In our previous study, a recombinant duck enteritis virus (DEV) delivering codonoptimized E gene (named as Ech) of duck Tembusu virus (DTMUV) optimized referring to chicken’s codon bias has been obtained based on the infectious bacterial artificial chromosome (BAC) clone of duck enteritis virus vaccine strain pDEVEF1, but the expression level of Ech in recombinant virus rDEVEchinfected cells was very low. To optimize DTMUV E gene expression delivered by the vectored DEV, different forms of E gene (collectively called EG) including origin E gene (Eori), truncated E451ori gene, codonoptimized Edk gene optimized referring to duck’s codon bias, as well as the truncated E451ch and E451dk, Etpaori and Etpa451ori, which contain prefixing chick TPA signal peptide genes, were cloned into transfer vector pEPBGHend, and several recombinant plasmids pEPBGHEG were constructed. Then the expression cassettes pCMVEGpolyABGH amplified from pEPBGHEG by PCR were inserted into US7US8 gene intergenic region of pDEVEF1 by twostep RedET recombination, 7 strain recombinant mutated BAC clones pDEVEG carrying different E genes were constructed. Next, the recombinant viruses rDEVEG were reconstituted from chicken embryo fibroblasts (CEFs) by calcium phosphate precipitation. Western blot analysis showed that E or E451 protein is expressed in rDEVEori, rDEVEch, rDEVEtpaori, rDEVE451ori, rDEVE451dk, and rDEVE451chinfected CEFs, and protein expression level in rDEVE451dkinfected CEFs is the highest. These studies have laid a foundation for developing bivalent vaccine controlling DEV and DTMUV infection.
Molecular Biotechnology https://doi.org/10.1007/s12033-019-00206-1 ORIGINAL PAPER Optimized Expression of Duck Tembusu Virus E Gene Delivered by a Vectored Duck Enteritis Virus In Vitro Liu Chen1 · Bin Yu1 · Jonggang Hua1 · Zheng Ni1 · Weicheng Ye1 · Tao Yun1 · Cun Zhang1 © Springer Science+Business Media, LLC, part of Springer Nature 2019 Abstract In our previous study, a recombinant duck enteritis virus (DEV) delivering codon-optimized E gene (named as E-ch) of duck Tembusu virus (DTMUV) optimized referring to chicken’s codon bias has been obtained based on the infectious bacterial artificial chromosome (BAC) clone of duck enteritis virus vaccine strain pDEV-EF1, but the expression level of E-ch in recombinant virus rDEV-E-ch-infected cells was very low To optimize DTMUV E gene expression delivered by the vectored DEV, different forms of E gene (collectively called EG) including origin E gene (E-ori), truncated E451-ori gene, codonoptimized E-dk gene optimized referring to duck’s codon bias, as well as the truncated E451-ch and E451-dk, Etpa-ori and Etpa-451-ori, which contain prefixing chick TPA signal peptide genes, were cloned into transfer vector pEP-BGH-end, and several recombinant plasmids pEP-BGH-EG were constructed Then the expression cassettes pCMV-EG-polyABGH amplified from pEP-BGH-EG by PCR were inserted into US7/US8 gene intergenic region of pDEV-EF1 by two-step Red/ET recombination, strain recombinant mutated BAC clones pDEV-EG carrying different E genes were constructed Next, the recombinant viruses rDEV-EG were reconstituted from chicken embryo fibroblasts (CEFs) by calcium phosphate precipitation Western blot analysis showed that E or E451 protein is expressed in rDEV-E-ori, rDEV-E-ch, rDEV-Etpa-ori, rDEVE451-ori, rDEV-E451-dk, and rDEV-E451-ch-infected CEFs, and protein expression level in rDEV-E451-dk-infected CEFs is the highest These studies have laid a foundation for developing bivalent vaccine controlling DEV and DTMUV infection Keywords Duck Tembusu virus · Duck enteritis virus · Vectored vaccine · Optimized expression · E antigen Supplementary information Supplementary information accompanies this paper at https://doi.org/10.1007/s12033-01900206-1 * Cun Zhang zhangcun@aliyun.com Liu Chen haoliuzi@126.com Bin Yu biogiant@126.com Jonggang Hua huajG2008@126.com Zheng Ni nizheng79@163.com Weicheng Ye ywc119@aliyun.com Tao Yun yt‑t@163.com Institute of Animal Husbandry and