Association between preterm labor and genitourinary tract infections caused by Trichomonas vaginalis, Mycoplasma hominis, Gram negative bacilli, and coryneforms Available online at www sciencedirect c[.]
+ MODEL Available online at www.sciencedirect.com ScienceDirect Journal of the Chinese Medical Association xx (2017) 1e7 www.jcma-online.com Original Article Association between preterm labor and genitourinary tract infections caused by Trichomonas vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms Alaa El-Dien M.S Hosny a, Waleed El-khayat b, Mona T Kashef a,*, Mohsen N Fakhry c a Department of Microbiology and Immunology, Faculty of Pharmacy, Cairo University, Cairo, Egypt b Obstetrics & Gynecology Department, Faculty of Medicine, Cairo University, Cairo, Egypt c Microbiologist at Chemipharm Pharmaceutical Industries, Cairo, Egypt Received July 19, 2016; accepted October 7, 2016 Abstract Background: Preterm labor (PTL) is responsible for most cases of neonatal death In most of these cases, the causes of PTL have not been established although several risk factors have been described Therefore, the aim of this study was to investigate risk factors for PTL before 37 gestational weeks among Egyptian women Methods: In this case-control study, 117 pregnant women without risk factors for PTL were chosen The control group (n ¼ 45) had term labor (gestational weeks 37 weeks), and the case group (n ¼ 72) had PTL (gestational weeks < 37 weeks) The two groups were screened for urinary and vaginal infections The role of different demographic characteristics, patient history, and clinical signs were also investigated Results: Several risk factors were identified in this study, including age < 20 years, nulliparity, previous abortion and previous preterm birth, menses vaginal bleeding, a vaginal pH > 5, a positive whiff test, Trichomonas vaginalis infection, Mycoplasma hominis infection, coryneforms heavy vaginal growth, and any vaginal growth of Gram-negative bacilli Urinary tract infection with any colony count was not associated with PTL Conclusion: Our study demonstrated that the main risk factors for PTL were vaginal infection with T vaginalis, M hominis, coryneforms, and Gram-negative bacilli, and their determinants (vaginal pH > 5, positive whiff test, heavy vaginal bleeding) Both young age (< 20 years) and poor obstetric history were also the risk factors Therefore, screening for genitourinary tract infections is strongly recommended to be included in prenatal care Copyright © 2017, the Chinese Medical Association Published by Elsevier Taiwan LLC This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/) Keywords: infection; preterm labor; risk factors; urinary tract infection; vaginal Introduction Preterm labor (PTL) is labor which occurs before 37 completed weeks of gestation and can lead to preterm birth Conflicts of interest: The authors declare that they have no conflict of interest related to the subject matter or materials discussed in this article * Corresponding author Dr Mona T Kashef, Department of Microbiology and Immunology, Faculty of Pharmacy, Cairo University, El Qasr El Einy Street, Cairo 11562, Egypt E-mail address: mona.kashef@pharma.cu.edu.eg (M.T Kashef) (PTB) PTB causes most of neonatal deaths and different forms of neonatal morbidities.1 The causes of PTB in most cases have not been established although several risk factors have been identified.2 These factors include: (1) poor socioeconomic status and low education level3; (2) maternal age of < 20 years and > 35 years4; (3) heavy manual work2; (4) cervical incompetence, multiple gestations, previous abortion, previous PTB2,4,5; and (5) genitourinary tract infections.1 Genitourinary infections usually lead to PTB Because many of these infections are asymptomatic, underestimation of their importance may have been occurred.1 Furthermore, few studies http://dx.doi.org/10.1016/j.jcma.2016.10.007 1726-4901/Copyright © 2017, the Chinese Medical Association Published by Elsevier Taiwan LLC This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/) Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/ j.jcma.2016.10.007 + MODEL A.E.