farnesoid x receptor activation promotes hepatic amino acid catabolism and ammonium clearance in mice

Accepted Manuscript Farnesoid X Receptor Activation Promotes Hepatic Amino Acid Catabolism and Ammonium Clearance in Mice Vittoria Massafra, Alexandra Milona, Harmjan R Vos, Rúben J.J Ramos, Johan Gerrits, Ellen C.L Willemsen, José M Ramos Pittol, Noortje Ijssennagger, Martin Houweling, Hubertus C.M.T Prinsen, Nanda M Verhoeven-Duif, Boudewijn M Burgering, Saskia W.C van Mil PII: DOI: Reference: S0016-5085(17)30054-9 10.1053/j.gastro.2017.01.014 YGAST 60927 To appear in: Gastroenterology Accepted Date: 17 January 2017 Please cite this article as: Massafra V, Milona A, Vos HR, Ramos RJJ, Gerrits J, Willemsen ECL, Ramos Pittol JM, Ijssennagger N, Houweling M, Prinsen HCMT, Verhoeven-Duif NM, Burgering BM, van Mil SWC, Farnesoid X Receptor Activation Promotes Hepatic Amino Acid Catabolism and Ammonium Clearance in Mice, Gastroenterology (2017), doi: 10.1053/j.gastro.2017.01.014 This is a PDF file of an unedited manuscript that has been accepted for publication As a service to our customers we are providing this early version of the manuscript The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain ACCEPTED MANUSCRIPT Farnesoid X Receptor Activation Promotes Hepatic Amino Acid Catabolism and Ammonium Clearance in Mice Vittoria Massafra1, Alexandra Milona1, Harmjan R Vos1, Rúben J.J Ramos2, Johan RI PT Gerrits1,2, Ellen C.L Willemsen1, José M Ramos Pittol1, Noortje Ijssennagger1, Martin Houweling3, Hubertus C.M.T Prinsen2, Nanda M Verhoeven-Duif1,2, Boudewijn M SC Burgering1, and Saskia W.C van Mil1 Center for Molecular Medicine, UMC Utrecht, Utrecht, The Netherlands Department of Genetics, UMC Utrecht, Utrecht, The Netherlands Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands M AN U Corresponding author: Dr S.W.C van Mil, Center for Molecular Medicine, UMC Utrecht, HP 3.217, PO box 85060, 3508 AB Utrecht, The Netherlands, T +31 (0)88 75 50005 E-mail: TE D S.W.C.vanMil@umcutrecht.nl EP Author conflict of interest disclosures: There is no conflict of interest to disclose Authors’ contributions: Conceptualization, V.M., A.M and S.W.C.v.M.; Methodology: AC C V.M., H.R.V., M.H., H.C.M.T.P, E.C.LW., J.G.; Investigation: V.M., A.M., H.R.V., R.J.J.R., J.M.R.P.; Resources: N.Ij.; Writing – Original Draft: V.M and S.W.C.v.M; Writing –Review & Editing: N.M.V.D., B.B and M.H Acknowledgements: Grant support: S.W.C.v.M is supported by the Netherlands Organization for Scientific Research (NWO) Project VIDI (917.11.365), FP7 Marie Curie Actions IAPP (FXR-IBD, 611979), the Utrecht University Support Grant, Wilhelmina Children’s Hospital Research Fund H.R.V is supported by Proteins At Work (NWO) ACCEPTED MANUSCRIPT Abstract Background & Aims: The nuclear receptor subfamily group H member (NR1H4 or farnesoid X receptor, FXR) regulates bile acid synthesis, transport, and catabolism FXR also regulates post-prandial lipid and glucose metabolism We performed quantitative proteomic RI PT analyses of liver tissues from mice to evaluate these functions and investigate whether FXR regulates amino acid metabolism SC Methods: To study the role of FXR in mouse liver, we used mice with a disruption of Nr1h4 (FXR-knockout mice) and compared them to floxed control mice Mice were gavaged with M AN U the FXR agonist obeticholic acid or vehicle for 11 days Proteome analyses, as well as targeted metabolomics and chromatin immunoprecipitation, were performed on the livers of these mice Primary rat hepatocytes were used to validate the role of FXR in amino acid catabolism by gene expression and metabolomics studies Finally, control mice and mice with TE D liver-specific disruption of Nr1h4 (liverFXR-knockout mice) were refed with a high-protein diet after hours fasting and gavaged a 15NH4Cl tracer Gene expression and the metabolome EP were studied respectively in the livers and plasma from these mice Results: In livers of control mice and primary rat hepatocytes, activation of FXR with AC C obeticholic acid increased expression of proteins that regulate amino acid degradation, ureagenesis, and glutamine synthesis We found FXR to bind to regulatory sites of genes encoding these proteins in control livers Liver tissues from FXR-knockout mice had reduced expression of urea cycle proteins, and accumulated precursors of ureagenesis, compared to control mice In liverFXR-knockout mice on a high-protein diet, the plasma concentration of newly formed urea was significantly decreased compared with controls In addition, liverFXR-knockout mice had reduced hepatic expression of enzymes that regulate ammonium ACCEPTED MANUSCRIPT detoxification, compared with controls In contrast, obeticholic acid increased expression of genes encoding enzymes involved in ureagenesis compared to vehicle in C57Bl/6 mice Conclusions: In livers of mice, FXR regulates amino acid catabolism and detoxification of RI PT ammonium via ureagenesis and glutamine synthesis Failure of the urea cycle and hyperammonemia are common in patients with acute and chronic liver diseases; compounds SC that activate FXR might promote ammonium clearance in these patients AC C EP TE D M AN U KEY WORDS: liver proteome; INT-747; Cps1; glutamine synthetase ACCEPTED MANUSCRIPT Introduction Carbohydrates, proteins, and fats from the diet are digested in the gastro-intestinal tract, where they are broken down into their basic units, sugars (monosaccharides, e.g glucose), amino acids, and free fatty acids, respectively Via the portal venous circulation, these basic RI PT energy units reach the liver where they are processed.1 In the postprandial phase, glucose is either used as energy source, condensed into glycogen or converted into fatty acids or amino acids Free fatty acids are either oxidized to generate energy or esterified with glycerol-3phosphate to synthesize triacylglycerol and subsequently stored in the liver or distributed to SC other tissues via VLDL incorporation Amino acids are metabolized to provide energy or used to synthesize proteins, glucose, and/or other bioactive molecules.2 Regulation of amino acid M AN U metabolism in the liver is crucial, because in times of dietary surplus, high concentrations of amino acids and ammonium reach the liver and may cause toxicity Amino acids which are not used for protein synthesis are degraded to NH4+ and a carbon skeleton Ammonium clearance is achieved by ureagenesis and glutamine synthesis in the liver.3, TE D Carbamoylphosphate synthetase-1, Cps1, catalyses the committed step of ureagenesis and is mostly expressed in mitochondria of periportal hepatocytes, primarily exposed to intestinal protein catabolites Glutamine synthesis relies on glutamine synthetase, Glul, expressed in EP cytosol of pericentral hepatocytes, where it ensures the clearance of ammonium and thereby controls tightly blood ammonium concentration.5 AC C Next to their function as detergents facilitating dietary absorption of lipids and fat soluble vitamins, bile acids (BAs) have an