Đang tải... (xem toàn văn)
Effect of Qingxinkaiqiao compound on cortical mRNA expression of the apoptosis related genes Bcl 2, BAX, caspase 3, and Aβ in an Alzheimer’s disease rat model TOPIC JTCM |www journaltcm com[.]
Online Submissions: http://www.journaltcm.com info@journaltcm.com J Tradit Chin Med 2016 October 15; 36(5): 654-662 ISSN 0255-2922 © 2016 JTCM All rights reserved EXPERIMENTAL STUDY TOPIC Effect of Qingxinkaiqiao compound on cortical mRNA expression of the apoptosis-related genes Bcl-2, BAX, caspase-3, and Aβ in an Alzheimer's disease rat model Hu Haiyan, Wang Yiyu, Zhang Yihui, Wang Wenhua, Xu Dongmei, Chen Zhiyu, Zhang Xiaoyan, Mao Dandan aa Hu Haiyan, Wang Wen-hua, Zhang Xiao-yan, the Second Clinical College of Wenzhou Medical University, Wenzhou 325003, China Wang Yiyu, Zhang Yihui, Xu Dongmei, Chen Zhiyu, Mao Dandan, Department of Traditional Chinese Medicine, the Second Affiliated Hospital of Wenzhou Medical University, Wenzhou 325003, China Supported by the National Natural Science Foundation of China: Study on Mechanisms of Qingxinkaiqiao Fang on Restrain Form of β-amyloid in Brain Tissue of Rat Analogue Model of Alzheimer's Disease by a Multiple (No 30973780) Correspondence to: Mao Dandan, Department of Traditional Chinese Medicine, the Second Affiliated Hospital of Wenzhou Medical University, Wenzhou 325003, China maoddan@sina.com Telephone: +86-13567786184 Accepted: January 15, 2016 groups were administered the corresponding drugs; the control group and model group were administered an equal volume of physiological saline for 14 days After treatment, real-time quantitative polymerase chain reaction, immunohistochemistry, and western blot assay were employed to confirm mRNA and protein expressions of Bcl-2, Bax, caspase-3, and Aβ, respectively RESULTS: Compared with the model group, Bcl-2 expression increased and Bax, caspase-3, and Aβ expression decreased in each drug treatment group (P < 0.05, P < 0.01) The expressions of middle-dose QK group were more significant than the high- and low-dose QK groups (P < 0.01, P > 0.05) CONCLUSION: QK treatment resulted in significantly up-regulated Bcl-2 expression, down-regulated Bax, caspase-3, and Aβ expression, and reduced numbers of apoptotic cells in the cortex Abstract OBJECTIVE: To investigate the effects of Qingxinkaiqiao (QK) compound in a rat model of Alzheimer's disease induced with β-amyloid (Aβ) 1-40 © 2016 JTCM All rights reserved Key words: Alzheimer disease; Amyloid; Apoptosis; Qingxinkaiqiao (QK) compound METHODS: Fifty-six three months, male, Sprague-Dawley rats were randomly divided into seven groups: blank control group, surgery group, model group, low-dose QK group, middle-dose QK group, high-dose QK group, and Aricept (donepezil hydrochloride) group, with eight rats in each group Apart from the control and surgery groups, an Alzheimer's disease model was established in all groups by bilateral hippocampal injection of Aβ 1-40 The surgery group received an injection of the same volume of physiological saline Two days after model establishment, rats from the drug JTCM | www journaltcm com INTRODUCTION Alzheimer's disease (AD) is a common neurological degenerative disease in the elderly, characterized by a progressive decline in memory and cognitive function, and often accompanied by personality change The incidence of AD increases with age The symptoms and eventual cognitive decline have placed a large burden on family members and society Because of the increased age of our society, there is a great need for in654 October 15, 2016 | Volume 36 | Issue | Hu HY et al / Experimental Study creased attention to this devastating disease There remains no effective modern treatment for Alzheimer's disease, but Traditional Chinese Medicine provides a unique therapeutic perspective for dementia Qingxinkaiqiao (QK) compound from the "Fumanjian" is a Chinese medicine recipe documented in the medical book Jingyue Quanshu,1 written by Zhang Jing-yue during the Ming Dynasty It has been used in clinical practice for many years It can significantly improve cognitive dysfunction, as well as behavioral and psychological symptoms in patients.2-4 Previous results from our group showed that QK improves learning and memory in AD rats and decreases apoptosis in the hippocampal region.5 The present study aimed to investigate the effects of QK on cortical expression of B-cell lymphoma-2 (Bcl-2), Bcl-2-associated X protein (Bax), cysteinyl aspartate specific proteinase-3 (Caspase-3), and β-amyloid precursor protein (Aβ) in a rat model of AD induced by Aβ1-40 Reagents (sources) used in the study were as follows: Aβ1-40 and DMSO were purchased