-D.M.S Hosny et al / Journal of the Chinese Medical Association xx (2017) 1e7 Methods (gestational age, race, age, weight, height, nonprescription drug use, prenatal care received, working during pregnancy, smoking, coffee consumption, education, yoghurt consumption, contraception use, and use of vaginal douches during pregnancy), pregnancy history (parity, gravidity, previous abortions, and previous PTB), medical complications (anemia, vaginal bleeding during pregnancy, urinary tract infection, and other infections), and results of speculum examination, done at the time of sampling (presence of vaginal discharge, other signs of infection as erythema, bleeding, vaginal pH, and the whiff test result) 2.1 Study population 2.4 Sampling This case-control study was performed involving Egyptian women who were in labor and admitted to the Department of Obstetrics and Gynaecology, Kasr Al Aini hospital, Cairo, Egypt The women were enrolled during a 7-month period from December 2009 to June 2010 For purposes of this study, labor was defined as at least three uterine contractions in 10 minutes or 2e3-cm cervical dilatation.9 The study population (PTL group) consisted of 72 women admitted for PTL (< 37 gestational weeks) with or without preterm premature rupture of membranes (PPROM) The control group (TL group) consisted of 45 control women admitted for TL without any complications of pregnancy such as PPROM, preterm contractions, or vaginal bleeding ( 37 gestational weeks) The gestational age was based on the last menstrual period combined with ultrasonographic data, if present The study was approved by Kasr Al Aini hospital ethical committee (992009) Vaginal swabs were obtained by the attending physician prior to vaginal examination, and urine samples were collected by the participants themselves All specimens were transported to the laboratory and processed within 18 hours of collection by a microbiologist who was blinded to the group of participants.10 2.2 Exclusion criteria 2.4.1.1 Isolation and identification of vaginal microorganisms 2.4.1.1.1 Group B streptococci The swab was inoculated into selective Todd Hewitt broth supplemented with 15 mg/mL nalidixic acid, 10 mg/mL colistin, CNA supplement (as directed), and 10 mg/mL yeast extract (LIM broth); all the media were purchased from Oxoid Ltd., UK Next, the broth was subcultured to a 5% sheep blood agar (SBA) plate All cultures were incubated following appropriate atmospheric conditions.11 Suspected colonies were tested using Streptococcal grouping latex test, according to manufacturer's instructions (Oxoid Ltd., UK) 2.4.1.1.2 T vaginalis detection One of the swabs, placed in Amies medium, was inoculated into a modified thioglycolate medium (Oxoid Ltd., UK), incubated aerobically at 35 C for days, and examined daily for characteristic motility.12 The other swab, placed in Amies medium, was used to inoculate SBA, MacConkey agar, Sabouraud dextrose agar, and Rogosa agar (All were from Oxoid Ltd., UK) to isolate aerobic bacteria, facultative Gram-negative bacilli, yeast species, and lactobacilli, respectively All inoculated media were incubated according to the recommended conditions Only colonies growing in the third or fourth streak were identified as they indicate a change of vaginal flora to heavy growth of this microorganism(s).13 2.4.1.1.3 Molecular identification testing Polymerase chain reaction (PCR) was used for the detection of Chlamydia focusing on these infections were conducted in Egypt, and they investigated only one infection in relation to PTB, such as chlamydia,6 bacterial vaginosis, or urinary tract infection.7,8 In the present study, we screened women in term labor (TL) and PTL for the presence of urinary and vaginal infections to examine their association with PTL In addition, the role of different demographic characteristics, patient history, and clinical signs were also investigated Women with any of the following risk factors for PTL were excluded from the study: age < 15 years, placenta previa and abruptio placentae, multiple gestations, hydramnios, congenital malformation, intrauterine fetal death, intrauterine growth retardation, medical complications requiring long-term or intermittent medications as insulin-requiring diabetes mellitus, chronic hypertension and maternal cardiac disease, preeclampsia, pregnancy-induced hypertension, erythroblastosis fetalis, Rh isoimmunization, renal disease with a baseline creatinine level of > 2.0, autoimmune disease requiring steroids, cervical cerclage, uterine fibroids, abdominal trauma, in vitro fertilization, clinically evident herpes simplex virus, and treatment with antibiotics or vaginal douches/pessaries within weeks of enrollment These factors were chosen based on their association with medically-induced preterm delivery Therefore, this exclusionary regimen facilitates the ability to study the presence of infection