important function in regulation of nutrient metabolism.6 By rapidly activating nuclear receptors and other cell signaling pathways upon their postprandial return to the liver, BAs not only induce feedback inhibition of BA synthesis but also control lipid and glucose metabolism.7 Signalling of BAs in the postprandial phase is mediated by the Farnesoid X receptor (FXR), which is mainly expressed in intestine, liver and kidney Intestinal FXR activation by BAs ACCEPTED MANUSCRIPT increases BA export into the portal circulation In addition, FXR activation in the intestine increases Fgf15 synthesis and export into the portal system Fgf15 through its membrane receptor Fgfr4 decreases hepatic BA biosynthesis, by affecting Cyp7a1 activity Hepatic FXR activation increases BA efflux from hepatocytes through the regulation of transporters’ RI PT expression (OSTα/β, BSEP and MDR3).8 FXR modulates triacylglycerol clearance, by promoting lipoprotein lipase activity via induction of ApoC-II and controls fatty acid and cholesterol synthesis, via repression of SC Srebp1c Moreover, FXR improves insulin sensitivity and glucose clearance via downregulation of the gluconeogenic genes Pck1 and Fbp1.9 Metabolic function of FXR as shortage.10, 11 M AN U nutrient sensor encompasses also repression of autophagy during prolonged nutrient Furthermore, FXR activation promotes liver regeneration and hepatocyte survival, inhibits hepatic inflammation and enhances tumor suppressor genes.12 FXR agonists were shown to be beneficial in clinical trials for non-alcoholic steatohepatitis (NASH) and primary biliary cholangitis (PBC) and may have therapeutic potential in gallstone disease, TE D cirrhosis, liver cancer and metabolic syndrome.13 In this study, we show that FXR not only regulates glucose and fatty acid metabolism, but also regulates the metabolism of the third class of basic energy units: amino acids We EP quantified liver proteome-wide changes occurring in vivo in response to obeticholic acid (OCA) or FXR ablation and confirmed the role of FXR in BA, lipid and glucose metabolism AC C We show that FXR activation in vivo results in upregulation of proteins involved in amino acid degradation, urea cycle and glutamine synthesis, while FXR ablation associates with reduced expression of urea cycle proteins and accumulation of upstream substrates of urea cycle FXR binds to regulatory sites of these genes and its activation increased urea production in primary hepatocytes In vivo tracing studies of the conversion of isotopically labelled ammonium into urea also support a role for FXR in ureagenesis Combining the data on FXR metabolic functions, we argue that FXR functions as a key regulator of deciding the post-prandial fate of the three nutrient breakdown units: sugars, fats and amino acids ACCEPTED MANUSCRIPT Materials and methods Animal experiments Homozygous FXR-floxed mice (C57BL/6 FXR fl/fl, kind gift from K Schoonjans, Ecole RI PT Polytechnique Federale de Lausanne, Switzerland,14) were crossed with Meox2-cre mice and Alb-Cre mice (Jackson Laboratory, Bar Harbor, ME, U.S.) to generate whole body FXR null mice (FXR-/-), and liver-specific FXR-null mice (liver FXR-/-) containing the same floxed SC allele for the ultimate comparison, respectively FXR-floxed littermates without cre alleles were used as wild type (Wt) controls Genotyping of FXR-floxed mice was assessed as M AN U described previously.14 FXR expression was assessed in liver, kidney, ileum and adrenal glands of Meox2-cre mice (FXR-/-) and Alb-cre mice (livFXR-/-) (Supplementary Figure 1) Mice were fed a purified diet (AIN-93M, Research Diet, New Brunswick, NJ, U.S.) ad libitum and housed in a temperature and light-controlled room C57BL/6 male mice either Wt TE D or FXR-/- were gavaged with either OCA (10mg/kg body weight, kindly provided by Luciano Adorini, Intercept Pharmaceuticals, San Diego, CA, U.S.) or Vehicle (1% methyl cellulose) for 11 days In the evening prior to the sacrifice, mice received an extra gavage of OCA/Veh EP Mice were fasted for hours prior to sacrifice In an independent experiment, C57BL/6 male mice were gavaged with either OCA or vehicle 15 AC C for days On day 3, mice were fasted for hours One group of mice were gavaged with NH4Cl dissolved in water (20mg/kb body weight; Cambridge Isotope Laboratories, Tewksbury, MA, U.S.) directly after fasting Another group of mice were refed with a high protein diet (ssniff EF R/M High Protein, E15209; ssniff Spezialdiäten GmbH, Soest, Germany) for hours before they were gavaged the tracer Mice were killed and livers and plasma were harvested 90 minutes after 15 NH4Cl administration Alb-cre mice (livFXR-/-) and their Wt FXR fl/fl controls were subjected to the same treatment of refeeding with high protein diet and 15 NH4Cl administration All experiments were approved by the ethics committee of the University Medical Center Utrecht ACCEPTED MANUSCRIPT See Supplementary Methods for descriptions of the SILAC-based proteomics, primary hepatocyte culturing, urea and amino acid mass spectrometry analyses RI PT Western blotting Liver tissue extracts were generated and protein concentration was assessed (BCA assay kit, Thermo Scientific) Western blots were probed with antibodies against Cps1 (Origene, Rockville, MD, U.S.), Ass1 (Abcam, Cambridge, UK), Glul (BD Biosciences, Franklin SC Lakes, NJ, U.S), Arg1 (Cell Signalling, Danvers, MA, U.S.), Prodh (Abcam), and Hal M AN U (Abcam) α-Tubulin (Sigma), and α-actin (Abcam) antibodies were used as loading controls Chromatin immunoprecipitation and ChIP-seq analysis Snap-frozen liver tissue was crosslinked with formaldehyde and processed for chromatin immunoprecipitation as described previously.15 Primer sequences used for ChIP-qPCR are TE D reported in Supplementary Table IR1 motifs16 were searched in peak regions proximal to target genes using the HOMER suite software We analysed ChIP-seq datasets generated in our laboratory (Gene Expression Omnibus, GSE73624,15) and by others17 to assess the AC C EP binding profile of FXR in liver Gene expression analyses RNA was isolated from primary hepatocytes using TRIzol reagent (Invitrogen) cDNA was generated from µg of total RNA using SuperScript II Reverse Transcriptase (Invitrogen) qRT-PCR analysis was performed using SYBR green PCR master mix (Roche, Basel, Switzerland) and analysed on a MyIQ real time PCR cycler (BioRad, Hercules, California, U.S.) Primer sequences are listed in Supplementary Table ACCEPTED MANUSCRIPT Statistics Significance of pathway enrichment was determined by Ingenuity software, setting p sp|P29758|OAT_MOUSE mitochondrial Ornithine aminotransferase, mitochondrial OS=Mus musculus GN=Oat PE=1 SV=1 Q3UMC0 Q3UMC0 Spermatogenesis-associated Spata5 >sp|Q3UMC0|SPAT5_MOUSE protein Spermatogenesis-associated protein OS=Mus musculus GN=Spata5 PE=2 SV=2 A2A974 A2A974 Cyp4a12b >tr|A2A974|A2A974_MOUSE Cytochrome P450, family 4, subfamily a, polypeptide 12B OS=Mus musculus GN=Cyp4a12b PE=3 SV=1 Q6NXL1 Q6NXL1 Sec24d >tr|Q6NXL1|Q6NXL1_MOUSE