCTGC ZnT5 ACCGTTACAAAGCATCAGTGGA GTCCTCCTCCAGAGCTAGTGA ZnT6 GCCTGAGATACACACGGGAA GCGACTAAGGTCTGCCACAT ZIP7 CCACGGACACTCACATGAAG CCTCTGTGGTGGAGGCTATC ZnT7 ATGTTGCCCCTGTCCATCAAGG TCGGAGATCAAGCCTAGGCAGT Csnk2a1 TGGTTGGGACCCTGACAGTAA TTGATTTCCCCATTCCACCACAT Csnk2a2 GCACCCGTACTTCTACCCG AAAGTGGGAGGAACCGCAAC Cyclophilin GGGAAGGTGAAAGAAGGCAT GAGAGCAGAGATTACAGGGT Page 37 of 43 Diabetes e x p r e s s io n ( f o ld ) 3 2 1 * G H N O C H O C G N R e la tiv e Z n T m R N A * e x p r e s s io n ( f o ld ) R e la tiv e Z IP m R N A Supplementary Fig 1: The mRNA expression levels of ZIP7 and ZnT7 in isolated cardiomyocytes from left ventricle of normal rat heart incubated with high glucose Freshly isolated rat left ventricular cardiomyocytes incubated with high glucose (33 mM) for hours (+HG group) and then examined the protein and mRNA levels of both ZIP7 and ZnT7 comparison to those of mannitol (23 mM) incubated cardiomyocytes (CON group) Bars represent mean (±SEM) Number of cells used are isolated from n=3–4 hearts/group and measurements performed with double assays in each sample from each group for each type of measurement Significance level accepted at *p