as a sole risk factor in PTL A gynecologist was responsible for the inclusion/exclusion of study participants by applying the suitable medical examination or questionnaire 2.3 Data collection A written questionnaire was filled out by a staff nurse prior to sampling, focusing on patient demographic characteristics 2.4.1 Vaginal swab samples A total of five swabs were obtained from each woman The first one was used for group B streptococci screening, as previously described.11 The other four swabs were used for screening other genital infections using an unmoistened sterile speculum Two of these swabs were placed separately into Amies transport medium (Oxoid Ltd., UK) for microbial biochemical identification The third swab was returned to its plastic tube containing no transport medium for molecular identification tests Finally, the final fourth swab was used for Gram stain scoring of vaginal sample, pH determination, and whiff test Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/ j.jcma.2016.10.007 + MODEL A.E.-D.M.S Hosny et al / Journal of the Chinese Medical Association xx (2017) 1e7 trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis, M genitalium, and Ureaplasma The genomic DNA was extracted from the swab using the QIAamp DNA Mini kit (Qiagen, Germany), according to the manufacturer's instructions PCR was subsequently performed, as described previously.14e19 Table summarizes the sequence of primers used for detection of each microorganism and the expected amplicon size The positive samples in genus-specific PCR for mycoplasmas and ureaplasmas were further tested for M genitalium, M hominis, and Ureaplasma 2.4.1.2 Gram stain scoring of vaginal sample, pH determination, and whiff test The final fourth swab was rolled over a glass slide which was Gram stained and scored as described previously.20 Clue cells were also recorded The same swab was then touched to a pH paper (Whatman narrow range pH paper 4e6, with discrimination of 0.5, UK) for the determination of the vaginal pH, and a drop of 10% potassium hydroxide was placed on it (whiff test) A fishy amine odor was recorded as a positive whiff test Bacterial vaginosis (BV) was also diagnosed using the Amsel's composite criteria, which suggests that BV should be suspected if three or more of the following criteria were present: homogeneous vaginal discharge, elevated vaginal pH > 4.5, production of amine odor in whiff test, and presence of clue cells Women with less than three of the criteria were considered as normal.21 2.5 Urine analysis Each woman was instructed by a staff nurse regarding the proper collection of the urine sample The urine was cultured by the surface streak method on two SBA plates and two MacConkey agar plates using 1-mL and 10-mL plastic calibrated loops (Pbi, Italy), incubated aerobically for 48 hours at 35e37 C.22 Only plates with 10 colonies were considered.23 The counts were calculated as colony forming units (CFU)/mL and were placed in one of the following groups: no growth to < 103, 103 to < 104, 104 to < 105, and 105 Only growth of one or two isolates of possible uropathogens at a concentration of 103 CFU/ml was considered, and these isolates were identified Cultures growing isolates or any urethral nonuropathogen flora (diphtheroids, viridans streptococci, lactobacilli, coagulase-negative Staphylococci other than Staphylococcus saprophyticus, and Bacillus spp.) were not identified.24 Different biochemical tests were used for microorganism identification including colony characteristics, Gram stain and wet mount, catalase test (3%), growth on Mannitol salt agar (Oxoid, UK), Dry Spot Staphytect Plus kit (Oxoid, UK), disk susceptibility with Polymyxin B (300 units, Oxoid, UK) and Novobiocin (5 mg, Oxoid, UK), oxidase sticks (Oxoid, UK), RapID STR system (Remel, USA), RapID CB plus system (Remel, USA), RapID ONE system (Remel, USA), and RapID SS/u system (Remel, USA) All tests were done according to the manufacturer's instructions Thereafter, the germ tube test was performed for identification of Candida albicans.22 2.6 Statistical analysis The tests of two or more proportions were done using Fisher's exact test The p values were from two sample-tailed tests (http://www.physics.csbsju.edu/stats/exact.html) Analysis of variance test was used to compare continuous data, such as age and weight between different groups, by the Excel program after checking data normality using a studentized range test Odds ratio (OR) and 95% confidence intervals (CI) were also calculated for