from Sigma (St Louis, MO, USA); DAB chromogenic reagent kits were purchased from Zymed (San Diego, CA, USA); Hematin dye solution was purchased from Fir Biological (Beijing, China); Trizol Reagent was purchased from ShengGong Biological Engineering (Shanghai, China); Reverse transcriptase, fluorescence quantitative Ploymerase Chain Reaction (PCR) and SYBR green I were purchased from Bioneer (Daejeon, Korea) The quantitative PCR primers were purchased from Dalian Treasure Biological Engineering (Dalian, China); rabbit anti-rat BAX actin antibody, rabbit anti-rat Bcl-2 actin antibody and horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody were purchased from Cell Signal Technology (Beverly, MA, USA); rabbit anti-rat caspase-3 antibody and rabbit anti-rat Aβactin antibody were purchased from Bioworld Technology (St Louis, MO, USA); chloral hydrate was purchased from Sinopharm Chemical Reagent (Shanghai, China); BCA protein assay kit and enhanced chemiluminescence kit were purchased from Pierce (Rockford, IL, USA) MATERIALS AND METHODS Experimental animals Fifty-six male, specific pathogen-free, 3-month-old Sprague-Dawley (SD) rats weighing (250 ± 20) g were purchased from the Beijing Vital River Laboratory Animal Technology Co., Ltd [Certification No SCXK (Beijing) 2012-0001] Rats were bred at the Wenzhou Medical University Laboratory Animal Center (clean experimental and standard animal feeding conditions) The rats were housed in a room with a 12-h light/dark cycle The animals were subjected to experimentation after acclimatization for week at 23-25 ℃ and relative humidity of 55% ± 5% , with free access to standard food and water All experimental conditions followed ethical requirements related to experimental animals Establishment of animal model and grouping Aβ1-40 was incubated according to the manufacturer's instructions to allow the change in an assembly state of the peptide with ensuing toxicity Fifty-six rats were used in the experiment.6 Except for the randomly chosen rats that served as the normal controls, the remaining 48 rats were sedated with 10% chloral hydrate (3-4 mL/kg) by intraperitoneal injection The hair on the skull was shaved and the skin was disinfected with 75% alcohol The skin on the skull was then incised and the periosteum was removed Referring to the Paxinos and Watson Rat Brain Atlas,7 the bregma served as the point Then, mm ventral from bregma, a cranial drill was employed to drill a hole through the skull 1.5 mm to the left and right of the midline A needle was inserted mm deep and a microsyringe was used to infuse μL double-distilled H2O bilaterally into the hippocampus of the sham-surgery group The remaining groups were injected with μL Aβ1-40 at a concentration of 2.5 μg/μL (equivalent to μg Aβ) and a speed of 0.5 μL/min The needle was then held in place for 10 minutes after infusion to prevent leakage Once the needle was removed, the scalp was sutured and iodine was used to disinfect the incision Except for the normal control group (0 + NS) and the sham-surgery group (NS + NS), the remaining 40 successfully established model rats were randomly divided into five groups according to a random number sequence generated by a computer, with eight rats in each group: model control group (Aβ + NS), positive control group (Aβ + Aricept) treated with Aricept [1.67 mg·kg－1·d－1], and three QK-treated groups (Aβ + L-FJ/Aβ + M-FJ/Aβ + H-FJ) treated respectively with QK at various dosages according to the equivalent Drugs and reagents The following herbs were purchased from the Dispensary of Traditional Chinese Medicine (Second Affiliated Hospital of Wenzhou Medical University and verified by the Department of Chinese Materia Medica of Wenzhou Medical University): Dihuang (Radix Rehmanniae) g, Baishao (Radix Paeoniae Alba) g, Shichangpu (Rhizoma Acori Tatarinowii) g, Maidong (Radix Ophiopogonis Japonici) g, Mudanpi (Cortex Moutan Radicis) g, Fushen (Poria Cum Radix Pini) g, Kushen (Radix Sophorae Flavescentis) g, Shihu (Herba Dendrobii Nobilis) g, Chenpi (Pericarpium Citri Reticulatae) g, and Zhimu (Rhizoma Anemarrhenae) g The raw herbs were decocted with appropriate amounts of water, extracted two times, filtered and concentrated to drug stocks of g/mL (crude drug), and stored at ℃ Donepezil (Eisai Pharmaceutical, Suzhou, China; batch number: 100223A) was made into a water suspension of the designed concentration prior to administration JTCM | www journaltcm com 655 October 15, 2016 | Volume 36 | Issue | Hu HY et al / Experimental Study adult human clinical dose (low-dose QK: 4.75 mg·kg－1· d － 1; middle-dose QK: 9.5 mg·kg － 1·d － 1; high-dose QK: 19 mg·kg － 1·d － Starting the