Veterinary Sciences, Zhejiang Academy of Agriculture Sciences, Hangzhou 310021, China Introduction In April 2010, a novel infectious disease has spread around the main duck-producing regions of egg-laying and breeder ducks in China This disease was characterized by retarded growth, high fever, loss of appetite, decline in egg production, and death emerged in ducks, and the main pathologic features of the disease were ovarian hemorrhage, follicle atresia, and rupture [1, 2] By pathogen isolation and identification, as well as fullgenome sequencing, this pathogen is considered a new member of Tembusu virus in ducks, which exhibits the closest genetic evolutionary relationship with Tembusu virus, a mosquitoborne flavivirus of the Ntaya virus group, thus tentatively named as duck Tembusu virus (DTMUV) This pathogen can infect different breeds of egg-laying and breeder ducks, with varying degrees of morbidity The incidence rate in the group-infected DTMUV is up to 100%, and total mortality ranges from to 15% while occasionally increasing up to 30% due to secondary 13 Vol.:(0123456789) bacterial infections Besides egg-laying, breeder ducks, and wild ducks, TMUV exhibits a wide range of natural host species, including chickens, geese, pigeons, and sparrows [3–5] Both mosquito-mediated transmission and nonvector transmission (airborne transmission) are involved in the spread of TMUV [6, 7] The viral particles were approximately 45 nm in diameter and enveloped Its genome consists of a singlestranded, positive-sense RNA, 10,990 nt in length, which shows most of the genetic characteristics of other mosquitoborne flaviviruses The genome contains a single open reading frame encoding a polyprotein with 3,426 amino acids, which is processed into at least 10 mature viral proteins including three structural protein (C, PrM, E) and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5) [8] E protein contains 501 amino acids, and it is the major surface protein of flaviviruses It plays a critical role in receptor binding, membrane fusion, and invasion of target cells Furthermore, E protein has good immunogenicity and reactivity, and is the main protective antigen of host anti-infection immunity Since its emergence, duck Tembusu viral disease caused by DTMUV has resulted in serious economic losses in the poultry industry in China, and because of the zoonotic nature of flaviviruses, DTMUV and other avian TMUV may be of public health concern as well Therefore, the need for vaccines against DTMUV is extremely urgent Currently, Inactivated vaccine (HB strain) and duck Tembusu virus disease vaccine, live-attenuated vaccine (Strain WF100) are available; however, the live-vectored vaccines are still missing Duck enteritis virus (DEV) is the causative agent of duck viral enteritis, which causes an acute, contagious, and lethal disease in many species of waterfowl within the order Anseriformes According to virus taxonomy reported in 2012 by the International Committee on Taxonomy of Viruses (ICTV), DEV (also referred to as Anatid herpesvirus 1) is classified into the genus Mardivirus and the subfamily Alphaherpesvirinae of Herpesviridae [9] Alphaherpesvirus is a kind of viral live vector with obvious advantage, which has large genome, many nonessential genes, large capacity of inserting exogenous genes, stable heredity, low interference from maternal antibodies, and long survival time in vivo Except having a characteristic of herpesvirus, commercial live-attenuated DEV vaccines have been used widely to control lethal DEV infections in ducks Therefore, DEV is an ideal candidate for viral vector to develop vaccine for controlling virus infection inthe water poultry industry Up to now, several studies that made DEV as live vaccine vector have been carried out, and good results have obtained, demonstrating that DEV has great potential and advantage to be a live vaccine vector [10–18] The exogenous protein expression level is one of the key factors to induce 13 Molecular Biotechnology host antibody