different bacterial forms that were significantly associated with PTL (http://vassarstats.net/) A p value < 0.05 was considered significant Results There was no significant difference in the pregnancy outcome based on the most tested demographic characteristics (data not shown) In addition, there was no significant difference in the mean age, weight, or height between the PTL group and control (TL) group ( p > 0.05) as shown in Table 2; however, 28.36% of the total PTL women were aged < 20 years compared with only 9.3% of the TL group ( p < 0.05) Table Primer sequences used in PCR identification of pathogenic microorganisms and their corresponding amplicon size Name of microorganism Primer sequence Chlamydia trachomatis F: 50 -TCCGGAGCGAGTTACGAAGA-30 R: 50 -AATCAATGCCCGGGATTGGT-30 F: 50 -GCTACGCATACCCGCGTTGC-30 R: 50 -CGAAGACCTTCGAGCAGACA-30 F: 50 -GTAATACATAGGTCGCAAGCGTTATC-30 R: 50 - CACCATCTGTCACTCTGTTAACCTC-30 F: 50 -AGTTGATGAAACCTTAACCCCTTGG-30 R: 50 - CCGTTGAGGGGTTTTCCATTTTTGC-30 F: 50 -CAATGGCTAATGCCGGATACGC-30 R: 50 - GGTACCGTCAGTCTGCAAT-30 F: 50 -GTATTTGCAATCTTTATATGTTTTCG-300 R: 50 - CAGCTGATGTAAGTGCAGCATTAAATT C-3 Neisseria gonorrhoeae Mycoplasmas and ureaplasmas (genus-specific) Mycoplasma genitalium Mycoplasma hominis Ureaplasma Amplicon size (bp) Reference 241 14 390 15 520 16 281 17 334 18 403, 404 (Ureaplasma parvum) 448 (Ureaplasma urealyticum) 19 bp ¼ base pair; F ¼ forward primer; R ¼ reverse primer Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/ j.jcma.2016.10.007 + MODEL A.E.-D.M.S Hosny et al / Journal of the Chinese Medical Association xx (2017) 1e7 Table Comparison of demographic characteristics, pregnancy history, vaginal bleeding, and results of speculum examination among preterm and term labor women group ( p < 0.05; Table 2) A positive whiff test was significantly more common in the PTL group than in the control group ( p < 0.01; Table 2) Characteristics 3.4 Microbiology Total PTL cases TL (control) Demographic characteristics Age (y) 23.13 ± 5.29 (N ¼ 70) 24.45 ± 4.81 (N ¼ 44) Weight (kg) 68.31 ± 13.52 (N ¼ 61) 71.1 ± 11.92 (N ¼ 41) Height (cm) 159.69 ± 4.52 (N ¼ 61) 160.05 ± 4.84 (N ¼ 41) Gestational age at 32.38 ± 3.56 (N ¼ 52) 38.91 ± 1.08 (N ¼ 45) labor (wk) Age < 20 y (No 19/67 (28.36) 4/43 (9.30) with characteristic/ total no.) (%) Pregnancy history (No with characteristic/total no.) (%) parous or more 36/72 (50) 31/45 (68.89) Nulliparous 7/72 (9.72) 0/45 (0) Primigravida 29/72 (40.28) 14/45 (31.11) History of PTB 7/43 (16.28) 0/31 (0) excluding primigravida History of 16/43 (37.21) 2/31 (6.45) abortion excluding primigravida Menses vaginal 10/66 (15.15) 1/44 (2.27) bleeding Speculum examination (No with characteristic/total no.) (%) Vaginal pH 4.5 27/63 (42.8) 24/43 (55.81) Vaginal pH ¼ 23/63 (36.5) 18/43 (41.86) Vaginal pH > 13/63 (20.6) 1/43 (2.33) Whiff test positive 37/66 (56.06) 11/44 (25) p 0.1822 0.2869 0.7023 < 0.001 0.017 0.032 0.037 0.002 0.047 0.017 3.4.1 Identification of vaginal microorganisms N gonorrhoeae and M genitalium were not detectable; thus, they were not considered further The isolation of group B streptococci, C trachomatis and Ureaplasma was comparable between the two groups ( p > 0.05; Table 3) Vaginal infection with T vaginalis was significantly more common in the PTL group than in the TL group (49.21% vs 28.89, p < 0.05; Table 3) There was a two-fold increase in the risk of PTL in the group infected with T vaginalis compared with the noninfected group (OR ¼ 2.38, 95% CI ¼ 1.06e5.37, p < 0.05; Table 4) M hominis was significantly more detectable in the PTL group ( p < 0.05; Table 3) Except for coryneforms, the heavy vaginal growth of aerobic microorganisms was similar between the two groups ( p > 0.05; Table 3) Only coryneform heavy vaginal growth was significantly more common in the PTL group than in the control group ( p < 0.01; Table 3) There was a 20-fold increase in the risk of PTL in the group with heavy vaginal growth of coryneform compared with the group that did not show such growth (OR ¼ 20.64, 95% CI ¼ 1.19e356.58, p < 0.05; Table 4) 0.002 PTB ¼ preterm birth; PTL ¼ preterm labor; TL ¼ term labor Data are presented as mean ± SD Table Comparison of microbiological characteristics among preterm and term labor women 3.1 Pregnancy history Characteristic (No with characteristic/total no.) (%) The PTL group showed a significantly higher number of nulliparous women than the TL group (9.72% vs 0%, p < 0.05) This group also recorded significantly higher frequencies of both previous PTB and