following day, the rats were intragastrically administered the respective QK dose place for 14 days at a volume of 10 mg·kg－1· d － (starting at 10 o'clock in the morning every day) The control and model groups were given equivalent volumes of normal saline solution 15.0 μL After mixing, the RNA was denatured for 10 at 25 ℃ The sample was centrifuged to collect the solution at the bottom of the centrifuge tube, and then 4.0 μL × reaction buffer, 1.0 μL RNase inhibitor, and 1.0 μL M-MLV RT were added to the sample, water was added to a total of 25.0 μL The reaction was extended at 42 ℃ for 60 min, maintained at 85 ℃ for min, and then terminated The synthesized cDNA was stored at －20 ℃ Design of PCR primer Primers for Bcl-2 mRNA, Bax mRNA, caspase-3 mRNA, and Aβ mRNA were designed according to the standard principle of real-time PCR primer designation (Shanghai Rui Jingsheng Biological Engineering Co., Ltd., Shanghai, China) Fluorescence real-time quantitative PCR detection The reaction mixture was as follows (50 μL total): 25 μL 2× PCR buffer, 0.6 μL × primers (25 pmol/μL), 0.3 μL SYBR green I (20×), μL cDNA template, and 22.5 μL DEPC H2O The PCR amplification reaction conditions were as follows: 94 ℃ for min; 94 ℃ for 20 seconds, 60 ℃ for 30 seconds, and 72 ℃ for 30 seconds for 35 cycles, following by 72 ℃ elongation Dissolution curve analyses were performed on the amplified PCR products Sequence Detection Software 2.2 was used to analyze the data and calculate the Ct value, which was the value for each sample to reach the threshold value during PCR amplification The relative expression quantities of each sample (Bcl-2/β-actin, Bax/β-actin, caspase-3/β-actin, and Aβ/β-actin) were obtained following β-actin correction (Table 1) Cortex sample handling At the end of the experiment, the rats were anaesthetized with 10% chloral hydrate (3-4 mL/kg) via intraperitoneal injection The rats were then connected to the infusion apparatus, and the chest was opened along both sides of the sternum avoiding large blood vessels to expose the heart A needle was inserted into the tip of the heart and into the aorta The needle was then fixed with a vascular clamp and the right atrial appendage was incised Cold saline (250 mL) was infused until the liver was clear, which was followed by 250 mL cold (4 ℃) paraformaldehyde The brains were quickly removed and further fixed in 4% paraformaldehyde The cortex was rapidly separated from the brain and stored at －80 ℃ Quantification of mRNA expression of Bcl-2, Bax, caspase-3, and Aβ in the cortex using real-time quantitative PCR Measurement of concentration and integrity detection of total RNA extraction Total RNA was extracted according to Trizol kit instructions RNA integrity was tested by separating the RNA by 1.5% agarose gel electrophoresis The RNA solution was diluted and zeroed with diethypyrocarbonate water (DEPC water) The OD values (A260/A280) at 260 nm and 280 nm were obtained by ultraviolet spectrophotometer to determine RNA purity and to calculate the RNA concentration Synthesis of cDNA A mixture of 1.0 μL (1.0 μg/μL) template total RNA, 2.0 μL (T18, 10 pmol/μL) and 2.0 μL (10 mmol/L) dNTP mix was placed into a centrifuge tube (0.5 mL) and water was added to a total of Western blot assay Following extraction of tissue protein, the protein concentration was determined using the BCA protein assay kit according to kit instructions The OD562 value and the protein concentration standard curve were used to calculate the total sample protein concentration Tissue extracts were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis Equal amounts of protein were subjected to electrophoresis on 10% SDS-PAGE gels and then the proteins were Table Ploymerase chain reaction primers Primers Bcl-2 Bax Caspase-3 Aβ β-actin Sequence (5'-3') Amplified fragment length bp Annealing temperature (℃) Upstream GTGAACTGGGGGAGGATTGT 167 51 Downstream GCATCCCAGCCTCCGTTA - - Upstream CCCGAGAGGTCTTCTTCCG 167 50 Downstream GAAGTCCAGTGTCCAGCCCA - - Upstream CGAAACTCTTCATCATTCAGGC 129 54 Downstream AGTAAGCATACAGGAAGTCGGC - - Upstream CTGGAGGTGCCCACTGATG 150 55 Downstream GGGTCTGACTCCCATTTTCC - - Upstream CCCATCTATGAGGGTTACGC 150 51 Downstream TTTAATGTCACGCACGATTTC - - JTCM | www journaltcm com 656 October 15, 2016 | Volume 36 | Issue | Hu HY et al / Experimental Study transferred to polyvinylidene difluoride (PVDF) membranes using an electrophoretic transfer system The PDVF membranes were then blocked for h at room temperature and incubated with primary antibodies (Bax, Bcl-2, and caspase-3 were diluted 1∶500, and Aβ was diluted 1∶100 in TBS) overnight at ℃ After three washes with TBST for each, the membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (1∶1000) at room temperature for h Finally, after washing the membranes three times with TBS for each, immune-labeled bands were identified by using a chemiluminescence-based detection kit (Pierce) The OD values for Bax, Bcl-2, caspase-3, Aβ, and β-actin were obtained using the Quantity One Gel Analysis System (Bio-Rad, Hercules, USA)as follows: target-protein optical density ratio = optical density value of the target protein To reduce experimental error, the western blot assay was performed three times for each rat tion mixture and for 30 with converter-POD at 37 ℃ After incubating for 10 with DAB substrate solution (Zymed, San Diego, CA, USA), the sections were counterstained with hematoxylin, and then examined under a light microscope Positive and negative controls were included on slides from the same block Stained slides were randomly observed at a high-power field (× 400 magnification), and pathological changes near the injection site were photographed The image pictures were processed using America IPP6.0 software (Media Cybernetics, Rockville, MD, USA) and the apoptotic ratio was calculated according to the following formula: apoptotic ratio = number of TUNEL-positive cells/ total number of cells HE staining In brief, after the paraffin sections were dewaxed, hematoxylin staining was performed for min, followed by eosin staining for s The sections were then dehydrated with alcohol, followed by xylene, and then coverslipped Cortical histopathological abnormalities were investigated under a light microscope Two different pathologists quantified the number of cells in the cortical region of each section in a blinded manner, and the average number was served as the final result Immunohistochemistry and quantitative analysis The fixed brain tissues were dehydrated through an alcohol gradient, followed by xylene The tissues were then embedded in paraffin and sectioned on a cryostat at a thickness of μm Sections were dewaxed and subjected to 3% H2O2 for 10 min, followed by several washes in distilled water Then sections to heat-mediated antigen retrieval with 0.01 M citric acid buffer (pH 6.0) Following several washes in phosphate-buffered saline (PBS), sections were bolcked with 10% goat serum (30 min), and then incubated with rabbit anti-rat BAX antibody (1∶1000), Bcl-2 antibody (1∶1000), Caspase-3 antibody (1∶1000) and Aβ antibody (1∶ 1000) at ℃ overnight After incubation with the goat secondary antibody, at room temperature for h After detected with a DAB staining kit, the sections were counterstained with hematoxylin The MIAS Medical System (Media Cybernetics, Rockville, MD, USA) was used for image analysis A total of six sections were selected for each group, and five fields were analyzed on each section (× 400 magnification) All positive cells were selected within the view, and the computer software IPP6.0 image analysis system (Media Cybernetics) automatically calculated the cell density The positive target area/total area of the field of view was calculated for quantitative expression Statistical analysis All data were processed using SPSS 16.0 statistical software (SPSS, Chicago, IL, USA) All data were expressed as mean ± standard deviation ( xˉ ± s) Least significant difference and Dunnett test were performed for group comparisons P < 0.05 was the statistically significant level RESULTS Comparison of mRNA expression of Bcl-2, Bax, caspase-3, and Aβ in the cortex Results showed no significant difference in mRNA expression of Bcl-2, Bax, caspase-3, and Aβ between the normal control and the sham-surgery groups (P > 0.05) Compared with the normal control group, Bcl-2 mRNA expression in the model control group significantly decreased, whereas Bax, caspase-3, and Aβ mRNA expressions significantly increased (P < 0.01) Compared with the model control group, Bcl-2 mRNA expression in each treatment group significantly increased, but Bax, caspase-3, and Aβ mRNA expressions significantly decreased (P < 0.01) Bcl-2 mRNA expression in the middle-dose QK group significantly increased, but Bax, caspase-3, and Aβ mRNA expressions significantly decreased compared with the low-dose and high-dose group (P < 0.01) Compared with the Aricept group, Bcl-2 mRNA expression in the low-dose and high-dose groups were decreased, but no significant differences in Bax mRNA expression were found in the two groups (P > 0.05) (Figure 1) TUNEL assay To detect cells undergoing apoptosis, TUNEL was performed according to the manufacturer's protocol supplied within the TUNEL-pod kit (Roche, Basle, Switzerland) The brain sections were first immersed in xylene and