production In this study, different forms of DTMUV E gene have been inserted into DEV genome, and the expression level of exogenous gene has been determined, and at last, a recombinant DEV expressing DTMUV E451 with high efficiency has been obtained This recombinant virus will be a potential bivalent vaccine against DEV and DTMUV Materials and Methods All research was approved by the relevant committees at the Zhejiang Academy of Agriculture Sciences Virus Strain and Cells The bacterial pDEV-EF1/GS1783, which contains the fulllength infectious BAC clone of DEV vaccine strain, and corresponding virus rDEV-EF1 were constructed and stored in our laboratory [19, 20] Recombinant virus rDEV-E-ch which contains the codon-optimized DTMUV E gene referring to chicken’s bias codon was constructed and stored in our laboratory [19, 20] Chicken embryo fibroblasts (CEFs) were prepared from 10-day-old specific-pathogen-free (SPF) embryonated eggs (Zhejiang JianLiang Bioengineering Co., Ltd., Hangzhou, China) according to standard procedures and cultured in DMEM (Gibco-BRL, Gaithersburg MD, USA) supplemented with 8% FBS, 100 U of penicillin/mL, and 100 μg streptomycin/mL Construction of Transfer Vector pEP‑BGH‑EG E-ch and E-dk genes which separately introduced Pst I and Not I sites in 5′ and 3′ terminuses were optimized and synthesized by Genscript corporation (GeneScript, Nanjing, China) referring to gene sequence of DTMUV (GenBank JF270480.1) as well as chicken or duck’s bias codons Several pairs of primer (Table 1) were designed referring to E gene sequences to amplify different forms of E gene Primers Eori +/Eori- were used to ampify E-ori gene with isolated DTMUV YY5 strain DNA as template [21]; Primers Eori +/ E451(ori-) were used to ampify C-terminus shorten E451 (ori-) gene, which retained 1-451 aa of E-ori gene; Primers Etpa(ori +)/Eori- were used to amplify Etpa-ori gene, which introduced a chicken TPA signal peptide sequence in N terminus of E-ori gene Primers Etpa(ori +)/E451(ori-) were used to amplify Etpa-451-ori gene, which introduced a chicken TPA signal peptide sequence in N terminus of E451-ori gene; Primers E451 ch +/E451 ch- were used to amplify E451-ch gene with codon-optimized E-ch gene as template; Primers Edk-F//Edk (1-451)-R were used to amplify E451-dk gene with codon-optimized E-dk gene as template Plasmids pEP-BGH-BG were constructed by Molecular Biotechnology Table 1 Primers used in this study Primer Sequence Sequence introduced 5-ctgcagccaccatgggattcagctgtctggggatgc-3 5-gcggccgcttaggcattgacatttaccgc-3 5-gcggccgcttatttaaatgctgagccgaaaac-3 5-aactgcagccaccatgggaagtggaaaacactcagaatgaaaggca agctcctgagtctcctcctgctggtgggagtaatcaagactgcccaatgcca gggcacacacttcagctgtctggggatgc-3 E451 ch + 5-ggtaccgccaccatgggatttagttgcctggggatgcag-3 5-gcggccgcttatttaaaagctgagccgaac-3 E451 ch 5-aactgcagccaccatgggattttcttgcctggggatgcag-3 Edk-F 5-attgcggccgcttatttaaaagcggagccgaac-3 Edk (1-451)-R pDEV vac-in-s 5-tactaatttaagtgtgcagcctggttaac tgtattatgcgcggagcgatgtacgggccagata-3 pDEV vac-in-as 5- tccgtagtctggccggcagtatgttggtgttt agtactccaaacccatagagcccaccgcatcccc-3 Rec-JD-F 5-ctaccacaagcgtcatcaacca-3 Rec-JD-R 5-tgtccattaccaaatccgaaaa-3 Eori+ Eori E451(ori-) Etpa(ori +) Pst I (underlined) Not I (underlined) Not I (underlined) Pst I (underlined) and chicken TPA signal peptide (Italics) Kpn I (underlined) Not I (underlined) Pst I (underlined) Not I (underlined) Homology arm of US7 (bold) Homology arm of US8 (bold) Note Restriction enzyme sites added to primers are underlined, sequences in italics indicate additional bases that are not present in the original DEV genome, and sequences in bold are homology arms which are present in the original DEV genome inserting EG into Pst I and Not I sites or Kpn I and Not I sites of pEP-BGH-end Generation of Recombinant Mutated BAC Clones of DEV Delivering EG Gene These mutated BAC clones were all obtained by two-step Red-mediated recombination (en passant) [22] by inserting EG expression cassette into US7 and US8 intergenic region of DEV (Fig. 