abortions, excluding primigravidas, than the TL group ( p > 0.05 vs p < 0.01), as indicated in Table Vaginal infection GBS positive Chlamydia trachomatis positive Ureaplasma positive Trichomonas vaginalis positive Mycoplasma hominis positive Gram-positive cocci a Coryneforms a,b Gram-negative bacilli a Candida a Lactobacilli a Growth of Gram-negative bacilli at any streak Growth of lactobacilli at any streak Urine bacterial count > 103 CFU/mL 103 to < 104 CFU/mL 104 to < 105 CFU/mL 105 CFU/mL 3.2 Medical complications Only menses vaginal bleeding during pregnancy was significantly more common in the PTL group than in the TL group (15.15% vs 2.27%, p < 0.05; Table 2) However, other tested medical complications were comparable between the two groups (data not shown) 3.3 Speculum examination The presence of vaginal discharge or other signs of infection, such as bleeding, erythema, eruptions, warts, ulcerations, or inguinal adenopathy, on speculum examination did not differ significantly between the two groups ( p > 0.05) (data not shown) A vaginal pH of > (very abnormal pH) was significantly more common in the PTL group than in the TL Total PTL cases TL (control) p 12/71 (16.9) 1/72 (1.39) 26/72 (36.11) 31/63 (49.21) 11/72 (15.28) 10/72 (13.89) 13/72 (18.06) 4/72 (5.56) 5/72(6.94) 35/72 (48.61) 43/72 (59.72) 4/45 (8.89) 1/45 (2.22) 22/45 (48.89) 13/45 (28.89) 1/45 (2.22) 7/45 (15.56) 0/45 (0) 1/45 (2.22) 5/45 (11.11) 19/39 (48.72) 17/45 (37.78) 0.277 > 0.99 0.183 0.047 0.028 > 0.99 0.002 0.648 0.5050 > 0.99 0.024 58/72 (80.56) 33/39 (84.62) 0.797 58/72 (80.56) 3/72 (4.17) 5/72 (6.94) 6/72 (8.33) 42/45 (93.34) 2/45 (4.44) 1/45 (2.22) 0/45 (0) 0.129 CFU ¼ colony forming unit; GBS ¼ group B Streptococci; PTL ¼ preterm labor; TL ¼ term labor a Presence of characteristic growth at the third or fourth streak b Coryneforms: Brevibacterium spp (group B) in nine cases, Arcanobacterium pyogenes, Acinetobacter calcoaceticus, and Corynebacterium minutissimum each in one case and a mixed Brevibacterium spp (group B) and Corynebacterium minutissimum in one case Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/ j.jcma.2016.10.007 + MODEL A.E.-D.M.S Hosny et al / Journal of the Chinese Medical Association xx (2017) 1e7 Table Calculated odds ratio for factors associated with preterm labor Infection N (total cases in TL and PTL groups) N with PTL Rate of PTL (%) OR (95% CI) Trichomonas vaginalis infection (ỵve) Trichomonas vaginalis infection (ve) Gram negative bacilli infection (ỵve) Gram negative bacilli infection (ve) Coryneforms heavy vaginal growth (ỵve) Coryneforms heavy vaginal growth (ve) 44 64 60 57 13 104 31 32 43 29 13 59 70.45 50.00 71.67 50.88 100 56.7 2.38 (1.06e5.37) Reference 2.4 (1.1e5.2) Reference 20.64 (1.19e356.58) Reference p 0.0468 0.02 0.037 OR ¼ odds ratio; CI ¼ confidence interval; PTL ¼ preterm labor; TL ¼ term labor When considering any vaginal growth of Gram-negative bacilli and not only heavy growth, this type of growth was significantly more common in the PTL group than in the TL group ( p < 0.05; Table 3) There was a two-fold increase in the risk of PTL when taking into consideration any vaginal Gram-negative bacilli infection compared with the group showing no such infection (OR ¼ 2.4, 95% CI ¼ 1.1e5.2, p < 0.05; Table 4) 3.4.2 Gram staining of vaginal smears There was no significant difference in the vaginal grade, the presence of clue cells, or BV diagnosed by the Amsel method between the PTL and TL groups (data not shown) 3.5 Urinary tract infection The urine samples colony count did not differ significantly between the two groups ( p ¼ 0.129; Table 3) All detected uropathogens were comparable among the two groups (data not shown) Discussion Several factors have been documented to be associated with PTL However, only a few of these factors were found to be associated with PTL in this study, which further highlighted their importance These factors included women aged < 20 years, as noted in other studies.4 A plausible biological explanation may be incomplete maternal physical growth and relative malnutrition.25 On the contrary, women aged > 35 years, associated with PTL in the same study,4 were not associated with PTL in this study This may be due to the small number of women in this age group who were included in the study (3 women in each of the TL and PTL group) or that the risk in this age group arose from the presence of chronic diseases where women with chronic diseases were excluded in our study.25 As recorded previously, there was an association