dehydrated through serial alcohol dilutions followed by a wash step in distilled water After treating with 3% H2O2 for 10 at room temperature, the sections were incubated with proteinase K for 20 at 37° C to enhance permeability Then, the sections were incubated for 60 with TUNEL reacJTCM | www journaltcm com 657 October 15, 2016 | Volume 36 | Issue | Hu HY et al / Experimental Study 0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0.00 A b c 0+NS NS+NS Aβ+NS Aricept L-FJ c M-FJ c H-FJ a C b c c c 0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0.00 mRNA levels of Bcl-2 a 0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0.00 B c b c c a 0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ a mRNA levels of Aβ mRNA levels of caspase-3 mRNA levels of Bax 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0.00 D b c c c 0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ 0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ Groups Groups Figure Cortical mRNA expression of Bax, Bcl-2, caspase-3, and Aβ A: Bax; B: Bcl-2; C: caspase-3; D: Aβ 0+NS: normal control group (no treatment); NS+NS: sham-surgery group (no treatment); Aβ+ NS: model control group (no treatment); Aricept: treated with Aricept (1.67 mg·kg －1·d －1); L-FJ: treated with QK (low dose of 4.75 mg·kg－1·d－1); M-FJ: treated with QK (medium dose of 9.5 mg·kg－1·d－1); H-FJ: treated with QK (high dose of 19 mg·kg－1·d－1) NS: normal saline; Aβ: amyloid-β1-40 protein; L-FJ: low dose of QK (4.75 mg·kg － 1·d － 1); M-FJ: medium dose of QK (9.5 mg·kg － 1·d － 1); H-FJ: high dose of QK (19 mg·kg － 1·d － 1) Data are presented as mean ± standard deviation (n = 6) Significant differences compared with NS + NS (sham-surgery) group at the same time point are designated as aP < 0.01 and with Aβ + NS (model control) group at the same time point as bP < 0.01, cP < 0.05, and dP < 0.01 normal control and sham-surgery rats revealed morphologically normal neurons with no TUNEL reaction Compared with the control group, the number of apoptotic cells significantly increased in the model group (P < 0.01; Figure 4) After treatment with donepezil or QK, the number of TUNEL-positive cells significantly decreased compared with the model group (P < 0.01) The 9.5 mg·kg － 1·d － QK dose produced the strongest effect, which was comparable to 4.75 or 19 mg·kg－1·d－1 Comparison of Bcl-2, Bax, caspase-3, and Aβ protein expressions in the cortex of AD rats To investigate changes in Bcl-2, Bax, caspase-3, and Aβ protein expression in the cortex, we used western blot analysis Results are shown in Figure There was no significant different in Bcl-2, Bax, caspase-3, and Aβ protein expressions between the normal control group and the surgery control group (P > 0.05) Bax, caspase-3, and Aβ protein expression significantly increased in the model control group rats, and Bcl-2 protein significantly decreased, compared with the sham-surgery group (P > 0.01) Compared with the model control group, Bcl-2 mRNA expression in each treatment group significantly increased, but Bax, caspase-3, and Aβ mRNA expressions significantly decreased (P < 0.01) However, there were no differences in Bcl-2, Bax, caspase-3, and Aβ protein expression between the middle-dose QK group and the Aricept group (P > 0.05) (Figure 2) HE staining HE staining revealed no remarkable neuronal abnormalities in the cortex of rats in the control and sham-surgery groups The pyramidal cells were neatly and tightly arranged, and no cell loss was found Additionally, for these groups, the cells were round and intact with clear, dark-blue nuclei (Figure 5) However, obvious cortical histopathological damage was observed in the model groups The pyramidal layered structure was disintegrated, and neuronal loss was found Neurons with pyknotic nuclei and with a shrunken or irregular shape were also observed (Figure 5C) These abnormalities were attenuated by treatment The cells in the Aricept and QK groups exhibited better cell morphology and were more numerous than in the model group, but were overall worse than in the control and sham-surgery groups (Figure 5D, 5E) Immunohistochemistry of Bcl-2, Bax, caspase-3, and Aβ in the cortex In the AD model group, there was a significant increase in the number of cells expressing Bax, caspase-3, and Aβ in the cortex, and a significant decrease in the number of cells expressing Bcl-2 (P < 0.01; Figure 3) compared with the other groups Following treatment with donepezil or QKF, these results were reversed The 9.5 mg·kg － 1·d － QK dose produced the strongest effect, which was compared with 4.75 and 19 mg· kg － 1·d － DISCUSSION TUNEL assay results Microscopic inspection of the cortical