Sec24 related gene family, member D (S cerevisiae) OS=Mus musculus GN=Sec24d PE=2 SV=1 Q61391;Q8BNU9 Q61391 Neprilysin Mme >sp|Q61391|NEP_MOUSE Neprilysin OS=Mus musculus GN=Mme PE=1 SV=3 B2RPU8;Q9D1L0;D3Z5B1 B2RPU8;Q9D1L0;D3Z5B1 Coiled-coil-helix-coiled-coil-helix 2410018M08Rik;Chchd2 >tr|B2RPU8|B2RPU8_MOUSE domain-containing protein MCG130675 2, mitochondrial OS=Mus musculus GN=2410018M08Rik PE=2 SV=1;>sp|Q9D1L0|CHCH2_MOUSE Coiled-coil-helix-coiled-coil-helix domain-containing protein 2, m P10648;P13745;Q6P8Q0;D3Z6A6;D3YZV3;Q6P8Q1;E9Q6L7;F6SC55 P10648;P13745;Q6P8Q0;D3Z6A6;D3YZV3;Q6P8Q1;E9Q6L7 GlutathioneGsta2;Gsta1;Gm3776;Gm10639 S-transferase >sp|P10648|GSTA2_MOUSE A2;Glutathione S-transferase Glutathione A1;Glutathione S-transferase S-transferase A2 OS=Mus A1, N-terminally musculus GN=Gsta2 processed;Glutathione PE=1 SV=2;>sp|P13745|GSTA1_MOUSE S-transferase Glutathione S-transferase A1 OS=Mus musculus GN=Gsta1 PE O55060;D6RIK3;D3Z0R1;D3Z217;D3YWK6;D3Z380 O55060;D6RIK3;D3Z0R1;D3Z217;D3YWK6;D3Z380 Thiopurine S-methyltransferase Tpmt >sp|O55060|TPMT_MOUSE Thiopurine S-methyltransferase OS=Mus musculus GN=Tpmt PE=1 SV=1;>tr|D6RIK3|D6RIK3_MOUSE Uncharacterized protein OS=Mus musculus GN=Tpmt PE=4 Q8BI72 Q8BI72 CDKN2A-interacting Cdkn2aipprotein >sp|Q8BI72|CARF_MOUSE CDKN2A-interacting protein OS=Mus musculus GN=Cdkn2aip PE=2 SV=1 F6XC64;E9PV41;Q6NS79;D3Z074;O08808;E9PXV7;E9PYA5 F6XC64;E9PV41;Q6NS79;D3Z074;O08808;E9PXV7 Protein diaphanous Diap1;Diaph1 homolog >tr|F6XC64|F6XC64_MOUSE Uncharacterized protein (Fragment) OS=Mus musculus GN=Diap1 PE=4 SV=1;>tr|E9PV41|E9PV41_MOUSE Uncharacterized protein OS=Mus musculus GN=Diap Q9EP96;D3Z5U7;E9PWV5;D3Z278 Q9EP96 Solute carrier Slco1a4 organic anion >sp|Q9EP96|SO1A4_MOUSE transporter family member Solute 1A4carrier organic anion transporter family member 1A4 OS=Mus musculus GN=Slco1a4 PE=2 SV=1 Q3TUH1;G5E881;D6RGT1;G3UWL8;Q3TUH1-2;G3UYJ1 Q3TUH1;G5E881;D6RGT1;G3UWL8;Q3TUH1-2 Mitochondrial Tamm41 translocator >sp|Q3TUH1|TAM41_MOUSE assembly and maintenanceMitochondrial protein 41 homolog translocator assembly and maintenance protein 41 homolog OS=Mus musculus GN=Tamm41 PE=1 SV=2;>tr|G5E881|G5E881_MOUSE RIKEN cD P46412;D3Z2Y7;D3Z7Y0;E9QK84;F2Z3Y2 P46412;D3Z2Y7;D3Z7Y0 GlutathioneGpx3 peroxidase>sp|P46412|GPX3_MOUSE 3;Glutathione peroxidase Glutathione peroxidase OS=Mus musculus GN=Gpx3 PE=2 SV=2;>tr|D3Z2Y7|D3Z2Y7_MOUSE Glutathione peroxidase (Fragment) OS=Mus musculus GN=Gpx3 P Q9DBM0-2;Q7TSR6;Q9DBM0;E9Q0P2;E9PWU8 Q9DBM0-2;Q7TSR6;Q9DBM0;E9Q0P2;E9PWU8 ATP-bindingAbcg8 cassette sub-family >sp|Q9DBM0-2|ABCG8_MOUSE G member Isoform of ATP-binding cassette sub-family G member OS=Mus musculus GN=Abcg8;>tr|Q7TSR6|Q7TSR6_MOUSE ATP-binding cassette sub-family G me Q8K3M1;Q5FW69 Q8K3M1;Q5FW69 BC089597 >tr|Q8K3M1|Q8K3M1_MOUSE Cis-retinol/3alpha hydroxysterol short-chain dehydrogenase-like protein OS=Mus musculus GN=BC089597 PE=2 SV=1;>tr|Q5FW69|Q5FW69_MOUSE BC0895 P01872;P01873 P01872;P01873 Ig mu chainIgh-6 C region secreted >sp|P01872|IGHM_MOUSE form;Ig mu chain C region Ig mumembrane-bound chain C region secreted form form OS=Mus musculus GN=Igh-6 PE=1 SV=2;>sp|P01873|MUCM_MOUSE Ig mu chain C region membrane-bound form OS=Mus m E9PWQ3;D3YWD1;E9Q8G0;F6R0L1 E9PWQ3;D3YWD1;E9Q8G0 Col6a3 >tr|E9PWQ3|E9PWQ3_MOUSE Uncharacterized protein OS=Mus musculus GN=Col6a3 PE=4 SV=1;>tr|D3YWD1|D3YWD1_MOUSE Collagen, type VI, alpha (Fragment) OS=Mus musculus G Q8VI94;E9PY91 Q8VI94;E9PY91 2-5-oligoadenylate Oasl1 synthase-like >tr|Q8VI94|Q8VI94_MOUSE protein 2,5-oligoadenylate synthetase-like OS=Mus musculus GN=Oasl1 PE=2 SV=1;>tr|E9PY91|E9PY91_MOUSE Uncharacterized protein OS=Mus musculus GN=Oasl1 F8WIT2;P14824 F8WIT2;P14824 Annexin;Annexin Anxa6A6 >tr|F8WIT2|F8WIT2_MOUSE Annexin OS=Mus musculus GN=Anxa6 PE=3 SV=1;>sp|P14824|ANXA6_MOUSE Annexin A6 OS=Mus musculus GN=Anxa6 PE=1 SV=3 P33622;E9QP56 P33622;E9QP56 Apolipoprotein Apoc3 C-III >sp|P33622|APOC3_MOUSE Apolipoprotein C-III OS=Mus musculus GN=Apoc3 PE=2 SV=2;>tr|E9QP56|E9QP56_MOUSE Uncharacterized protein OS=Mus musculus GN=Apoc3 PE=4 SV=1 Q9QY30 Q9QY30 Bile salt export Abcb11 pump >sp|Q9QY30|ABCBB_MOUSE Bile salt export pump OS=Mus musculus GN=Abcb11 PE=1 SV=2 P04919-2;P04919 P04919-2;P04919 Band anion Slc4a1 transport >sp|P04919-2|B3AT_MOUSE protein Isoform Kidney of Band anion transport protein OS=Mus musculus GN=Slc4a1;>sp|P04919|B3AT_MOUSE Band anion transport protein OS=Mus musculus G Q02357;E9QNT8;Q02357-3;G8JL84;D3Z5M4;Q0VGY9;Q02357-4;Q02357-6;Q02357-5;Q02357-2;G5E8J2;B7ZW98;E9QPP1;D3YTV8;E9QLM8;E9QPV4;F7D1P5;G3UY11;D6RJ51 Q02357;E9QNT8;Q02357-3;G8JL84;D3Z5M4;Q0VGY9;Q02357-4;Q02357-6;Q02357-5;Q02357-2;G5E8J2;B7ZW98;E9QPP1;D3YTV8;E9QLM8;E9QPV4;F7D1P5;G3UY11 Ankyrin-1 Ank1 >sp|Q02357|ANK1_MOUSE Ankyrin-1 OS=Mus musculus GN=Ank1 PE=1 SV=2;>tr|E9QNT8|E9QNT8_MOUSE Uncharacterized protein OS=Mus musculus GN=Ank1 PE=4 SV=1;>sp|Q02357-3 A2BE93;Q9EQU5-2;Q9EQU5;A2BE92;Q9EQU5-3 A2BE93;Q9EQU5-2;Q9EQU5;A2BE92 Protein SETSet >tr|A2BE93|A2BE93_MOUSE SET nuclear oncogene (Fragment) OS=Mus musculus GN=Set PE=3 SV=1;>sp|Q9EQU5-2|SET_MOUSE Isoform of Protein SET OS=Mus musculus GN=Set;>sp|Q Q9Z2J0 Q9Z2J0 Solute carrier Slc23a1 family 23>sp|Q9Z2J0|S23A1_MOUSE member Solute carrier family 23 member OS=Mus musculus GN=Slc23a1 PE=1 SV=2 E9Q3S1;Q6GTJ9;P35951;B1AXJ6;F6YZZ8;Q924X6-2;B1AXJ3;B1AXJ5;B1AXJ4;Q924X6 E9Q3S1;Q6GTJ9;P35951 Low-densityLdlr lipoprotein>tr|E9Q3S1|E9Q3S1_MOUSE receptor Uncharacterized protein OS=Mus musculus GN=Ldlr PE=4 SV=1;>tr|Q6GTJ9|Q6GTJ9_MOUSE Low density lipoprotein receptor OS=Mus musculus GN=Ldlr PE=2 Q9WU79;F6PYI8;F6YFQ5;F6XMC0;E9PUR5 Q9WU79 Proline dehydrogenase Prodh >sp|Q9WU79|PROD_MOUSE 1, mitochondrial Proline dehydrogenase 1, mitochondrial OS=Mus musculus GN=Prodh PE=2 SV=2 E9QN08;Q80T06;P57776;D3YUQ9;P57776-3;D3YZT9;Q91VK2;D3YY68 E9QN08;Q80T06;P57776;D3YUQ9;P57776-3;D3YZT9;Q91VK2 Elongation factor Eef1d 1-delta >tr|E9QN08|E9QN08_MOUSE Eukaryotic translation elongation factor delta (guanine nucleotide exchange protein) (Fragment) OS=Mus musculus GN=Eef1d PE=3 SV=1;>tr|Q80T06|Q80T0 Q921K2 Q921K2 Parp1 >tr|Q921K2|Q921K2_MOUSE Poly (ADP-ribose) polymerase family, member OS=Mus musculus GN=Parp1 PE=2 SV=1 P27786 P27786 Steroid 17-alpha-hydroxylase/17,20 Cyp17a1 >sp|P27786|CP17A_MOUSE lyase Steroid 17-alpha-hydroxylase/17,20 lyase OS=Mus musculus GN=Cyp17a1 PE=2 SV=1 Q60605-2;Q60605;E9QLM0 Q60605-2;Q60605;E9QLM0 Myosin lightMyl6 polypeptide >sp|Q60605-2|MYL6_MOUSE Isoform Smooth muscle of Myosin light polypeptide OS=Mus musculus GN=Myl6;>sp|Q60605|MYL6_MOUSE Myosin light polypeptide OS=Mus musculus G Q3UPN1;P29533;P29533-2 Q3UPN1;P29533 Vascular cellVcam1 adhesion protein >tr|Q3UPN1|Q3UPN1_MOUSE Uncharacterized protein OS=Mus musculus GN=Vcam1 PE=2 SV=1;>sp|P29533|VCAM1_MOUSE Vascular cell adhesion protein OS=Mus musculus GN=Vcam P27046;F6QMB7;Q9WU23;Q8BRK9-2;Q8BRK9 P27046 Alpha-mannosidase Man2a1 >sp|P27046|MA2A1_MOUSE Alpha-mannosidase OS=Mus musculus GN=Man2a1 PE=1 SV=2 P50462 P50462 Cysteine and Csrp3 glycine-rich >sp|P50462|CSRP3_MOUSE protein Cysteine and glycine-rich protein OS=Mus musculus GN=Csrp3 PE=1 SV=1 O09158;D3Z2W7;D6RJM4;D3Z707 O09158;D3Z2W7 CytochromeCyp3a25;Cyp3a59 P450 3A25>sp|O09158|CP3AP_MOUSE Cytochrome P450 3A25 OS=Mus musculus GN=Cyp3a25 PE=2 SV=1;>tr|D3Z2W7|D3Z2W7_MOUSE Uncharacterized protein OS=Mus musculus GN=Cyp3a59 PE= F7C386;E9PX91;Q8BSF4;F6TVX7;Q3TJ76;D3YY63;D3Z0X7 F7C386;E9PX91;Q8BSF4;F6TVX7;Q3TJ76;D3YY63 Phosphatidylserine Pisd;Gm20671 decarboxylase >tr|F7C386|F7C386_MOUSE proenzyme;Phosphatidylserine Phosphatidylserine decarboxylase decarboxylase alpha chain;Phosphatidylserine (Fragment) OS=Mus musculus decarboxylase GN=Pisd PE=4 beta SV=1;>tr|E9PX91|E9PX91_MOUSE chain Uncharacterized protein OS=Mus musculus G Q9JM96;A2A6Q2;A2A6Q3 Q9JM96;A2A6Q2;A2A6Q3 Cdc42 effector Cdc42ep4 protein >sp|Q9JM96|BORG4_MOUSE Cdc42 effector protein OS=Mus musculus GN=Cdc42ep4 PE=1 SV=1;>tr|A2A6Q2|A2A6Q2_MOUSE CDC42 effector protein (Rho GTPase binding) (Fragment Q08857 Q08857 Platelet glycoprotein Cd36 >sp|Q08857|CD36_MOUSE Platelet glycoprotein OS=Mus musculus GN=Cd36 PE=1 SV=2 Q9CWD8;F7D3P0 Q9CWD8 Iron-sulfur protein Nubpl NUBPL >sp|Q9CWD8|NUBPL_MOUSE Iron-sulfur protein NUBPL OS=Mus musculus GN=Nubpl PE=2 SV=2 Q8BKX1-3;B1AZ46;Q8BKX1-2;Q8BKX1;Q8BKX1-4 Q8BKX1-3;B1AZ46;Q8BKX1-2;Q8BKX1;Q8BKX1-4 Brain-specific Baiap2 angiogenesis >sp|Q8BKX1-3|BAIP2_MOUSE inhibitor 1-associated protein Isoform of Brain-specific angiogenesis inhibitor 1-associated protein OS=Mus musculus GN=Baiap2;>tr|B1AZ46|B1AZ46_MOUSE Brain-specific angiogenes A2ATU0;Q9CX00 A2ATU0 Probable 2-oxoglutarate Dhtkd1 >sp|A2ATU0|DHTK1_MOUSE dehydrogenase E1 component Probable DHKTD1, 2-oxoglutarate mitochondrial dehydrogenase E1 component DHKTD1, mitochondrial OS=Mus musculus GN=Dhtkd1 PE=2 SV=1 P52019;Q3TSS7 P52019;Q3TSS7 Squalene monooxygenase Sqle >sp|P52019|ERG1_MOUSE Squalene monooxygenase OS=Mus musculus GN=Sqle PE=2 SV=1;>tr|Q3TSS7|Q3TSS7_MOUSE Uncharacterized protein OS=Mus musculus GN=Sqle PE=2 SV=1 Q03311 Q03311 Cholinesterase Bche >sp|Q03311|CHLE_MOUSE Cholinesterase OS=Mus musculus GN=Bche PE=2 SV=2 A6H611;E9Q785 A6H611;E9Q785 Mitochondrial Mipep intermediate >sp|A6H611|MIPEP_MOUSE peptidase Mitochondrial intermediate peptidase OS=Mus musculus GN=Mipep PE=2 SV=1;>tr|E9Q785|E9Q785_MOUSE Uncharacterized protein OS=Mus musculus GN=M P14576;E9PZR5;E9PXC0;P14576-2 P14576;E9PZR5;E9PXC0 Signal recognition Srp54;Srp54c particle >sp|P14576|SRP54_MOUSE 54 kDa protein Signal recognition particle 54 kDa protein OS=Mus musculus GN=Srp54 PE=1 SV=2;>tr|E9PZR5|E9PZR5_MOUSE Uncharacterized protein OS=Mus musculus GN= D3YUS5;E9PYD8;E9PW37;F6QQP6;Q3UHC7-2;F6RK07;A2AUX5;A2AUX4;A2AUX3;Q3UHC7-3;B7ZD29;Q3UHC7 D3YUS5;E9PYD8;E9PW37 Rasal2 >tr|D3YUS5|D3YUS5_MOUSE RAS protein activator-like OS=Mus musculus GN=Rasal2 PE=4 SV=1;>tr|E9PYD8|E9PYD8_MOUSE RAS protein activator-like OS=Mus musculus GN=Rasal2 PE P97379-2;P97379 P97379-2;P97379 Ras GTPase-activating G3bp2 protein-binding >sp|P97379-2|G3BP2_MOUSE protein Isoform B of Ras GTPase-activating protein-binding protein OS=Mus musculus GN=G3bp2;>sp|P97379|G3BP2_MOUSE Ras GTPase-activating protein-bindin Q68FF9 Q68FF9 3-oxo-5-alpha-steroid Srd5a1 4-dehydrogenase >sp|Q68FF9|S5A1_MOUSE 3-oxo-5-alpha-steroid 4-dehydrogenase OS=Mus musculus GN=Srd5a1 PE=2 SV=2 Q8BGT5;D6RFQ8 Q8BGT5 Alanine aminotransferase Gpt2 >sp|Q8BGT5|ALAT2_MOUSE Alanine aminotransferase OS=Mus musculus GN=Gpt2 PE=2 SV=1 Q8VCH7 Q8VCH7 Retinol dehydrogenase Rdh10 >sp|Q8VCH7|RDH10_MOUSE 10 Retinol dehydrogenase 10 OS=Mus musculus GN=Rdh10 PE=1 SV=2 D3Z069;Q8K1N2;Q8K1N2-2;F8WJ06;F6QU68;D3Z1R8;D3Z231 D3Z069;Q8K1N2;Q8K1N2-2 Pleckstrin homology-like Phldb2 >tr|D3Z069|D3Z069_MOUSE domain family B member Pleckstrin homology-like domain, family B, member (Fragment) OS=Mus musculus GN=Phldb2 PE=4 SV=1;>sp|Q8K1N2|PHLB2_MOUSE Pleckstrin homology-li Q61112;Q61112-2 Q61112;Q61112-2 45 kDa calcium-binding Sdf4 >sp|Q61112|CAB45_MOUSE protein 45 kDa calcium-binding protein OS=Mus musculus GN=Sdf4 PE=2 SV=1;>sp|Q61112-2|CAB45_MOUSE Isoform of 45 kDa calcium-binding protein OS=Mus mus Q91WG0;D3YWM6 Q91WG0;D3YWM6 Ces2c;Ces2d-ps >tr|Q91WG0|Q91WG0_MOUSE Carboxylesterase OS=Mus musculus GN=Ces2c PE=2 SV=1;>tr|D3YWM6|D3YWM6_MOUSE Uncharacterized protein OS=Mus musculus GN=Ces2d-ps PE=4 Q9D6M3;E9PV90;E9PY45;E9Q6M6;E9Q579;F6UUQ1;Q9DB41-2;Q9DB41;G3UX09 Q9D6M3;E9PV90;E9PY45;E9Q6M6 Mitochondrial Slc25a22 glutamate >sp|Q9D6M3|GHC1_MOUSE carrier Mitochondrial glutamate carrier OS=Mus musculus GN=Slc25a22 PE=1 SV=1;>tr|E9PV90|E9PV90_MOUSE Solute carrier family 25 (mitochondrial carrier, gluta P48410;A2ALN0 P48410;A2ALN0 ATP-bindingAbcd1 cassette sub-family >sp|P48410|ABCD1_MOUSE D member ATP-binding cassette sub-family D member OS=Mus musculus GN=Abcd1 PE=1 SV=1;>tr|A2ALN0|A2ALN0_MOUSE ATP-binding cassette, sub-family D, membe Q3TQS1;Q8R3F0 Q3TQS1;Q8R3F0 Larp1b >tr|Q3TQS1|Q3TQS1_MOUSE Uncharacterized protein OS=Mus musculus GN=Larp1b PE=2 SV=1;>tr|Q8R3F0|Q8R3F0_MOUSE Larp2 protein OS=Mus musculus GN=Larp1b PE=2 SV=1 Q9CWP6;B1AU74;Q9CWP6-2;Q9CWP6-3;Q9CWP6-4 Q9CWP6;B1AU74;Q9CWP6-2;Q9CWP6-3;Q9CWP6-4 Motile sperm Mospd2 domain-containing >sp|Q9CWP6|MSPD2_MOUSE protein Motile sperm domain-containing protein OS=Mus musculus GN=Mospd2 PE=1 SV=2;>tr|B1AU74|B1AU74_MOUSE Motile sperm domain containing OS=M Q91W64;E9Q8U5;E9Q2L0 Q91W64 CytochromeCyp2c70 P450 2C70>sp|Q91W64|CP270_MOUSE Cytochrome P450 2C70 OS=Mus musculus GN=Cyp2c70 PE=2 SV=2 A2A839;A2A838;P48193;A2A841;A2AD32;F7BUB8 A2A839;A2A838;P48193;A2A841;A2AD32;F7BUB8 Protein 4.1 Epb4.1;Epb41 >tr|A2A839|A2A839_MOUSE Erythrocyte protein band 4.1 OS=Mus musculus GN=Epb4.1 PE=4 SV=1;>tr|A2A838|A2A838_MOUSE Erythrocyte protein band 4.1 (Fragment) OS=Mus musculu Q9JMH9-1;B2RRE2;Q9JMH9;Q9JMH9-6;E9QAX2;E9QA74;E9Q405;Q9JMH9-5;Q9JMH9-7;Q9JMH9-2;Q9JMH9-4 Q9JMH9-1;B2RRE2;Q9JMH9;Q9JMH9-6;E9QAX2;E9QA74;E9Q405;Q9JMH9-5;Q9JMH9-7;Q9JMH9-2;Q9JMH9-4 Unconventional Myo18a myosin-XVIIIa >sp|Q9JMH9-1|MY18A_MOUSE Isoform of Unconventional myosin-XVIIIa OS=Mus musculus GN=Myo18a;>tr|B2RRE2|B2RRE2_MOUSE Myo18a protein OS=Mus musculus GN=Myo18a PE F6YE50;E9Q066;Q8BWW4;G3X9Q6 F6YE50;E9Q066;Q8BWW4;G3X9Q6 La-related protein Larp4 >tr|F6YE50|F6YE50_MOUSE Uncharacterized protein (Fragment) OS=Mus musculus GN=Larp4 PE=4 SV=1;>tr|E9Q066|E9Q066_MOUSE Uncharacterized protein OS=Mus musculus GN=Larp P15508;E9Q5I4;E9Q397;Q3UGX2;Q149M1 P15508;E9Q5I4;E9Q397;Q3UGX2 Spectrin beta Sptb chain, erythrocytic >sp|P15508|SPTB1_MOUSE Spectrin beta chain, erythrocyte OS=Mus musculus GN=Sptb PE=1 SV=4;>tr|E9Q5I4|E9Q5I4_MOUSE Uncharacterized protein OS=Mus musculus GN=Spnb1 PE=4 P14602-2;P14602;D3YZ06;P14602-3 P14602-2;P14602;D3YZ06;P14602-3 Heat shock Hspb1 protein beta-1 >sp|P14602-2|HSPB1_MOUSE Isoform B of Heat shock protein beta-1 OS=Mus musculus GN=Hspb1;>sp|P14602|HSPB1_MOUSE Heat shock protein beta-1 OS=Mus musculus GN=Hspb1 PE M AN U SC RI PT Protein IDs AC C EP TE D Razor + Ratio H/L Ratio H/L L/H FOLD CHANGE L/H FOLD CHANGE Ratio H/L normalized Ratio H/L normalized L/H FOLD CHANGE unique normalized Nr8 (Wt normalized Nr24 L/H FXR-/- Veh/ Wt Veh L/H FXR-/- OCA /FXR-/- Veh Nr50 (Wt OCA) Nr19 (FXR-/- Veh) Wt OCA /Wt Veh peptides Veh) (FXR-/- OCA) 0.8593 0.26419 0.36062 NaN 3.253 2.383 #VALUE! 