between nulliparous women as well as previous preterm delivery or previous abortion and PTL.5,25 This may be due to the presence of complications during childbirth in nulliparous women, such as obstructed labor, or due to an increased risk of uterine infection during a prior abortion that can lead to PTB.25,26 Furthermore, in accordance with the results of earlier studies, intense vaginal bleeding (not spotting) was highly associated with PTL The association between vaginal bleeding and PTL may be due to the consequent thrombin production, which stimulates uterine contractions as well as proteolytic activity that can lead to PPROM In addition, this bleeding may be an indicator of infection or inflammation.27 As demonstrated in other studies, vaginal pH > was associated with PTL This may be due to the fact that elevated pH is a sign of inflammation or infection of the endometrium or amniotic fluid with subsequent PTL.28 Some studies have suggested an association between BV and PTL due to released proteolytic enzymes and elevated pH, which can increase the risk of BV by 10-fold.29 The detection of BV did not differ significantly between the two groups Similar results were reported by Discacciati et al30 and Verstraelen et al.31 However, several tested bacterial species were found to be associated with PTL namely T vaginalis, M hominis, and coryneform bacteria Furthermore, similar results were previously reported.31e33 Group B streptococci were suspected of being associated with PTL; however, this was not the case in our study as well as in some other studies.30e34 As only one chlamydial infection was detected in the PTL and TL groups, this study cannot be relied upon to help prove the association between PTL and chlamydial infection This study results also not support the claimed association between Ureaplasma urealyticum and PTL.35 On the contrary, this study recorded a higher prevalence of these species in the TL than in the PTL group, which may be due to the fact that 60% of healthy women carry U urealyticum in their urogenital tract.36 All heavy growing aerobic bacteria, except coryneforms, were not associated with PTL Gramnegative bacilli were associated with PTL when any growth (whether heavy or not) was used in statistical analysis This supports the claim that Gram-negative bacilli are important placental pathogens responsible for subclinical chorioamnionitis and PTB.33 Consistent with other studies, we found no significant association between Candida infection and PTL Also, lactobacilli, which are the predominating genus in vaginal microbiota and play an important role in maintaining the natural healthy balance of these organisms, were found to play a role in PTL risk Their absence was associated with PTL in some studies but not in this study and other studies.12,24 This may be attributed to other factors that have not been addressed in this study, such as the diversity of lactobacilli which affects pregnancy duration.37 Most studies recommend considering a urine culture with more than 105 CFU/mL as indicative of the presence of Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/ j.jcma.2016.10.007 + MODEL A.E.-D.M.S Hosny et al / Journal of the Chinese Medical Association xx (2017) 1e7 urinary tract infection in PTL women.38 In our study population, none of the tested urine culture count criteria was significantly associated with PTL, although a urine culture colony count of more than 105 CFU/mL was detectable only in the PTL group This may be due to the fact that low-count bacteriuria might be an early phase of urinary tract infection but not a true infection and due to the lower number detected of 105 CFU/mL in PTL group (8.33%).39 There were several limitations to this study First, it is a one-hospital study and therefore, may not reflect the true Egyptian population Second, screening for other infections associated with PTL, such as hepatitis B, HIV, and syphilis, were not conducted in our study.1 In conclusion, although several factors were considered as risk factors for PTL, only a few of them were significantly associated with PTL in this study Most of these factors could be attributed to suspected infection However, special attention should be given to nulliparous women, women showing signs of vaginal infection such as bleeding, and high vaginal pH Infection control during abortion or labor is required to avoid its adverse effect on subsequent pregnancies Therefore, it is recommended to detect and treat infections with T vaginalis, M hominis, Gram-negative