1) In detail, to construct pDEV-EG, pCMVEG-BGH-pA expression cassette flanking homology arms of DEV US7 and US8 was amplified from pEP-BGH-EG with primers pDEV vac-in-s and pDEV vac-in-as (Table 1) Then, 100 ng of purified PCR product (3542 ~ 3782 bp in length) was electroporated into competent GS1783 bacteria containing pDEV-EF1, and bacteria of transformation were plated on LB plates containing chloramphenicol (34 μg/mL) and kanamycin (50 μg/mL) and incubated at 32 °C for 48 h Double-resistant colonies (pDEV-kan.EG) were selected for the second-step Red recombination to remove the kanamycin resistance gene Colonies resistant to chloramphenicol but sensitive to kanamycin were selected Then, positive colonies (pDEV-EG) were determined by RFLP (restriction fragment length polymorphisms) with Pst I or BamH I and sequencing the PCR products amplified with primer pairs Rec-JD-F and Rec-JD-R (Table 1) flanking the region of EG insert Reconstitution of Recombinant Viruses pDEV-EG was extracted from bacteria by alkaline lysis method Next, 4 μg of pDEV-EG DNA was transfected into CEFs by the calcium phosphate precipitation method according to Chen L [19] The cells were then cultured with DMEM supplemented with 8% FBS for 3-6 days until 70 ~ 80% CPE occurred The viruses collected were named rDEV-E-ori, rDEV-E451-ori, rDEV-Etpa-ori, rDEV-Etpa451-ori, rDEV-E-dk, rDEV-E451-dk, and rDEV-E451-ch individually Measure Viral Plaque Size The plaque sizes of reconstructed viruses rDEV-E-ori, rDEV-E451-ori, rDEV-Etpa-ori, rDEV-Etpa-451-ori, rDEV-E-dk, rDEV-E451-dk, rDEV-E451-ch; the reference strain rDEV-E-ch: and the parental strain rDEV-EF1 were measured as follows The viruses were serially diluted and plated onto CEFs seeded in a 12-well plate, and 2 h later, the inoculum was replaced with DMEM containing 1.5% methylcellulose (Sigma-Aldrich, St Louis, MO, USA) After a 2-day-incubation at 37 °C, for every virus, 100 fluorescent plaques were randomly selected, photos were taken under fluorescence microscope (Nikon, Tokyo, Japan), and then their sizes were measured using Image J software (http://rsb.info.nih.gov/ij/) Statistical analyses to compare the differences in the plaque sizes between the nine strains were conducted using one-way ANOVA with SPSS 11.5 software 13 Molecular Biotechnology Fig. 1 Construction of recombinant pDEV-EG The flow shown in the dotted box (a and b) has been described in our previous study a A mini-F vector (pHA2) as a BAC that allows the maintenance of large circular DNA in E coli was introduced into the intergenic region between UL15B and UL18 of a DEV vaccine strain by homologous recombination; b pCMV promoter, which controls expression of GFP in pDEV-vac, was substituted by pEF1 gene by two-step Red-mediated recombination (en passant); c Diagram of the exogenous gene expression cassette d Diagram of recombinant virus in which pCMV-EG-BGH-pA expression cassette was inserted into US7 and US8 intergenic spaces of pDEV-EF1 by two-step Red-mediated recombination (en passant) Western Blotting Analysis of E or E451 Protein Expressed in Recombinant Virus‑Infected CEFs polyclonal antibody (1: 500) or rabbit anti-GFP polyclonal antibody (1:1000) for 1 h at 37 °C The horseradish peroxidase (HRP)-conjugated goat antirabbit IgG (Santacruz, CA, USA) was used as the secondary antibody And the protein bands were visualized using Western Blot Hyper HRP Substrate (Takara Co Ltd., Tokyo, Japan), and chemiluminescence was observed using Molecular Imager® ChemiDoc™ XRS+ Imaging System (Bio-Rad Laboratories, Hercules, CA, USA) Expression of E or E451 protein was verified by Western blotting analysis using rabbit anti-DTMUV EDIII polyclonal antibody (preparation in our laboratory) Meanwhile, control GFP protein has also been detected using rabbit anti-GFP polyclonal antibody (Beyotime Institute of Biotechnology, Haimen, China) In detail, the cells were infected with 1.0 MOI rDEV-E-ori, rDEV-E451-ori, rDEV-Etpa-ori, rDEVEtpa-451-ori, rDEV-E-dk, rDEV-E451-dk, rDEV-E-ch, rDEV-E451-ch, and