sections from AD is the most common type of dementia The incidence of AD increases with age, which is compounded JTCM | www journaltcm com 658 October 15, 2016 | Volume 36 | Issue | Hu HY et al / Experimental Study A kDa Bax 21 C β-actin Protein levels of Bax (/β-actin) 3.0 2.5 2.0 1.5 1.0 0.5 0.0 Protein levels of Caspase-3 (/β-actin) 6.0 5.0 4.0 3.0 2.0 1.0 0.0 a b 0+NS NS+NS Aβ+NS Aricept a b c L-FJ c c M-FJ c D 43 87 Aβ 17 43 β-actin 3.5 3.0 E 2.5 2.0 b c 1.5 1.0 a 0.5 0.0 0+NS NS+NS Aβ+NS Aricept H-FJ 2.5 a G 2.0 Protein levels of Bcl-2 (/β-actin) Caspase-3 43 26 β-actin Protein levels of Aβ (/β-actin) β-actin B kDa Bcl-2 c 1.5 1.0 b 43 F d L-FJ c M-FJ d H-FJ H c c c 0.5 0.0 0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ 0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ Groups Groups Figure Protein expression of Bcl-2, Bax, caspase-3, and Aβ in the cortex A and E: protein levels of Bax in all groups B and F: protein levels of Bcl-2 in all groups C and G: protein levels of caspase-3 in all groups D and G: protein levels of Aβ in all groups + NS: normal control group (no treatment); NS + NS: sham-surgery group (no treatment); Aβ + NS: model control group(no treatment); Aricept: treated with Aricept (1.67 mg·kg －1·d －1); L-FJ: treated with QK (low dose of 4.75 mg·kg － 1·d － 1); M-FJ: treated with QK (medium dose of 9.5 mg·kg － 1·d － 1); H-FJ: treated with QK (high dose of 19 mg·kg － 1·d － 1) NS: normal saline; Aβ: amyloid-β1-40 protein; L-FJ: low dose of QK (4.75 mg·kg － 1·d － 1); M-FJ: medium dose of QK (9.5 mg·kg－1·d－1); H-FJ: high dose of QK (19 mg·kg－1·d－1) Data are presented as mean ± standard deviation (n = 6) Significant differences compared with NS + NS (sham-surgery) group are designated as aP < 0.01 and with Aβ + NS (model control) group as bP < 0.01, cP < 0.01, and dP < 0.05 by the fact that people are living longer these days There are many hypotheses for AD etiology, including the Aβ waterfall hypothesis,8,9 immune and inflammatory involvement hypothesis,10,11 the cholinergic defects hypothesis,12,13 the tau protein hyperphosphorylation hypothesis,14,15 the intracellular calcium homeostasis disorders hypothesis,16,17 and the peroxidation hypothesis.18 It has been suggested that the incidence of AD is caused by multiple factors, and Aβ deposition in neuronal cells of the brain is the initial event that occurs in AD.19 Therefore, for the present study, the bilateral hippocampi of rats were injected with Aβ1-40 fragments to establish an experimental model of AD This method has been shown to be stable and reliable and very effectively simulates the pathological and pathophysiological characteristics of AD.20-22 Aβ is neurotoxic and induces apoptosis through a series of pathological and physiological mechanisms that lead to AD,23 such as activation of glial cells, which initiates neuroinflammation,24 induction of the inflammatory cascade,25 induction of oxidative stress mechanisms,26,27 and excessive expression of NO and NO toxicity.28 Taken together, these results suggest that Aβ-induced neuronal apoptosis is an important pathological characteristic of AD Caspase-3 is an effector of apoptosis and the final executor of apoptosis.29 The Bcl-2 family is intricately involved in neuronal apoptosis; Bcl-2 is an important endogenous anti-apoptotic gene, Bax is JTCM | www journaltcm com the most important pro-apoptotic gene in this family,30 and the ratio between these two genes plays a role in the physiological state Previous experiments31 have shown that Aβ can lead to increase toxicity in neural stem cells, reduced Bcl-2 expression, increased Bax expression, and imbalanced Bax/Bcl-2 ratios, all of which undermine the integrity of cell membranes Compared with the model group, Bcl-2 expression increased and Bax, caspase-3, and Aβ expression decreased in the cortex of each QK treatment group In conclusion, QK significantly increased expression of Bcl-2, down-regulated expression of Bax, caspase-3, and Aβ, and reduced the number of apoptotic cells in the cortex REFERENCES 659 Zhang JB Complete Works of jingyue, Shanghai: The second facility press, 2006: 685 Wang YF Yan QL uses the clearing method in the treatment of Alzheimer's disease experience Jiang Su Zhong Yi Za Zhi 2004; 25(3): 10-11 Hong W Zhang Jingyue's academic thoughts about dementia Hebei Zhong Yi Za Zhi 2000; 22(7): 551-552 Yan QL, Xing B Development of TCM treatment in Alzheimer's disease objective and method Zhong Yi Za Zhi 2003; 44(10): 725-726 Hu HY, Cui ZH, Li HQ, et al Fumanjian, a Classic ChiOctober 15, 2016 | Volume 36 | Issue | Hu HY et al / Experimental Study mRNA levels of Caspase-3 0.30 0.25 0.20 0.15 0.10 0.05 0.00 