0.52927 0.21801 0.17564 0.20769 2.428 3.013 -1.182 24 1.1363 0.48881 1.6374 NaN 2.325 -1.441 #VALUE! 5.5954 1.2182 14.237 15.004 4.593 -2.544 -1.054 0.6007 NaN 0.97922 0.93518 #VALUE! -1.630 1.047 3.0373 0.85108 4.1062 3.7131 3.569 -1.352 1.106 NaN 0.18104 NaN 0.1289 #VALUE! #VALUE! #VALUE! NaN 0.30517 0.096931 0.11169 #VALUE! #VALUE! -1.152 1.5761 0.61057 1.4272 NaN 2.581 1.104 #VALUE! 1.5684 1.4367 1.4769 1.7546 1.092 1.062 -1.188 1.7579 NaN 0.54925 0.73851 #VALUE! 3.201 -1.345 NaN 0.24836 0.085714 0.086834 #VALUE! #VALUE! -1.013 NaN 0.65297 NaN NaN #VALUE! #VALUE! #VALUE! 0.4874 NaN 0.25397 NaN #VALUE! 1.919 #VALUE! 0.8092 0.49503 NaN 0.92016 1.635 #VALUE! #VALUE! NaN 0.83118 0.60547 0.81242 #VALUE! #VALUE! -1.342 0.76509 0.67789 1.1066 0.87786 1.129 -1.446 1.261 0.49753 0.24165 0.27419 1.0509 2.059 1.815 -3.833 15 0.99312 1.0861 0.65484 0.50913 -1.094 1.517 1.286 0.462 0.27388 0.8093 0.77867 1.687 -1.752 1.039 44 1.6126 1.1508 0.39029 0.36593 1.401 4.132 1.067 0.9124 0.4244 4.8438 4.4079 2.150 -5.309 1.099 60 9.7743 4.8345 8.623 4.756 2.022 1.134 1.813 24 8.3316 4.67 5.9112 3.6958 1.784 1.409 1.599 49 2.46 0.76804 1.157 2.5032 3.203 2.126 -2.164 1.5337 1.2875 1.2432 0.863 1.191 1.234 1.441 2.7081 1.4538 1.3358 1.0854 1.863 2.027 1.231 0.71038 0.47669 1.6356 1.5814 1.490 -2.302 1.034 31 NaN 2.0103 1.6517 NaN #VALUE! #VALUE! #VALUE! 1.5487 0.92256 0.85747 0.74454 1.679 1.806 1.152 NaN 0.81197 0.21994 0.26598 #VALUE! #VALUE! -1.209 12 1.1774 0.6754 0.83162 0.88329 1.743 1.416 -1.062 0.93941 0.6276 0.46096 0.453 1.497 2.038 1.018 0.79793 0.48058 0.33 0.3691 1.660 2.418 -1.118 46 NaN 0.66579 0.9492 0.92886 #VALUE! #VALUE! 1.022 0.62131 0.46004 0.43157 0.78578 1.351 1.440 -1.821 18 0.79443 NaN 0.25568 0.40238 #VALUE! 3.107 -1.574 1.1714 0.49165 0.54522 0.67403 2.383 2.148 -1.236 1.3955 0.78379 0.28927 0.22092 1.780 4.824 1.309 10 0.2701 0.30354 0.39135 0.27394 -1.124 -1.449 1.429 0.73704 0.57707 1.1392 0.83929 1.277 -1.546 1.357 11 0.21838 0.27408 0.26636 0.38477 -1.255 -1.220 -1.445 28 2.3016 2.649 0.92275 0.77986 -1.151 2.494 1.183 0.38423 0.35763 0.29365 0.2649 1.074 1.308 1.109 0.21906 0.25885 0.27499 0.19128 -1.182 -1.255 1.438 13 1.5057 1.5614 1.9955 2.0935 -1.037 -1.325 -1.049 11 0.87218 NaN NaN NaN #VALUE! #VALUE! #VALUE! 1.0551 1.1534 1.0822 0.8721 -1.093 -1.026 1.241 2.3966 1.3786 37.189 18.507 1.738 -15.517 2.009 0.22508 0.2973 0.13102 0.12685 -1.321 1.718 1.033 26 0.84688 0.64027 NaN 1.2362 1.323 #VALUE! #VALUE! 0.96934 0.73124 NaN NaN 1.326 #VALUE! #VALUE! 0.48499 0.28507 0.34044 NaN 1.701 1.425 #VALUE! 0.57723 0.6248 0.77176 0.83555 -1.082 -1.337 -1.083 12 1.2302 0.87248 1.0403 0.92088 1.410 1.183 1.130 14 NaN 0.87263 0.41334 0.39869 #VALUE! #VALUE! 1.037 12 0.69572 NaN NaN NaN #VALUE! #VALUE! #VALUE! 1.2796 0.86336 0.61833 0.75682 1.482 2.069 -1.224 0.84761 1.0388 2.791 2.6254 -1.226 -3.293 1.063 24 0.91308 0.75862 0.73116 0.78846 1.204 1.249 -1.078 30 NaN NaN NaN NaN #VALUE! #VALUE! #VALUE! NaN NaN NaN NaN #VALUE! #VALUE! #VALUE! NaN NaN NaN NaN #VALUE! #VALUE! #VALUE! NaN NaN 0.54766 NaN #VALUE! #VALUE! #VALUE! ACCEPTED MANUSCRIPT #VALUE! -1.003 -1.093 1.673 -1.249 -1.073 1.108 -1.044 1.059 #VALUE! 1.035 1.073 1.261 -1.085 1.121 -1.021 -1.128 -1.008 1.055 -1.563 -1.340 1.103 -1.046 1.344 -1.176 -1.124 -1.237 1.215 1.809 #VALUE! #VALUE! -1.147 1.122 -1.030 -1.000 1.388 1.346 1.501 #VALUE! 1.083 -1.076 1.118 1.050 1.072 -1.066 -1.214 1.183 1.380 1.016 1.123 1.069 1.159 -1.181 -9.797 -1.101 -1.048 -1.076 1.137 #VALUE! -1.597 -1.330 1.280 -1.133 #VALUE! 1.053 -1.003 #VALUE! 17 13 27 44 51 5 5 22 71 44 34 12 15 27 25 14 3 12 10 10 10 39 44 23 18 18 11 12 11 59 11 13 40 14 10 34 Q8R3L2;Q8R3L2-3;Q8R3L2-2;Q8R3L2-5;B2ZAC8;Q8R3L2-4 Q8R3L2;Q8R3L2-3;Q8R3L2-2;Q8R3L2-5;B2ZAC8;Q8R3L2-4 Transcription Tcf25 factor 25 >sp|Q8R3L2|TCF25_MOUSE Transcription factor 25 OS=Mus musculus GN=Tcf25 PE=1 SV=2;>sp|Q8R3L2-3|TCF25_MOUSE Isoform of Transcription factor 25 OS=Mus musculus GN=Tcf25; Q99N15;A2AFQ2;O08756 Q99N15;A2AFQ2;O08756 3-hydroxyacyl-CoA Hsd17b10 dehydrogenase >tr|Q99N15|Q99N15_MOUSE type-2 17beta-hydroxysteroid dehydrogenase type 10/short chain L-3-hydroxyacyl-CoA dehydrogenase OS=Mus musculus GN=Hsd17b10 PE=2 SV=1;>tr|A2AFQ2|A2A O55003 O55003 BCL2/adenovirus Bnip3 E1B 19 >sp|O55003|BNIP3_MOUSE kDa protein-interacting protein BCL2/adenovirus E1B 19 kDa protein-interacting protein OS=Mus musculus GN=Bnip3 PE=1 SV=1 P49222;Q3UV95 P49222;Q3UV95 ErythrocyteEpb42;Epb4.2 membrane>sp|P49222|EPB42_MOUSE protein band 4.2 Erythrocyte membrane protein band 4.2 OS=Mus musculus GN=Epb42 PE=2 SV=3;>tr|Q3UV95|Q3UV95_MOUSE Erythrocyte protein band 4.2 OS=Mus musculu Q9JK42 Q9JK42 [Pyruvate dehydrogenase Pdk2 >sp|Q9JK42|PDK2_MOUSE [lipoamide]] kinase isozyme [Pyruvate 2, mitochondrial dehydrogenase [lipoamide]] kinase isozyme 2, mitochondrial OS=Mus musculus GN=Pdk2 PE=1 SV=2 P21440;F6SR33;B5X0E4 P21440 Multidrug resistance Abcb4 protein >sp|P21440|MDR3_MOUSE Multidrug resistance protein OS=Mus musculus GN=Abcb4 PE=2 SV=2 A2AVJ7;Q99PL5;Q99PL5-4;Q99PL5-3;E9PUZ4;Q99PL5-2;Q99PL5-10;Q99PL5-9;Q99PL5-8;Q99PL5-7;Q99PL5-6;Q99PL5-5;Q99PL5-12;Q99PL5-11 A2AVJ7;Q99PL5 Ribosome-binding Rrbp1 protein >tr|A2AVJ7|A2AVJ7_MOUSE Ribosome binding protein OS=Mus musculus GN=Rrbp1 PE=4 SV=1;>sp|Q99PL5|RRBP1_MOUSE Ribosome-binding protein OS=Mus musculus GN=Rrbp1 PE= Q5SWU9;E9PUB1;Q5SWU9-2 Q5SWU9;E9PUB1;Q5SWU9-2 Acetyl-CoA carboxylase Acaca >sp|Q5SWU9|ACACA_MOUSE 1;Biotin carboxylase Acetyl-CoA carboxylase OS=Mus musculus GN=Acaca PE=1 SV=1;>tr|E9PUB1|E9PUB1_MOUSE Uncharacterized protein OS=Mus musculus GN=Acaca PE=4 S P09925;E9Q5F2;A2ALA6 P09925;E9Q5F2;A2ALA6 Surfeit locusSurf1 protein >sp|P09925|SURF1_MOUSE Surfeit locus protein OS=Mus musculus GN=Surf1 PE=2 SV=3;>tr|E9Q5F2|E9Q5F2_MOUSE Uncharacterized protein OS=Mus musculus GN=Surf1 PE=4 SV=1;>t Q99MN1;Q8R2P8 Q99MN1;Q8R2P8 Lysine tRNA Kars ligase >sp|Q99MN1|SYK_MOUSE Lysine tRNA ligase OS=Mus musculus GN=Kars PE=1 SV=1;>tr|Q8R2P8|Q8R2P8_MOUSE Lysyl-tRNA synthetase OS=Mus musculus GN=Kars PE=2 SV=1 G5E8T3;Q9D104;E9Q8C2;Q9D7A6;D6RHP8 G5E8T3;Q9D104;E9Q8C2;Q9D7A6 Signal recognition Srp19 particle >tr|G5E8T3|G5E8T3_MOUSE 19 kDa protein Signal recognition particle 19, isoform CRA_b OS=Mus musculus GN=Srp19 PE=4 SV=1;>tr|Q9D104|Q9D104_MOUSE Signal recognition particle 19, isoform CRA Q3TMP1 Q3TMP1 Gtf3c3 >tr|Q3TMP1|Q3TMP1_MOUSE General transcription factor IIIC, polypeptide OS=Mus musculus GN=Gtf3c3 PE=2 SV=1 A2ALU4;A7TU71;A2ALU4-2 A2ALU4;A7TU71;A2ALU4-2 Protein Shroom2 Shroom2 >sp|A2ALU4|SHRM2_MOUSE Protein Shroom2 OS=Mus musculus GN=Shroom2 PE=1 SV=1;>tr|A7TU71|A7TU71_MOUSE SHROOM2 OS=Mus musculus GN=Shroom2 PE=2 SV=1;>sp|A2ALU Q91VU9;O88630 Q91VU9;O88630 Golgi SNAP Gosr1 receptor complex >tr|Q91VU9|Q91VU9_MOUSE member Golgi SNAP receptor complex member OS=Mus musculus GN=Gosr1 PE=2 SV=1;>sp|O88630|GOSR1_MOUSE