rDEV-EF1 till the occurrence of 80% cytopathogenic effect (CPE), collected and treated with sample buffer, then subjected to 10% SDS-PAGE, and finally electrophoretically transferred to a PVDF membrane (Millipore, Boston, Massachusetts, USA) To eliminate possible nonspecific binding, the membranes were blocked with 10% skimmed milk in PBST (0.5% Tween20 in PBS) overnight at 4 °C and incubated with rabbit anti-DTMUV E DIII 13 Results Identification of BAC Mutates RFLPs were performed to confirm that BAC-mutated clones were indeed generated DNAs of BAC-mutated clones and intermediate were digested by Pst I or BamH I (Fig. 2a or b) and analyzed by electrophoresis The Molecular Biotechnology Fig. 2 Analysis of recombinant BAC mutants by restriction endonuclease digestion (a, b) and PCR amplification (c) A Analysis of pDEV-E-dk and pDEV-E451-dk mutants by Pst I digestion M:15,000 bp marker (15,000, 10,000, 7500, 5000, 2500), 1: pDEVEF1, 2: pDEV-E-dk.Kan, 3: pDEV-E-dk, 4: pDEV-E451-dk.kan, 5: pDEV-E451-dk; B Analysis of pDEV-E-ori, pDEV-Etpa-ori, pDEVEtpa-451-ori, pDEV-E451-ori, and pDEV-E451-ch mutants by BamH I digestion M: 15,000 bp marker (15,000, 10,000, 7500, 5000, 2500), 1: pDEV-EF1, 2:pDEV-E-oriKan, 3:pDEV-E-ori, 4:pDEV-Etpa-ori Kan, 5:pDEV-Etpa-ori, 6:pDEV-Etpa-451-ori.Kan, 7:pDEV-Etpa- 451-ori, 8:pDEV-E451-ori.Kan, 9:pDEV-E451-ori, 10: pDEVE451-ch.Kan, 11: pDEV-E451-ch, 12: pDEV-E-ch.kan, and 13: pDEV-E-ch; C Identification of recombinant BAC-mutated clones by PCR amplification 1: pDEV-EF1, 2:pDEV-E-oriKan, 3:pDEV-Eori, 4:pDEV-Etpa-ori.Kan, 5:pDEV-Etpa-ori, 6:pDEV-Etpa-451-ori Kan, 7:pDEV-Etpa-451-ori, 8:pDEV-E451-ori.Kan, 9:pDEV-E451ori, 10: pDEV-E451-ch.Kan, 11: pDEV-E451-ch, 12: pDEV-E-ch kan, 13: pDEV-E-ch, 14:pDEV-E-dk.Kan, 15:pDEV-E-dk, 16:pDEVE451-dk.Kan, and 17:pDEV-E451-dk, M:250 bp marker (4500, 3000, 2250, 1500, 1000, 750, 500, 250) results of RFLP patterns indicated that the obtained Pst I or BamH I pattern matched perfectly with those in silico prediction, which were based on the reference wholegenome sequence of the DEV vaccine strain [GenBank: KF487736] [23] The sizes and sequencing results of PCR product amplified by Rec-JD-F/Rec-JD-R from the recombinant BAC DNAs were also in accordance with prediction (Fig. 2c) These results demonstrate that exogenous genes were inserted into the expected region of DEV genome Reconstitution of Recombinant Viruses The constructed mutated BAC DNAs were transfected into CEFs by calcium phosphate precipitation The fluorescent plaques were observed at 48 h after transfection, and the cell cultures were collected when more than 80% cells fluoresced, which indicated that the recombinant viruses have been generated, with rDEV-E-ch and rDEV-EF1-infected 13 Molecular Biotechnology Fig. 3 Recombinant viruses being reconstituted by transfecting the BAC DNAs into CEF cells CEFs as positive control, and no fluorescence was detected in negative control(NC) CEFs (Fig. 3) Measure the Plaque Size of Recombinant Viruses The plaque size of recombinant viruses rDEV-E-ori, rDEVE-ch, rDEV-E-dk, rDEV-Etpa-ori, rDEV-E451-ch, rDEVE451-dk, or rDEV-E451-ori were determined as described in Materials and methods, and were compared to the size of the parental virus rDEV-EF1 it was discovered that the plaque sizes were approximately 31.2%, 39.7%, 1.77%, 46.5%, 11.6%, 35.3%, and 35.2% smaller, respectively, than those formed by rDEV-EF1 when measured on day p.i; although the plaque size of rDEV-Etpa-451-ori was 72.26% larger than those formed by rDEV-EF1, there were no significant differences between the groups (P = 0.241; P = 0.05; P = 0.200; P = 0.321; P = 0.231; P = 0.450; P = 0.485), and there was also no significant difference between rDEV-Etpa451-ori and rDEV-EF1 (P = 0.554) (Fig. 4) Western Blotting Analysis of E or E451 Protein Expressed in Recombinant Virus‑Infected CEFs Expressions of E or E451 protein in recombinant virusinfected-cells and -supernatants were detected by Western blotting analysis using rabbit anti-DTMUV