bacilli, and coryneform bacteria to avoid their effect on pregnancy outcome in this population Larger studies on Egyptian women are needed to support our findings This study raises a question about other documented risk factors which were proved not to be associated with PTL in this study, such as infection with group B streptococci and U urealyticum These factors need to be reevaluated to determine if any other associated conditions and mechanisms are responsible for their previously recorded association with PTL rather than the infection itself References Cram LF, Zapata MI, Toy EC, Baker 3rd B Genitourinary infections and their association with preterm labor Am Fam Physician 2002;65:241e8 Al-Dabbagh SA, Al-Taee WY Risk factors for pre-term birth in Iraq: a case-control study BMC Pregnancy Childbirth 2006;6:13 Savitz DA, Kaufman JS, Dole N, Siega-Riz AM, Thorp Jr JM, Kaczor DT Poverty, education, race and pregnancy outcome Ethn Dis 2004;14:322e9 Ko YL, Wu YC, Chang PC Physical and social predictors for pre-term births and low birth weight infants in Taiwan J Nurs Res 2002;10:83e9 Ezechi OC, Makinde ON, Kalu BE, Nnatu SN Risk factors for preterm delivery in south western Nigeria J Obstet Gynaecol 2003;23:387e91 El-Shourbagy M, Abd-el-Maeboud K, Diab KM, el-Ghannam A, Nabegh L, Ammar S Genital Chlamydia trachomatis infection in Egyptian women: incidence among different clinical risk groups J Obstet Gynaecol Res 1996;22:467e72 Darwish A, Elnshar EM, Hamadeh SM, Makarem MH Treatment options for bacterial vaginosis in patients at high risk of preterm labor and premature rupture of membranes J Obstet Gynaecol Res 2007;33:781e7 Dimetry SR, El-Tokhy HM, Abdo NM, Ebrahim MA, Eissa M Urinary tract infection and adverse outcome of pregnancy J Egypt Public Health Assoc 2007;82:203e18 Buhimschi IA, Christner R, Buhimschi CS Proteomic biomarker analysis of amniotic fluid for identification of intra-amniotic inflammation BJOG 2005;112:173e81 10 Holst E, Goffeng AR, Andersch B Bacterial vaginosis and vaginal microorganisms in idiopathic premature labor and association with pregnancy outcome J Clin Microbiol 1994;32:176e86 11 Schrag S, Gorwitz R, Fultz-Butts K, Schuchat A Prevention of perinatal group B streptococcal disease Revised guidelines from CDC MMWR Recomm Rep 2002;51:1e22 12 Poch F, Levin D, Levin S, Dan M Modified thioglycolate medium: a simple and reliable means for detection of Trichomonas vaginalis J Clin Microbiol 1996;34:2630e1 13 Carey JC, Klebanoff MA Is a change in the vaginal flora associated with an increased risk of preterm birth? Am J Obstet Gynecol 2005;192: 1341e6 14 Mahony JB, Luinstra KE, Sellors JW, Jang D, Chernesky MA Confirmatory polymerase chain reaction testing for Chlamydia trachomatis in first-void urine from asymptomatic and symptomatic men J Clin Microbiol 1992;30:2241e5 15 Ho BS, Feng WG, Wong BK, Egglestone SI Polymerase chain reaction for the detection of Neisseria gonorrhoeae in clinical samples J Clin Pathol 1992;45:439e42 16 Yoshida T, Maeda S, Deguchi T, Miyazawa T, Ishiko H Rapid detection of Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma parvum, and Ureaplasma urealyticum organisms in genitourinary samples by PCRmicrotiter plate hybridization assay J Clin Microbiol 2003;41:1850e5 17 Jensen JS, Uldum SA, Søndergård-Andersen J, Vuust J, Lind K Polymerase chain reaction for detection of Mycoplasma genitalium in clinical samples J Clin Microbiol 1991;29:46e50 18 Blanchard A, Ya~nez A, Dybvig K, Watson HL, Griffiths G, Cassell GH Evaluation of intraspecies genetic variation within the 16S rRNA gene of Mycoplasma hominis and detection by polymerase chain reaction J Clin Microbiol 1993;31:1358e61 19 Fanrong K, James G, Zhenfang M, Gordon S, Wang B, Gilbert GL Phylogenetic analysis of Ureaplasma urealyticumesupport for the establishment of a new species, Ureaplasma parvum Int J Syst Bacteriol 1999; 49:1879e89 20 Hay PE, Lamont RF, Taylor-Robinson D, Morgan DJ, Ison C, Pearson J Abnormal bacterial colonisation of the genital tract and subsequent preterm delivery and late miscarriage BMJ 1994;308:295e8 21 Amsel R, Totten PA, Spiegel CA, Chen KC, Eschenbach D, Holmes KK Nonspecific vaginitis Diagnostic criteria and microbial and epidemiologic associations Am J Med 1983;74:14e22 22 Winn Jr WC, Allen SD, Janda WM, Koneman EW, Schreckenberger PC, Procop GW, et al Konemann's Color Atlas and textbook of diagnostic microbiology 6th ed Philadelphia: Lippincott Williams & Wilkins; 2006 23 Frimodt-Møller N, Espersen F Evaluation of calibrated