B1 C1 D1 E1 F1 G1 A2 B2 C2 D2 E2 F2 G2 A3 B3 C3 D3 E3 F3 G3 A4 B4 C4 D4 E4 F4 G4 a c c H1 0.12 c b 0.16 mRNA levels of Aβ mRNA levels of Bcl-2 OD levels of Bax 0.25 0.20 0.15 0.10 0.05 0.00 A1 a b c H2 c c M-FJ H-FJ H4 c 0.08 0.04 0+NS NS+NS Aβ+NS Aricept L-FJ a b M-FJ c c H-FJ H3 c 0.00 0.25 0.20 0.15 0.10 0.05 0.00 0+NS NS+NS Aβ+NS Aricept L-FJ a b c c 0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ 0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ Groups Groups Figure Immunohistochemical staining of the cortex (× 400) A1-H1: OD level of BAX in all groups A2-H2: OD level of Bcl-2 in all groups A3-H3: OD level of caspase-3 in all groups A4-H4: OD level of Aβ in all groups A: control; B: sham-surgery; C: control model; D: Aricept; E: low-dose QK; F: middle-dose QK; G: high-dose QK 0+NS: normal control group(no treatment); NS+NS: sham-surgery group (no treatment); Aβ+NS: model control group (no treatment); Aricept: treated with Aricept (1.67 mg·kg －1·d －1); L-FJ: treated with QK (low dose of 4.75 mg·kg －1·d －1); M-FJ: treated with QK (medium dose of 9.5 mg·kg －1·d －1); H-FJ: treated with QK (high dose of 19 mg·kg－1·d－1) NS: normal saline; Aβ: amyloid-β1-40 protein; L-FJ: low dose of QK (4.75 mg·kg－1·d－1); M-FJ: medium dose of QK (9.5 mg·kg－1·d－1); H-FJ: high dose of QK (19 mg·kg－1· d － 1) Data are presented as mean ± standard deviation (n = 6) Significant differences compared with NS + NS (sham-surgery) group are designated as aP < 0.01 and with Aβ + NS (model control) group as, bP < 0.01 and cP < 0.01 JTCM | www journaltcm com 660 October 15, 2016 | Volume 36 | Issue | Hu HY et al / Experimental Study F B G D C E a 1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0 c c Apoptotic ratio (%) A b H c 0+NS NS+NS Aβ+NS Aricept L-FJ M-FJ H-FJ Figure TUNEL staining showing cell apoptosis in the cortex (× 400) Groups A: control; B: sham-surgery; C: control model; D: Aricept; E: low-dose QK; F: middle-dose QK; G: high-dose QK Apoptosis is expressed as the percentage of the number of TUNEL-positive cells to the total number of cells 0+NS: normal control group (no treatment); NS + NS: sham-surgery group (no treatment); Aβ + NS: model control group (no treatment); Aricept: treated with Aricept (1.67 mg·kg － 1·d － 1); L-FJ: treated with QK (low dose of 4.75 mg·kg － 1·d － 1); M-FJ: treated with QK (medium dose of 9.5 mg·kg － 1·d － 1); H-FJ: treated with QK (high dose of 19 mg·kg － 1·d － 1) NS: normal saline; Aβ: amyloid-β1-40 protein; L-FJ: low dose of QK (4.75 mg·kg －1·d －1); M-FJ: medium dose of QK (9.5 mg·kg －1·d －1); H-FJ: high dose of QK (19 mg/kg/d) TUNEL: Terminal-deoxynucleoitidyl Transferase mediated nick end labeling Data are presented as mean ± standard deviation (n = 6) Significant differences compared with NS + NS (sham-surgery) group are designated as aP < 0.01 and with Aβ + NS (model control) group as cP < 0.01 and bP < 0.01 A B D C E Figure HE staining showing cellular morphology in the cortex (× 200) A: control (no treatment); B: sham-surgery (no treatment); C: control model (no treatment); D: Aricept (1.67 mg·kg － 1·d － 1); E: QK groups (medium dose of 9.5 mg·kg －1·d －1) Rats in the control and sham-surgery groups did not show histopathological abnormalities In the model group, remnants of the pyramidal cells were irregularly arranged and some exhibited a shrunken and irregular shape Cells in the Aricept and QK groups exhibited better cell morphology and were more numerous than in the model group HE: hematoxylin eosin 10 nese Herbal Formula, Can Ameliorate the Impairment of Spatial Learning and Memory through Apoptotic Signaling Pathway in the Hippocampus of Rats with Aβ1-40-Induced Alzheimer's Disease EVID-BASED COMPL ALT 2014 Available from URL: http://dx.doi.org/10.1155/ 2014/942917 Zhang YL, Liou DM, Wu QS, Yao YY, Li WP Effect of the extract of astragalus on the ability of learning and memory and the expression of Bcl-2 and Bcl-xl protein of the hippocampal neurons in rat model of Alzheimer's Disease Anhui Yi Ke Da Xue Xue Bao 2007; 42(3): 299-302 George P, Charles W The rat brain in stereotaxic coordinates Thirded Beijing: People, Publishing House, 2005: 30-36 Zhao WQ, Fernanda GDF, Sara F, et al Amyloid beta oligomers induce impairment of neuronal insulin receptors FASEBJ 2008; 22(1): 246-260 Viola KL, Velasco PT, Klein WL Why Alzheimer's disease is a disease of memory: the attack on synapses by A-beta oligomers (ADDLs) J Nutr Health Aging 2008; 12 (1): 51S-57S Ojala J, Alafuzoff I, Herukka SK, van Groen T, Tanila H, Pirttila T Expression of interleukin-18 is increased in the brains of Alzheimer's disease patients Neurobiol Aging JTCM | www journaltcm com 11 12 13 14 15 