Golgi SNAP receptor complex member OS=M P59242-2;D3YUW7;P59242;E9QMC1;E9Q611 P59242-2;D3YUW7;P59242;E9QMC1 Cingulin Cgn >sp|P59242-2|CING_MOUSE Isoform of Cingulin OS=Mus musculus GN=Cgn;>tr|D3YUW7|D3YUW7_MOUSE Uncharacterized protein OS=Mus musculus GN=Cgn PE=4 SV=1;>sp|P59242|C Q9D0I4;B1AVI2;Q9D614 Q9D0I4;B1AVI2;Q9D614 Syntaxin-17Stx17 >sp|Q9D0I4|STX17_MOUSE Syntaxin-17 OS=Mus musculus GN=Stx17 PE=2 SV=1;>tr|B1AVI2|B1AVI2_MOUSE Syntaxin 17 (Fragment) OS=Mus musculus GN=Stx17 PE=4 SV=1;>tr|Q9D614|Q P19096 P19096 Fatty acid synthase;[Acyl-carrier-protein] Fasn >sp|P19096|FAS_MOUSE S-acetyltransferase;[Acyl-carrier-protein] Fatty acid synthase OS=Mus musculus S-malonyltransferase;3-oxoacyl-[acyl-carrier-protein] GN=Fasn PE=1 SV=2 synthase;3-oxoacyl-[acyl-carrier-protein] reductase;3-hydroxyacyl-[acyl-carr Q811S7-2;Q811S7;Q9ERA0-3;Q9ERA0;Q9ERA0-2 Q811S7-2;Q811S7 Upstream-binding Ubp1 protein >sp|Q811S7-2|UBIP1_MOUSE Isoform of Upstream-binding protein OS=Mus musculus GN=Ubp1;>sp|Q811S7|UBIP1_MOUSE Upstream-binding protein OS=Mus musculus GN=Ubp1 P Q8VI47 Q8VI47 Canalicular Abcc2 multispecific>sp|Q8VI47|MRP2_MOUSE organic anion transporter 1Canalicular multispecific organic anion transporter OS=Mus musculus GN=Abcc2 PE=2 SV=2 P56593 P56593 CytochromeCyp2a12 P450 2A12>sp|P56593|CP2AC_MOUSE Cytochrome P450 2A12 OS=Mus musculus GN=Cyp2a12 PE=1 SV=2 P48776 P48776 TryptophanTdo2 2,3-dioxygenase >sp|P48776|T23O_MOUSE Tryptophan 2,3-dioxygenase OS=Mus musculus GN=Tdo2 PE=1 SV=2 E9Q179;Q8C5Q4;D3YUN1;D3YV30 E9Q179;Q8C5Q4 G-rich sequence Grsf1factor >tr|E9Q179|E9Q179_MOUSE G-rich RNA sequence-binding factor OS=Mus musculus GN=Grsf1 PE=4 SV=1;>sp|Q8C5Q4|GRSF1_MOUSE G-rich sequence factor OS=Mus musculus GN=Gr E9QNH3;Q91VH2 E9QNH3;Q91VH2 Sorting nexin-9 Snx9 >tr|E9QNH3|E9QNH3_MOUSE Uncharacterized protein OS=Mus musculus GN=Snx9 PE=4 SV=1;>sp|Q91VH2|SNX9_MOUSE Sorting nexin-9 OS=Mus musculus GN=Snx9 PE=1 SV=1 Q9CY16 Q9CY16 28S ribosomal Mrps28 protein S28, >sp|Q9CY16|RT28_MOUSE mitochondrial 28S ribosomal protein S28, mitochondrial OS=Mus musculus GN=Mrps28 PE=2 SV=1 P24721;B1AR35 P24721;B1AR35 Asialoglycoprotein Asgr2 receptor >sp|P24721|ASGR2_MOUSE Asialoglycoprotein receptor OS=Mus musculus GN=Asgr2 PE=1 SV=1;>tr|B1AR35|B1AR35_MOUSE Asialoglycoprotein receptor (Fragment) OS=Mus musculu O54950;D3YUS1;Q91WG5-2;Q8BIQ9;Q91WG5 O54950 5-AMP-activated Prkag1protein >sp|O54950|AAKG1_MOUSE kinase subunit gamma-1 5-AMP-activated protein kinase subunit gamma-1 OS=Mus musculus GN=Prkag1 PE=1 SV=2 P97872 P97872 Dimethylaniline Fmo5monooxygenase >sp|P97872|FMO5_MOUSE [N-oxide-forming] 5Dimethylaniline monooxygenase [N-oxide-forming] OS=Mus musculus GN=Fmo5 PE=2 SV=4 Q9R112;A2ATW7 Q9R112 Sulfide:quinone Sqrdloxidoreductase, >sp|Q9R112|SQRD_MOUSE mitochondrial Sulfide:quinone oxidoreductase, mitochondrial OS=Mus musculus GN=Sqrdl PE=2 SV=3 Q91WK1 Q91WK1 SPRY domain-containing Spryd4 >sp|Q91WK1|SPRY4_MOUSE protein SPRY domain-containing protein OS=Mus musculus GN=Spryd4 PE=2 SV=1 Q9D4H8-2;Q9D4H8;E0CYT5 Q9D4H8-2;Q9D4H8;E0CYT5 Cullin-2 Cul2 >sp|Q9D4H8-2|CUL2_MOUSE Isoform of Cullin-2 OS=Mus musculus GN=Cul2;>sp|Q9D4H8|CUL2_MOUSE Cullin-2 OS=Mus musculus GN=Cul2 PE=1 SV=2;>tr|E0CYT5|E0CYT5_MOUSE Cull Q3TGW2 Q3TGW2 Endonuclease/exonuclease/phosphatase Eepd1 >sp|Q3TGW2|EEPD1_MOUSE family domain-containing Endonuclease/exonuclease/phosphatase protein family domain-containing protein OS=Mus musculus GN=Eepd1 PE=1 SV=1 P17426-2;P17426;F6TPX8;E9PWD0;F6VSP9 P17426-2;P17426 AP-2 complex Ap2a1 subunit alpha-1 >sp|P17426-2|AP2A1_MOUSE Isoform B of AP-2 complex subunit alpha-1 OS=Mus musculus GN=Ap2a1;>sp|P17426|AP2A1_MOUSE AP-2 complex subunit alpha-1 OS=Mus musculus GN=A Q5SSK3;B7ZCA9 Q5SSK3 Transcription Tefm elongation >sp|Q5SSK3|TEFM_MOUSE factor, mitochondrial Transcription elongation factor, mitochondrial OS=Mus musculus GN=Tefm PE=2 SV=1 Q8CGA3;E9PW71 Q8CGA3;E9PW71 Large neutral Slc43a2 amino acids >sp|Q8CGA3|LAT4_MOUSE transporter small subunitLarge neutral amino acids transporter small subunit OS=Mus musculus GN=Slc43a2 PE=1 SV=1;>tr|E9PW71|E9PW71_MOUSE Uncharacterized protein OS=Mus B2RT14;P70691 B2RT14 Ugt1a5 >tr|B2RT14|B2RT14_MOUSE MCG14318, isoform CRA_h OS=Mus musculus GN=Ugt1a5 PE=2 SV=1 Q3TBW2;A2A715 Q3TBW2 39S ribosomal Mrpl10 protein L10, >sp|Q3TBW2|RM10_MOUSE mitochondrial 39S ribosomal protein L10, mitochondrial OS=Mus musculus GN=Mrpl10 PE=2 SV=2 Q9CWG8;Q9CWG8-2 Q9CWG8;Q9CWG8-2 NADH dehydrogenase Ndufaf7 [ubiquinone] >sp|Q9CWG8|MIDA_MOUSE complex I, assembly Protein factor midA homolog, mitochondrial OS=Mus musculus PE=2 SV=4;>sp|Q9CWG8-2|MIDA_MOUSE Isoform of Protein midA homolog, mitochondrial OS=Mus Q9JIK9 Q9JIK9 28S ribosomal Mrps34 protein S34, >sp|Q9JIK9|RT34_MOUSE mitochondrial 28S ribosomal protein S34, mitochondrial OS=Mus musculus GN=Mrps34 PE=2 SV=1 D3Z0T0;Q62311;D3Z5H6 D3Z0T0;Q62311;D3Z5H6 Transcription Taf6 initiation >tr|D3Z0T0|D3Z0T0_MOUSE factor TFIID subunit TAF6 RNA polymerase II, TATA box-binding protein (TBP)-associated factor OS=Mus musculus GN=Taf6 PE=4 SV=1;>sp|Q62311|TAF6_MOUSE Transcription init P35279 P35279 Ras-related Rab6a protein Rab-6A >sp|P35279|RAB6A_MOUSE Ras-related protein Rab-6A OS=Mus musculus GN=Rab6a PE=1 SV=4 Q8C1E7;D3Z0U3 Q8C1E7;D3Z0U3 Transmembrane Tmem120a protein >sp|Q8C1E7|T120A_MOUSE 120A Transmembrane protein 120A OS=Mus musculus GN=Tmem120a PE=2 SV=1;>tr|D3Z0U3|D3Z0U3_MOUSE Transmembrane protein 120A (Fragment) OS=Mus m Q61136;C7G3P2 Q61136;C7G3P2 Serine/threonine-protein Prpf4b >sp|Q61136|PRP4B_MOUSE kinase PRP4 homolog Serine/threonine-protein kinase PRP4 homolog OS=Mus musculus GN=Prpf4b PE=1 SV=3;>tr|C7G3P2|C7G3P2_MOUSE MKIAA0536 protein (Fragment) OS=Mus E9Q6K0;Q80X80;G5E8D9;E9PZE4 E9Q6K0;Q80X80;G5E8D9;E9PZE4 C2 domain-containing C2cd2l protein >tr|E9Q6K0|E9Q6K0_MOUSE 2-like C2 calcium-dependent domain-containing 2-like OS=Mus musculus GN=C2cd2l PE=4 SV=1;>sp|Q80X80|C2C2L_MOUSE C2 domain-containing protein 2-like OS= Q8BXB6;Q3V1K7;D3YY31;D3YZA9;F6TQP9 Q8BXB6;Q3V1K7 Solute carrier Slco2b1 organic anion >sp|Q8BXB6|SO2B1_MOUSE transporter family member Solute 2B1carrier organic anion transporter family member 2B1 OS=Mus musculus GN=Slco2b1 PE=1 SV=1;>tr|Q3V1K7|Q3V1K7_MOUSE Solute carrier organic anio Q8R0W0 Q8R0W0 Epiplakin Eppk1 >sp|Q8R0W0|EPIPL_MOUSE Epiplakin OS=Mus musculus GN=Eppk1 PE=1 SV=2 Q8K370 Q8K370 Acyl-CoA dehydrogenase Acad10 >sp|Q8K370|ACD10_MOUSE family member 10 Acyl-CoA dehydrogenase family member 10 OS=Mus musculus GN=Acad10 PE=2 SV=1 P08775 P08775 DNA-directed Polr2a RNA polymerase >sp|P08775|RPB1_MOUSE II subunit RPB1 DNA-directed RNA polymerase II subunit RPB1 OS=Mus musculus GN=Polr2a PE=1 SV=3 E9Q4Z2;D3Z0B3 E9Q4Z2 Acacb >tr|E9Q4Z2|E9Q4Z2_MOUSE Uncharacterized protein OS=Mus musculus GN=Acacb PE=4 SV=1 F8VQC1;E9Q740 F8VQC1;E9Q740 Signal recognition Srp72 particle >tr|F8VQC1|F8VQC1_MOUSE subunit SRP72 Uncharacterized protein OS=Mus musculus GN=Srp72 PE=4 SV=1;>tr|E9Q740|E9Q740_MOUSE Uncharacterized protein OS=Mus musculus GN=Srp72 PE=4 SV= Q8VHG0;D3YUF0;D3Z2C5 