EDIII polyclonal antibody as primary antibody and HRP-labeled goat antirabbit IgG antibody as secondary antibody The results shows that rDEV-E-ori, rDEV-E-ch, rDEV-Etpa-ori and rDEV-E451-ori, rDEV-E451-dk, and rDEV-E451-ch virus-infected cell samples each produced a specific band corresponding to the size of 54.3 kD or 49 kD compared 13 Fig. 4 Plaque sizes of recombinant viruses rDEV-E-ori, rDEV-E451ori, rDEV-Etpa-ori, rDEV-Etpa-451-ori, rDEV-E-dk, rDEV-E451-dk, rDEV-E451-ch, rDEV-E-ch, and rDEV-EF1 on CEFs The means and standard deviations of sizes of 100 plaques of each virus were determined using Image J software The mean of the plaque size of pDEVEF1 was set at 100% Standard deviations are shown with the error bars to rDEV-EF1 virus-infected cell sample (Fig. 5), which is consistent with prediction Furthermore, it is observed that the expression level was the highest in rDEV-E451-dk virus-infected cell sample when the protein expression levels were normalized based on the GFP expression No E or E451 protein was detected in virus-infected cell supernatants (Result not shown) Molecular Biotechnology to duck’s codon bias, without the prefix signal peptide exhibited the optimal expression in this study The shortened E451 gene, which has been removed from transmembrane region only, will retain the capacity of E protein to induce neutralization antibodies against DTMUV In some flaviviruses, such as Japanese encephalitis virus (JEV) and West Nile virus (WNV), antibody of nonstructural protein NS1 is also capable of producing protective immunity and clearing virus-infected cells [24–29] The premembrane (PrM) protein could stabilize the conformation of E and protect it from degradation [30, 31] In the future, more studies focusing on the screening promoter, combining E451 gene expression with other antigen DTMUV gene (prM, NS1), as well as prefix different signal peptides to E451-dk gene will be explored At last, animal experiments to testify recombinant virus-induced antibody level and whether the antibody could protect against DTMUV and DEV infections will be carried Fig. 5 Detection of E or E451 protein expressed in virus-infected CEFs by Western blotting analysis M: PageRuler Prestained Protein Ladder;1:rDEV-EF1, 2:rDEV-E-ori, 3:rDEV-E-ch, 4:rDEV-E-dk, 5:rDEV-Etpa-ori, 6:rDEV-Etpa-451-ori, 7:rDEV-E451-ori, 8:rDEVE451-dk, and 9: rDEV-E451-ch Discussion BAC is the most popular platform to carry out genetic manipulation on herpesvirus A large amount of gene-deletion vaccines or recombinant live viral vectored vaccines have been extensively studied based on herpesvirus BAC system And several very successful examples have been obtained on MDV (Marek’s disease virus) and PRV (pseudorabies virus) In the year 2013, a full-length infectious bacterial artificial chromosome clone of duck enteritis virus vaccine strain has been constructed in our laboratory [19] And codonoptimized DTMUV E gene referring to chicken’s codon bias was first expressed based on the infectious clone of DEV vaccine strain However, expression level of E protein was very low [20] Since the expression level of exogenous antigen E is very critical in inducing high level neutralization antibodies against DTMUV, we aimed in this study to enhance the expression level of exogenous antigen In general, gene sequence and its promoter are the key factors to affect expression level of exogenous antigens Here, several different E gene sequences were inserted into DEV genome, including E gene sequence with or without codonoptimized, full-length, or shortened gene; and gene sequence with or without prefix signal peptide And the results show that a shortened E451 gene, which was optimized referring Acknowledgements The study was supported by grants from the National Key Research and Development Program of China (2016YFD0500107); the National Natural Science Foundation of China (31670150); Zhejiang Provincial Natural Science Foundation of China (Grant No LY15C180002); and the Public Service Technology Application