and 10 microl loops and dipslide as compared to pipettes for detection of low count bacteriuria in vitro APMIS 2000;108:525e30 24 Semeniuk H, Church D Evaluation of the leukocyte esterase and nitrite urine dipstick screening tests for detection of bacteriuria in women with suspected uncomplicated urinary tract infections J Clin Microbiol 1999; 37:3051e2 25 Kozuki N, Lee AC, Silveira MF, Sania A, Vogel JP, Adair L, et al Child Health Epidemiology Reference Group (CHERG) Small-for-GestationalAge-Preterm Birth Working Group The associations of parity and maternal age with small-for-gestational-age, preterm, and neonatal and infant mortality: a meta-analysis BMC Public Health 2013;13:S2 26 Dragoman M, Sheldon WR, Qureshi Z, Blum J, Winikoff B, Ganatra B, WHO Multicountry Survey on Maternal Newborn Health Research Network Overview of abortion cases with severe maternal outcomes in the WHO Multicountry Survey on Maternal and Newborn Health: a descriptive analysis BJOG 2014;121:25e31 27 Yang J, Hartmann KE, Savitz DA, Herring AH, Dole N, Olshan AF, et al Vaginal bleeding during pregnancy and preterm birth Am J Epidemiol 2004;160:118e25 28 Simhan HN, Caritis SN, Krohn MA, Hillier SL Elevated vaginal pH and neutrophils are associated strongly with early spontaneous preterm birth Am J Obstet Gynecol 2003;189:1150e4 29 Jakovljevic A, Bogavac M, Nikolic A, Tosic MM, Novakovic Z, Stajic Z The influence of bacterial vaginosis on gestational week of the completion of delivery and biochemical markers of inflammation in the serum Vojnosanit Pregl 2014;71:931e5 Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/ j.jcma.2016.10.007 + MODEL A.E.-D.M.S Hosny et al / Journal of the Chinese Medical Association xx (2017) 1e7 30 Discacciati MG, Simoes JA, Silva MG, Marconi C, Brolazo E, Costa ML, et al Microbiological characteristics and inflammatory cytokines associated with preterm labor Arch Gynecol Obstet 2011;283:501e8 31 Verstraelen H, Verhelst R, Roelens K, Claeys G, Weyers S, De Backer E, et al Modified classification of Gram-stained vaginal smears to predict spontaneous preterm birth: a prospective cohort study Am J Obstet Gynecol 2007;196:528.e1e6 32 Mann JR, McDermott S, Gill T Sexually transmitted infection is associated with increased risk of preterm birth in South Carolina women insured by Medicaid J Matern Fetal Neonatal Med 2010;23: 563e8 33 Donders GG, Van Calsteren K, Bellen G, Reybrouck R, Van den Bosch T, Riphagen I, et al Predictive value for preterm birth of abnormal vaginal flora, bacterial vaginosis and aerobic vaginitis during the first trimester of pregnancy BJOG 2009;116:1315e24 34 Seyyed EZ, Toossi E, Jalalvand A, Sajadi M Group B streptococci investigation in pre-term labors Med Arh 2013;67:124e5 35 Vouga M, Greub G, Prod'hom G, Durussel C, Roth-Kleiner M, Vasilevsky S, et al Treatment of genital mycoplasma in colonized pregnant women in late pregnancy is associated with a lower rate of premature labor and neonatal complications Clin Microbiol Infect 2014;20:1074e9 36 Nassar FA, Abu-Elamreen FH, Shubair ME, Sharif FA Detection of Chlamydia trachomatis and Mycoplasma hominis, genitalium and Ureaplasma urealyticum by polymerase chain reaction in patients with sterile pyuria Adv Med Sci 2008;53:80e6 37 Petricevic L, Domig KJ, Nierscher FJ, Sandhofer MJ, Fidesser M, Krondorfer I, et al Characterisation of the vaginal Lactobacillus microbiota associated with preterm delivery Sci Rep 2014;4:5136 38 Jain V, Das V, Agarwal A, Pandey A Asymptomatic bacteriuria & obstetric outcome following treatment in early versus late pregnancy in north Indian women Indian J Med Res 2013;137:753e8 39 Kunin CM, White LV, Hua TH A reassessment of the importance of “lowcount” bacteriuria in young women with acute urinary symptoms Ann Intern Med 1993;119:454e60 Please cite this article in press as: Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas vaginalis, Mycoplasma hominis, Gram-negative bacilli, and coryneforms, Journal of the Chinese Medical Association (2017), http://dx.doi.org/10.1016/ j.jcma.2016.10.007 ... Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas vaginalis, Mycoplasma hominis, Gram- negative bacilli, and coryneforms, Journal... Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas vaginalis, Mycoplasma hominis, Gram- negative bacilli, and coryneforms, Journal... Hosny AE-DMS, et al., Association between preterm labor and genitourinary tract infections caused by Trichomonas vaginalis, Mycoplasma hominis, Gram- negative bacilli, and coryneforms, Journal