Q8VHG0 Dimethylaniline Fmo4monooxygenase >sp|Q8VHG0|FMO4_MOUSE [N-oxide-forming] 4Dimethylaniline monooxygenase [N-oxide-forming] OS=Mus musculus GN=Fmo4 PE=2 SV=3 Q6PDN3;B1B1A8;Q6PDN3-3;Q6PDN3-2;Q8BJ10 Q6PDN3;B1B1A8 Myosin lightMylk chain kinase, >sp|Q6PDN3|MYLK_MOUSE smooth muscle;Myosin light Myosin chainlight kinase, chain smooth kinase, muscle, smooth deglutamylated muscle OS=Mus form musculus GN=Mylk PE=1 SV=3;>tr|B1B1A8|B1B1A8_MOUSE Myosin, light polypeptide kinase OS=Mus muscu Q9D7J9;A2AR43 Q9D7J9;A2AR43 Enoyl-CoA hydratase Echdc3 domain-containing >sp|Q9D7J9|ECHD3_MOUSE protein 3, mitochondrial Enoyl-CoA hydratase domain-containing protein 3, mitochondrial OS=Mus musculus GN=Echdc3 PE=2 SV=1;>tr|A2AR43|A2AR43_MOUSE Enoyl Coenzyme A hy G5E870 G5E870 E3 ubiquitin-protein Trip12 ligase >tr|G5E870|G5E870_MOUSE TRIP12 Thyroid hormone receptor interactor 12, isoform CRA_a OS=Mus musculus GN=Trip12 PE=4 SV=1 Q91ZU6;E9PXE5;Q91ZU6-4;E9QL23;Q91ZU6-2;E9Q9X1;Q91ZU6-3 Q91ZU6;E9PXE5;Q91ZU6-4;E9QL23;Q91ZU6-2;E9Q9X1;Q91ZU6-3 Dystonin Dst >sp|Q91ZU6|DYST_MOUSE Dystonin OS=Mus musculus GN=Dst PE=1 SV=1;>tr|E9PXE5|E9PXE5_MOUSE Uncharacterized protein OS=Mus musculus GN=Dst PE=4 SV=1;>sp|Q91ZU6-4|DYST Q9CQD1 Q9CQD1 Ras-related Rab5a protein Rab-5A >sp|Q9CQD1|RAB5A_MOUSE Ras-related protein Rab-5A OS=Mus musculus GN=Rab5a PE=1 SV=1 P97855;Q3UR88 P97855;Q3UR88 Ras GTPase-activating G3bp1 protein-binding >sp|P97855|G3BP1_MOUSE protein Ras GTPase-activating protein-binding protein OS=Mus musculus GN=G3bp1 PE=1 SV=1;>tr|Q3UR88|Q3UR88_MOUSE Uncharacterized protein OS=Mus musc E9QAH1;E9PVZ8;B7ZNF9 E9QAH1;E9PVZ8 Golgb1 >tr|E9QAH1|E9QAH1_MOUSE Uncharacterized protein OS=Mus musculus GN=Golgb1 PE=4 SV=1;>tr|E9PVZ8|E9PVZ8_MOUSE Uncharacterized protein OS=Mus musculus GN=Golgb1 PE=4 Q62465 Q62465 Synaptic vesicle Vat1membrane >sp|Q62465|VAT1_MOUSE protein VAT-1 homolog Synaptic vesicle membrane protein VAT-1 homolog OS=Mus musculus GN=Vat1 PE=1 SV=3 Q8BYK6;Q8BYK6-2;F8WIR8;Q8BYK6-3 Q8BYK6;Q8BYK6-2;F8WIR8;Q8BYK6-3 YTH domainYthdf3 family protein >sp|Q8BYK6|YTHD3_MOUSE YTH domain family protein OS=Mus musculus GN=Ythdf3 PE=1 SV=2;>sp|Q8BYK6-2|YTHD3_MOUSE Isoform of YTH domain family protein OS=Mus muscu O88428 O88428 BifunctionalPapss2 3-phosphoadenosine >sp|O88428|PAPS2_MOUSE 5-phosphosulfate synthase Bifunctional 2;Sulfate 3-phosphoadenosine adenylyltransferase;Adenylyl-sulfate 5-phosphosulfate synthase kinase2 OS=Mus musculus GN=Papss2 PE=1 SV=2 P20852;F7B9W9;F6SHL3;E9Q5D4 P20852 CytochromeCyp2a5 P450 2A5 >sp|P20852|CP2A5_MOUSE Cytochrome P450 2A5 OS=Mus musculus GN=Cyp2a5 PE=2 SV=1 A8DUK4;P02088;E9Q223;P02089;CON Q3SX09;CON P02070 A8DUK4;P02088;E9Q223 HemoglobinHbb-b1 subunit beta-1 >tr|A8DUK4|A8DUK4_MOUSE Beta-globin OS=Mus musculus GN=Hbb-b1 PE=3 SV=1;>sp|P02088|HBB1_MOUSE Hemoglobin subunit beta-1 OS=Mus musculus GN=Hbb-b1 PE=1 SV=2;>tr|E Q91ZE0 Q91ZE0 Trimethyllysine Tmlhe dioxygenase, >sp|Q91ZE0|TMLH_MOUSE mitochondrial Trimethyllysine dioxygenase, mitochondrial OS=Mus musculus GN=Tmlhe PE=2 SV=2 P18581;E9QPL9;P18581-2;E9Q6C4;E9QJY0 P18581;E9QPL9;P18581-2;E9Q6C4;E9QJY0 Low affinitySlc7a2 cationic amino >sp|P18581|CTR2_MOUSE acid transporter Low affinity cationic amino acid transporter OS=Mus musculus GN=Slc7a2 PE=1 SV=2;>tr|E9QPL9|E9QPL9_MOUSE Uncharacterized protein OS=Mus musculus G Q8C6I2;Q8C6I2-3;Q8C6I2-2 Q8C6I2;Q8C6I2-3 Succinate dehydrogenase Sdhaf2 >sp|Q8C6I2|SDHF2_MOUSE assembly factor 2, mitochondrial Succinate dehydrogenase assembly factor 2, mitochondrial OS=Mus musculus GN=Sdhaf2 PE=2 SV=1;>sp|Q8C6I2-3|SDHF2_MOUSE Isoform of Succinate dehy Q91V92;Q3V117;Q3TS02 Q91V92;Q3V117 ATP-citrate Acly synthase >sp|Q91V92|ACLY_MOUSE ATP-citrate synthase OS=Mus musculus GN=Acly PE=1 SV=1;>tr|Q3V117|Q3V117_MOUSE ATP citrate lyase OS=Mus musculus GN=Acly PE=2 SV=1 Q3TS19;P13634;D3YYQ4 Q3TS19;P13634 Carbonic anhydrase Ca1 >tr|Q3TS19|Q3TS19_MOUSE Car1 protein OS=Mus musculus GN=Car1 PE=2 SV=1;>sp|P13634|CAH1_MOUSE Carbonic anhydrase OS=Mus musculus GN=Ca1 PE=2 SV=3 RI PT #VALUE! -1.354 1.036 1.203 1.230 1.390 -2.134 2.328 1.981 #VALUE! -1.622 -1.075 1.825 1.612 1.178 1.127 2.011 1.828 -1.192 -1.553 -2.248 1.254 1.091 -2.546 -1.681 1.342 1.106 1.670 1.088 1.904 #VALUE! 1.557 -1.405 1.849 1.670 #VALUE! -1.106 -1.879 #VALUE! 1.799 2.335 1.268 1.158 -1.810 -1.067 2.635 1.078 1.440 -1.605 2.053 1.011 1.088 1.256 -1.484 #VALUE! -1.237 2.216 3.004 -1.357 2.102 20.049 -1.346 2.525 #VALUE! 1.561 1.586 #VALUE! SC #VALUE! -1.045 1.379 1.547 1.077 1.683 1.065 1.239 1.607 1.358 -1.081 1.249 #VALUE! 1.286 1.703 1.343 1.838 1.917 1.496 1.308 2.559 1.454 1.169 -1.135 2.069 1.552 1.469 1.015 -1.461 1.604 1.144 1.542 1.108 1.288 -1.053 #VALUE! 1.730 1.124 #VALUE! 1.530 1.302 1.447 1.436 1.261 2.473 1.149 1.531 -1.154 -1.165 -1.241 1.134 1.125 1.239 1.295 #VALUE! -1.052 1.362 1.040 1.194 1.439 1.032 1.425 -1.338 1.469 1.477 1.538 1.635 M AN U NaN 0.33695 0.46623 4.7602 0.23474 0.79606 1.5548 0.8186 0.43511 NaN 2.4575 0.93341 0.61233 0.57149 1.0278 0.90724 1.7495 0.89308 1.1041 3.7592 3.4141 0.47557 0.97787 0.53835 5.8835 0.96701 1.1408 0.22864 0.09983 NaN 0.58394 1.0419 0.86004 0.41894 0.34444 0.58944 0.24262 0.47651 NaN 0.77445 0.61671 0.99877 1.4551 1.7155 1.4934 0.14906 0.83676 0.85885 2.3366 0.29491 1.0544 0.17741 1.6318 0.2447 1.3742 1.4037 0.34694 0.37791 NaN 1.7929 0.038867 7.3193 0.10859 NaN 0.29898 2.0075 NaN TE D NaN 0.33586 0.4267 7.9615 0.18796 0.74196 1.722 0.78433 0.46082 NaN 2.543 1.0018 0.77206 0.52662 1.1524 0.88883 1.5507 0.88573 1.1645 2.4051 2.5471 0.52447 0.93503 0.72361 5.0045 0.85996 0.92238 0.27781 0.18063 0.82825 NaN 0.90804 0.96473 0.40676 0.34435 0.81788 0.32648 0.71525 NaN 0.83863 0.57308 1.1166 1.5283 1.839 1.4007 0.12277 0.98977 1.185 2.3742 0.33107 1.1273 0.20559 1.3813 0.024978 1.2477 1.339 0.32242 0.42968 1.4186 1.123 0.029229 9.3689 0.095871 NaN 0.31485 2.0008 NaN EP NaN 0.25917 0.32078 6.1935 0.21474 0.61281 0.75766 1.4734 0.56799 1.056 1.6943 0.74586 NaN 0.65998 0.7968 0.74585 1.6962 0.84432 0.65287 1.1836 0.44282 0.45221 0.87246 0.32266 1.4388 0.74356 0.69468 0.45707 0.28697 0.9829 0.90336 0.91728 0.61984 0.58404 0.60544 0.67583 0.17063 0.33866 1.3595 0.9864 1.0273 0.97853 1.2325 0.80532 0.53069 0.28159 0.69684 1.9688 1.7239 0.8433 1.0049 0.19889 1.4011 0.012993 1.1288 1.1383 0.52472 1.241 0.87539 1.64 0.56789 4.8855 0.32394 0.65954 0.33267 2.0631 1.8119 AC C NaN 0.24804 0.44221 9.5786 0.2312 1.0313 0.80699 1.8256 0.91298 1.4339 1.5676 0.93192 1.4089 0.84897 1.3571 1.0018 3.1182 1.6189 0.97679 1.5487 1.1333 0.65748 1.0198 0.28426 2.9774 1.1537 1.0205 0.46399 0.19646 1.5767 1.0334 1.4142 0.68657 0.7523 0.5751 NaN 0.29523 0.38063 NaN 1.5089 1.3379 1.4161 1.77 1.0158 1.3125 0.32348 1.0671 1.7065 1.4793 0.67961 1.1397 0.22374 1.7354 0.016828 NaN 1.0824 0.71444 1.2908 1.0453 2.3602 0.58602 6.9612 0.24209 0.96889 0.49148 3.173 2.9625 ACCEPTED MANUSCRIPT Supplementary Table Regulatory sites determined by ChIP-qPCR for FXR in liver extracts Genomic location of the peak (Chr:Start-End) Peak distance from TSS (bp) IR-1 motif in