Research Project of Science and Technology Department of Zhejiang Province (2016C32070) We would like to thank Kui Yang, Department of Pathobiological Sciences, School of Veterinary Medicine Louisiana State University, Louisiana, USA, for critical reading of the manuscript Compliance with Ethical Standards Conflict of interest The authors declare that they have no competing interests The founding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; and in the decision to publish the results References Cao, Z., Zhang, C., Liu, Y., Liu, Y., Ye, W., Han, J., et al (2011) Tembusu virus in ducks, china Emerging Infectious Diseases, 7(10), 1873–1875 Zhang, W., Chen, S., Mahalingam, S., Wang, M., & Cheng, A (2017) An updated review of avian-origin Tembusu virus: A newly emerging avian Flavivirus Journal of General Virology, 98(10), 2413–2420 Liu, M., Chen, S., Chen, Y., Liu, C., Chen, S., Yin, X., et al (2012) Adapted Tembusu-like virus in chickens and geese in China Journal of Clinical Microbiology, 50(8), 2807–2809 Tang, Y., Diao, Y., Yu, C., Gao, X., Ju, X., Xue, C., et al (2013) Characterization of a Tembusu virus isolated from naturally infected house sparrows (Passer domesticus) in Northern China Transboundary and Emerging Diseases, 60(2), 152–158 Liu, P., Lu, H., Li, S., Moureau, G., Deng, Y Q., Wang, Y., et al (2012) Genomic and antigenic characterization of the newly emerging Chinese duck egg-drop syndrome flavivirus: Genomic comparison with Tembusu and Sitiawan viruses Journal of General Virology, 93(Pt 10), 2158–2170 13 Tang, Y., Diao, Y., Chen, H., Ou, Q., Liu, X., Gao, X., et al (2015) Isolation and genetic characterization of a tembusu virus strain isolated from mosquitoes in Shandong China Transboundary and Emerging Diseases, 62(2), 209–216 Li, X., Shi, Y., Liu, Q., Wang, Y., Li, G., Teng, Q., et al (2015) Airborne transmission of a novel tembusu virus in ducks Journal of Clinical Microbiology, 53(8), 2734–2736 Yun, T., Ye, W., Ni, Z., Zhang, D., & Zhang, C (2012) Identification and molecular characterization of a novel flavivirus isolated from Pekin ducklings in China Veterinary Microbiology, 157(3–4), 311–319 King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J (2012) Virus taxonomy: Classification and nomenclature of viruses: Ninth report of the International Committee on Taxonomy of Viruses (http://ictvonline.org/virusTaxonomy.asp?versi on=2012&bhcp=1.2012) 10 Wang, J., & Osterrieder, N (2011) Generation of an infectious clone of duck enteritis virus (DEV) and of a vectored DEV expressing hemagglutinin of H5N1 avian influenza virus Virus Research, 159(1), 23–31 11 Liu, J., Chen, P., Jiang, Y., Wu, L., Zeng, X., Tian, G., et al (2011) A duck enteritis virus-vectored bivalent live vaccine provides fast and complete protection against H5N1 avian influenza virus infection in ducks Journal of Virology, 85(21), 10989–10998 12 Liu, X., Wei, S., Liu, Y., Fu, P., Gao, M., Mu, X., et al (2013) Recombinant duck enteritis virus expressing the HA gene from goose H5 subtype avian influenza virus Vaccine, 31(50), 5953–5959 13 Zou, Z., Liu, Z., & Jin, M (2014) Efficient strategy to generate a vectored duck enteritis virus delivering envelope of duck Tembusu virus Viruses, 6(6), 2428–2443 14 Chen, P., Liu, J., Jiang, Y., Zhao, Y., Li, Q., Wu, L., et al (2014) The vaccine efficacy of recombinant duck enteritis virus expressing secreted E with or without PrM proteins of duck tembusu virus Vaccine, 32(41), 5271–5277 15 Zou, Z., Hu, Y., Liu, Z., Zhong, W., Cao, H., Chen, H., et al (2015) Efficient strategy for constructing duck enteritis virusbased live attenuated vaccine against homologous and heterologous H5N1 avian influenza virus and duck enteritis virus infection Veterinary Research, 46, 42 16 Wang, J., Ge, A., Xu, M., Wang, Z., Qiao, Y., Gu, Y., et al (2015) Construction of a recombinant duck enteritis virus (DEV) expressing hemagglutinin of H5N1 avian influenza virus based on an infectious clone of DEV vaccine strain and evaluation of its efficacy in ducks