16 17 661 2009; 30(2): 198-209 Vasto S, Candore G, Listi F, et al Inflammation, genes and zinc in A1zheimer's disease Brain Res Rev 2008; 58 (l): 96-105 Gulledge AF, Stuart GJ Cholinergic inhibition of neocortical pyramidal neuron J Neurosci 2005; 25(44): 1030810320 Watanabe T, Yamagata N, Takasaki K, et al Decreased acetylcholine release is correlated to memory impairment in the Tg2576 transgenic mouse model of Alzheimer's disease Brain Res 2009; 1249(1): 222-228 Muntane G, Dalfo E, Martinez A, Ferrer I Phosphorylation of tan and alpha-synuclein in synaptic-enriched fractions of the frontal cortex in Alzheimer's disease, and in Parkinson's disease and related alpha-synucleinopathies Neuroscience 2008; 152(4): 913-923 Hanger DP, Anderton BH, Noble W Tau phosphorylation: the therapeutic challenge for neurodegenerative disease Trends Mol Med 2009; 15(3): 112-119 Thibault O, Gant JC, Landfield PW Expansion of the calcium hypothesis of brain aging and Alzheimer's disease: minding the store Aging Cell 2007; 6(3): 307-317 Cheung KH, Shineman D, Mulle M, et al Mechanism of Ca2+ disruption in Alzheimer's disease by Presenilin regulation of InsP3 receptor channel gating Neuron 2008; 58 October 15, 2016 | Volume 36 | Issue | Hu HY et al / Experimental Study 18 19 20 21 22 23 24 (6): 871-883 Reed T, Perluigi M, Sultana R, et al Redox Proteomic identification of 4-hydroxy-2-nonenal-modified brain proteins in amnestic mild cognitive impairment: insight into the role of lipid peroxidation in the progression and pathogenesis of Alzheimer's disease Neurobiol Dis 2008; 30(1): 107-120 Moir RD, Tanzi RE LRP-mediated clearance of Aβ is inhibited by KPI-containing is form of APP Curr Alzheimer Res 2005; 2(2): 276-280 Shin RW, Ogino K, Kondo A, et al Amyloid β-protein (Aβ)1-40 but not Aβ1-42 contributes to the experimental formation of Alzheimer disease amyloid fibrils in rat brain J Neurosci 1997; 17(21): 8187-8193 Yamaguchi Y, Miyashita H, Tsunekawa H, et al Effects of a novel cognitive enhancer, spiro[imidazo-[1,2-a]pyridine-3,2-indan]-2(3H)-one (ZSET1446), on learning impairments induced by amyloid-β1-40 in the rat J Pharmacol Exp Ther 2006; 317(3): 1079-1087 Zou K, Kim D, Kakio A, et al Amyliod β-protein (Aβ) 1-40 protects neurons from damage induced by Aβ1-42 in culture and in rat brain J Neurochem 2006; 87(3): 609-619 Zhang HS, Lin Q, Yang DH Research progress of Aβ toxicity mechanism of Alzheimer's diseas Zhong Guo Dang Dai Yi Yao 2009; 16(9): 23-24 Stein TD, Andersn J, Decarli C, Chan SL, Mattson MP, Johnson JA Neutralization of transthyretin reverses the neuroprotective effects of secreted amyloid precursor pro- JTCM | www journaltcm com 25 26 27 28 29 30 31 662 tein (APP) in APPSW mice resulting in tau phosphorylation and loss of hippocampal neurons: support for the amyloid hypothesis Neurosci 2004; 24(35): 7707-7717 Streit WJ Microglia and Alzheimer's disease pathogenesis J Neurosci Res 2004; 77(1): 1-8 Klyubin I, Walsh DM, Lemere CA, et al Amyloidbeta protein immunothempy neutralizes Abeta oligomem that disrupt synaptic plasticity in vivo Nat Med 2005; 11(5): 556-561 Ma GS, Chen SD, Ba MW, et al Aβ Induced Glioma Cell U251 Protein Aggregates Formation of Oxygen Content and Mitochondrial Membrane Potential Increasedac J Neurol 2005; 38(4): 265-266 Rowan MJ, Klyubin I, Wang Q, Anwyl R Synaptic plasticity disruption by amyloid beta protein:modulation by potential Alzheimer's disease modifying therapies Biochem Soc Trans 2005; 33(Pt 4): 563-567 Ozoren N, El-Deiry WS Cell-surface-death-receptor-signaling in normal and cancer cells J Semin Cancer Biol 2003; 13: 135-147 Fletcher JI, Meusburger S, Hawkins CJ, et al Apoptosis is triggered when prosurvival Bcl-2 proteins cannot restrain Bax Proc Natl Acad Sci USA 2008; 105(47): 18081-18087 Holsinger RM, Schnarr J, Henry P, Castelo VT, Fahnestock M Quantitation of BDNF mRNA in human parietal cortex by competitive reverse transcription- polymerase chain reaction:decreased levels in Alzheimer's disease Brain Res 2000; 76(2): 347-354 October 15, 2016 | Volume 36 | Issue | ... Protein expression of Bcl- 2, Bax, caspase- 3, and Aβ in the cortex A and E: protein levels of Bax in all groups B and F: protein levels of Bcl- 2 in all groups C and G: protein levels of caspase- 3 in. .. Effect of the extract of astragalus on the ability of learning and memory and the expression of Bcl- 2 and Bcl- xl protein of the hippocampal neurons in rat model of Alzheimer''s Disease Anhui Yi... group, Bcl- 2 expression increased and Bax, caspase- 3, and Aβ expression decreased in the cortex of each QK treatment group In conclusion, QK significantly increased expression of Bcl- 2, down-regulated