the peak (AGGTCANTGACCTN) chr1:67124225-67124829 -45073 AGAGCCAATGACCC chr1:67125141-67125712 -44174 AAGGCCATTGACTC chr1:67190203-67191017 +21010 GGGTCAATGGCTGC Glul chr1:155746632-155747475 -5 CGGCCAATGGCCTC Ass1 chr2:31315817-31316207 -9777 AGGGCAGAGACCGC Asl chr5:130497223-130499011 -2084 GGGTCCTTGACCTC Hal chr10:92950852-92952224 -99 GGGTCAGAGAACTA Prodh chr16:18083266-18084303 +5499 AGGCCACTGGCCCT M AN U Cps1 ChIP-qPCR primers (5’->3’) FW gttgtttcagattagcaatgttgac RV cacatttgatttgcacagtgg FW atgttcaactcaaagatggctct RV aggcctttggaacaaataagg FW ggctggctaccaagagtctg RV cctatctgacttctcaccttttcc FW cacagttcctcggccaat RV ggtactttttattgacagcttgtgc FW gggctctaccgcttgactg RV gcaggatgtagacgctctgg FW tgagttacgacggcctgat RV aaagtccagcccttgttcct FW agtgggctcagctacccata RV gtgttcctttggcctttctg FW ggctcctccccaggtaacta RV agtggcctcacatgactgc SC Gene RI PT Nr peak analyzed Supplementary Table qRT-PCR primers 36B4 Shp EP Cyp7a1 Glul Asl Hal AC C Cps1 Ass1 Prodh Nags TE D Gene Sequence (5’->3’) FW cgggaaggctgtggtgctgatg RV tcggtgaggtcctccttggtgaac FW ggagtctttctggagccttg RV cacatctgggttgaagagga FW atctcaagcaaacaccattcc RV ttgatgatgctgtctagtacc FW tcaagtataaccggaagcccg RV gaaagggtggccgtctgtt FW atgctctgggtgggttagg RV aggatctggttggtcatagca FW ggagaaccgcttcattgg RV tgagcgtggtaaaggatggt FW aagccatccgaagctgtttg RV cttgtccccgcctcctgt FW tgaaggcgatgtaatgtctcc RV cccatccaaggcaatgtact FW gagcgcaaagaaatggagtc RV gggtggacctgatactgcttc FW cagattcggctcatcgtgga RV tgccacagcccttgttactg RatMouse Gene Cyclophilin Bsep Glul Gls2 Ass1 Nags Prodh FXR Sequence (5’->3’) FW ggagatggcacaggaggaa RV gcccgtagtgcttcagctt FW aagctacatctgccttagacacagaa RV caatacaggtccgaccctctct FW ccgcctcgctctcctgacc RV cgggtcttgcagcgcagtc FW ccgtggtgaacctgctattt RV tgcgggaatcatagtccttc FW acacctcctgcatcctcgt RV gctcacatcctcaatgaacacct FW cttcggagagacctgcaaac RV ccgaaccagaagaagatcca FW gcaccacgagcagttgttc RV ctttgttgtgccggatcagag FW acagctaatgaggacgacag RV gatttcctgaggcattctctg ACCEPTED MANUSCRIPT AC C EP TE D M AN U SC FOLD change FOLD change Protein Wt OCA/Wt Veh FXR-/- Veh/Wt Veh Bile acid synthesis Cyp8b1 -7.91 2.42 Cyp7a1 ND 5.04 Cyp7b1 -2.96 -14.88 Hsd3b7 -1.43 -2.00 Cyp27a1 -1.11 -2.35 Ces1f -1.98 -1.12 Cyp39a1 -1.13 -2.46 Bile acid conjugation/taurine synthesis Baat -1.21 1.87 Csad -1.55 9.29 Bile acid/ phosphatidylcholine transport Abcb11/Bsep 2.15 -5.31 Abcb4/Mdr3 1.68 1.39 Abcc2/Mrp2 1.50 -1.19 Pcyt1a 2.36 -1.62 Slc10a1/Ntcp 1.04 -4.12 Slco1a1/Oatp1 -1.49 -3.13 Abcc3/Mrp3 1.95 16.19 RI PT Supplementary Table FXR-/- /Wt fold change in liver expression of BA metabolism-related proteins ACCEPTED MANUSCRIPT AC C EP TE D SC M AN U FOLD change FOLD change Protein Wt OCA/Wt Veh FXR-/- Veh/Wt Veh Histidine degradation Hal 2.33 -2.16 Uroc1 1.83 -1.58 Amdhd1 1.86 -2.93 Ftcd 2.26 -1.75 Proline degradation Prodh 1.49 -2.30 Tryptophan degradation Tdo2 2.56 -2.25 Kynu 1.47 -1.36 Methionine degradation Mat1a 1.56 1.07 Ahcy 1.50 -2.02 Cth 2.16 -1.04 Phenylalanine degradation Pah 1.47 -1.23 Lysine degradation Agphd1 1.48 -1.78 Urea cycle Ass1 2.31 -1.74 Asl 1.36 -1.53 Arg1 1.36 -1.53 Cps1 -1.24 -2.05 Nags -1.39 -3.67 Urea cycle-related Oat 2.43 3.01 Got1 1.30 -2.14 Gls2 1.12 -5.82 Glud1 -1.43 -1.50 Glutamine synthesis Glul 1.52 -2.22 RI PT Supplementary Table FXR-/- /Wt fold change in liver expression of amino acid metabolismrelated proteins ACCEPTED MANUSCRIPT Supplementary Table FXR-/- /Wt fold change in concentration of amino acids in liver extracts RI PT 0.000 ** 0.045 0.002 ** 0.025 * 0.005 ** 0.770 0.453 0.370 0.211 0.069 0.398 0.135 0.011 * 0.047 0.023 * 0.007 ** 0.018 * 0.015 * 0.000 ** 0.001 ** 0.074 0.006 ** 0.005 ** SC 3.78 2.01 1.68 1.68 1.29 -1.03 1.05 -1.18 -1.15 -1.26 -1.13 -1.28 -1.34 -1.22 -1.27 -1.54 -1.46 -1.41 -1.54 -1.70 -1.41 -1.59 -8.93 M AN U 0.005 ** 0.085 0.003 ** 0.051 0.001 ** 0.694 0.292 0.993 0.933 0.615 0.466 0.455 0.286 0.255 0.109 0.243 0.270 0.162 0.154 0.115 0.112 0.006 ** 0.079 Fold change FXR-/- OCA p value /Wt Veh TE D 3.30 1.78 1.62 1.58 1.39 1.05 1.05 1.00 -1.01 -1.07 -1.13 -1.14 -1.14 -1.14 -1.20 -1.20 -1.21 -1.21 -1.23 -1.33 -1.38 -1.63 -2.76 AC C Glu Pip Gln Asp His Pro Arg Ser Trp Thr Ile Val Phe Lys Ala Orn Leu Tyr Gly Met Asn OH-Pro Cit Fold change FXR-/- Veh p value /Wt Veh EP Amino Acid ACCEPTED MANUSCRIPT SC p-value 0.003** 0.001** 0.010* 0.006** 0.012* 0.002** 0.055 0.100 0.009* 0.018* 0.019* 0.043* 0.038* 0.016* 0.243 0.038* 0.027* 0.809 M AN U FC -1.65 -1.63 -1.62 -1.60 -1.58 -1.58 -1.56 -1.55 -1.49 -1.43 -1.43 -1.40 -1.38 -1.29 -1.26 -1.19 -1.16 1.00 TE D Amino acid Glutamic acid Alanine Isoleucine Leucine Phenylalanine Valine Tyrosine Arginine Proline Histidine Methionine Threonine Lysine Serine Aspartic acid Tryptophan Glutamine Ornithine RI PT Supplementary Table OCA/DMSO fold change concentration of amino acids in medium of primary hepatocytes Determination of amino acid concentrations in medium of primary hepatocytes treated for 16 hours with OCA or DMSO and in the last hour before harvesting with mM NH4Cl, 0.4 mM glutamine and 0.6 mM ornithine OCA/DMSO fold change in concentrations of amino acids and related significance AC C EP are shown ACCEPTED MANUSCRIPT M AN U SC RI PT Supplementary figures TE D Supplementary Figure Validation of FXR depletion in FXR-/- and liver FXR-/- mice Determination of FXR expression in liver and kidney tissue of Wt, FXR-/- and liver FXR-/- mice by RT-qPCR Disruption of FXR was validated, using primers Fw: 5’-acagctaatgaggacgacag -3’, Rv: 5’- EP gatttcctgaggcattctctg-3’ and expression was normalized to cyclophilin (5’-ggagatggcacaggaggaa-3’, SEM AC C Rv: 5’-gcccgtagtgcttcagctt-3’) Expression is relative to cyclophilin Data are represented as mean ± TE D M AN U SC RI PT ACCEPTED MANUSCRIPT EP Supplementary Figure Liver proteomic analysis reveals regulation of nutrient metabolism by FXR activation/ablation David Gene Ontology cluster analysis of metabolic processes enriched folds AC C upon FXR activation/ablation Differential protein changes were included in the analysis when ≥1.3 TE D M AN U SC RI PT ACCEPTED MANUSCRIPT Supplementary Figure Nags expression does not change upon FXR activation (A-B) Relative EP gene expression of Nags was investigated by qRT-PCR in primary hepatocytes incubated with DMSO or 1µM OCA for 0, 1, or 17 hours (A) and with DMSO or OCA or GW4064 for hours and in the AC C last hour before harvesting with mM NH4Cl, 0.4 mM glutamine, 0.6 mM ornithine, 10mM Hepes in HBSS (mean ± SD, n=3, no significant changes) ... TE D Amino acid Glutamic acid Alanine Isoleucine Leucine Phenylalanine Valine Tyrosine Arginine Proline Histidine Methionine Threonine Lysine Serine Aspartic acid Tryptophan Glutamine Ornithine... mainly expressed in intestine, liver and kidney Intestinal FXR activation by BAs ACCEPTED MANUSCRIPT increases BA export into the portal circulation In addition, FXR activation in the intestine...ACCEPTED MANUSCRIPT Farnesoid X Receptor Activation Promotes Hepatic Amino Acid Catabolism and Ammonium Clearance in Mice Vittoria Massafra1, Alexandra Milona1, Harmjan R Vos1, Rúben