and chickens Virology Journal, 12, 126 17 Sun, Y., Yang, C., Li, J., Li, L., Cao, M., Li, Q., et al (2017) Construction of a recombinant duck enteritis virus vaccine expressing hemagglutinin of H9N2 avian influenza virus and evaluation of its efficacy in ducks Archives of Virology, 162(1), 171–179 18 Chang, P., Yao, Y., Tang, N., Sadeyen, J R., Sealy, J., Clements, A., et al (2018) The application of NHEJ-CRISPR/Cas9 and Cre-Lox system in the generation of bivalent duck enteritis virus vaccine against avian influenza virus Viruses, 10(2), 81 19 Chen, L., Yu, B., Hua, J., Ye, W., Ni, Z., Yun, T., et al (2013) Construction of a full-length infectious bacterial artificial 13 Molecular Biotechnology 20 21 22 23 24 25 26 27 28 29 30 31 chromosome clone of duck enteritis virus vaccine strain Virology Journal, 10, 328 Chen, L., Yu, B., Ni, Z., Hua, J., Ye, W., Yun, T., et al (2015) Construction and characterization of a recombinant duck enteritis virus expressing E protein of duck Tembusu virus Acta Agriculturae Zhejiangensis, 27(11), 1889–1895 (in Chinese) Yun, T., Zhang, D., Ma, X., Cao, Z., Chen, L., Ni, Z., et al (2012) Complete genome sequence of a novel flavivirus, duck tembusu virus, isolated from ducks and geese in china Journal of Virology, 86(6), 3406–3407 Tischer, B K., von Einem, J., Kaufer, B., & Osterrieder, N (2006) Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli BioTechniques, 40, 191–197 Yang, C., Li, J., Li, Q., Li, H., Xia, Y., Guo, X., et al (2013) Complete genome sequence of an attenuated duck enteritis virus obtained by in vitro serial passage Genome Announc, 1(5), e00685–e00685 Lin, C W., Liu, K T., Huang, H D., & Chen, W J (2008) Protective immunity of E coli-synthesized NS1 rotein of Japanese encephalitis virus Biotechnology Letters, 30(2), 205–214 Lieberman, M M., Clements, D E., Ogata, S., Wang, G., Corpuz, G., Wong, T., et al (2007) Preparation and immunogenic properties of a recombinant West Nile subunit vaccine Vaccine, 25(3), 414–423 Chung, K M., Nybakken, G E., Thompson, B S., Engle, M J., Marri, A., Fremont, D H., et al (2006) Antibodies against West Nile Virus nonstructural protein NS1 prevent lethal infection through Fc gamma receptor-dependent and -independent mechanisms Journal of Virology, 80(3), 1340–1351 Chung, K M., Thompson, B S., Fremont, D H., & Diamond, M S (2007) Antibody recognition of cell surface-associated NS1 triggers Fc-gamma receptor-mediated phagocytosis and clearance of West Nile virus-infected cells Journal of Virology, 81(17), 9551–9555 Krishna, V D., Rangappa, M., & Satchidanandam, V (2009) Virus-specific cytolytic antibodies to nonstructural protein of Japanese encephalitis virus effect reduction of virus output from infected cells Journal of Virology, 83, 4766–4777 Ishikawa, T., Wang, G., Widman, D G., Infante, E., Winkelmann, E R., Bourne, N., et al (2011) Enhancing the utility of a prM/Eexpressing chimeric vaccine for Japanese encephalitis by addition of the JEV NS1 gene Vaccine, 29(43), 7444–7455 Vazquez, S., Guzman, M G., Guillen, G., Chinea, G., Perez, A B., Pupo, M., et al (2002) Immune response to synthetic peptides of dengue prM protein Vaccine, 20, 1823–1830 Beasley, D W., & Barrett, A D (2002) Identification of neutralizing epitopes within structural domain III of the West Nile virus envelope protein Journal of Virology, 76, 13097–13100 Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations ... genetic manipulation on herpesvirus A large amount of gene- deletion vaccines or recombinant live viral vectored vaccines have been extensively studied based on herpesvirus BAC system And several... antibodies against DTMUV, we aimed in this study to enhance the expression level of exogenous antigen In general, gene sequence and its promoter are the key factors to affect expression level of exogenous... exogenous antigens Here, several different E gene sequences were inserted into DEV genome, including E gene sequence with or without codonoptimized, full-length, or shortened gene; and gene sequence