A Fully Synthetic Transcriptional Platform for a Multicellular Eukaryote Resource A Fully Synthetic Transcri ptional Platform for a Multicellular Eukaryote Graphical Abstract Highlights d A fully synt[.]
Resource A Fully Synthetic Transcriptional Platform for a Multicellular Eukaryote Graphical Abstract Authors Justin Crocker, Albert Tsai, David L Stern Correspondence crockerj@janelia.hhmi.org In Brief Crocker et al build a fully synthetic transcriptional platform in Drosophila consisting of engineered transcription factor gradients and artificial enhancers This synthetic platform confirms the need for pioneer factors to establish an active state and shows how overlapping activator and repressor binding sites can provide sharp expression boundaries Highlights d A fully synthetic transcriptional platform of engineered factors is created d The pioneer factor Zelda is required to open chromatin at synthetic enhancers d Synthetic enhancers encode transcription levels based on the number of binding sites d Overlapping activator and repressor binding sites provide sharp expression boundaries Crocker et al., 2017, Cell Reports 18, 287–296 January 3, 2017 ª 2017 The Author(s) http://dx.doi.org/10.1016/j.celrep.2016.12.025 Cell Reports Resource A Fully Synthetic Transcriptional Platform for a Multicellular Eukaryote Justin Crocker,1,2,* Albert Tsai,1 and David L Stern1 1Janelia Research Campus, Howard Hughes Medical Institute, 19700 Helix Drive, Ashburn, VA 20147, USA Contact *Correspondence: crockerj@janelia.hhmi.org http://dx.doi.org/10.1016/j.celrep.2016.12.025 2Lead SUMMARY Regions of genomic DNA called enhancers encode binding sites for transcription factor proteins Binding of activators and repressors increase and reduce transcription, respectively, but it is not understood how combinations of activators and repressors generate precise patterns of transcription during development Here, we explore this problem using a fully synthetic transcriptional platform in Drosophila consisting of engineered transcription factor gradients and artificial enhancers We found that binding sites for a transcription factor that makes DNA accessible are required together with binding sites for transcriptional activators to produce a functional enhancer Only in this context can changes in the number of activator binding sites mediate quantitative control of transcription Using an engineered transcriptional repressor gradient, we demonstrate that overlapping repressor and activator binding sites provide more robust repression and sharper expression boundaries than non-overlapping sites This may explain why this common motif is observed in many developmental enhancers INTRODUCTION Transcriptional enhancers in multicellular animals have been studied for about four decades, but we still have mainly a qualitative understanding of how they function In brief, combinations of activating and repressing transcription factors act upon enhancers to drive specific patterns of expression (Stampfel et al., 2015) Natural enhancers have been studied experimentally usually by deleting individual transcription factor binding sites These studies have therefore revealed specific sites required for proper enhancer function, but they have not necessarily identified all DNA sites that are sufficient to generate a functional enhancer Similarly, genome-wide studies of the occupancy of transcription factors on DNA regions have provided correlational evidence for the role of transcription factors in enhancer function, but only for factors that were examined explicitly Additionally, many transcription factor binding sites, as determined by occupancy assays, are not functional (Li et al., 2008) It would be useful to be able to test synthetic assemblages of transcription factor binding sites However, although artificially concatenated arrays of activator binding sites typically drive expression, they not always recapitulate the activators’ native expression domains (Erceg et al., 2014) The construction of a synthetic system would allow comprehensive tests of alternative models of enhancer function, elucidating how specific DNA motifs and binding site architectures influence enhancer function Indeed, one useful test of whether a biological phenomenon is understood is to build a working model of the system However, attempts to build synthetic enhancers using binding sites for activators and repressors have largely failed (Johnson et al., 2008; Vincent et al., 2016) Here, we report a fully synthetic enhancer platform for the Drosophila blastoderm embryo and demonstrate the utility of this system RESULTS Construction of a Synthetic Enhancer Platform We reasoned that use of an exogenous transcription factor would allow study of the principles of enhancer architecture independently of the regulatory network that operates naturally in the Drosophila embryo We therefore first engineered a gradient of transcription-activator like protein (TALEs) fused to a VP16 activator (Crocker and Stern, 2013) (TALEA) (Figure 1A) The gradient of TALEA protein was generated by driving TALEA expression with the hunchback promoter (Perry et al., 2010; Treisman and Desplan, 1989) (hb-TALEA), resulting in a smooth anterior-to-posterior RNA gradient (Figures 1C and 1D) The binding site for this TALEA, 50 -CCGGATGCTCCTCTT, is not present in the Drosophila genome and allowed construction of enhancers that would respond only to the TALEA (Figure 1B) Use of TALEs allows greater flexibility in the design of future experiments than other heterologous transcription factors, such as Gal4 and LexA, that are often used in Drosophila experiments, because TALEs with different DNA binding specificities can be generated easily We synthesized a 252-bp DNA sequence that is transcriptionally silent in the early Drosophila embryo by starting with a random DNA sequence and systematically altering any motifs that resembled binding sites for known factors active in the early embryo This sequence did not drive detectable expression in the blastoderm embryo (Figures 1E and 1F) The TALEA protein Cell Reports 18, 287–296, January 3, 2017 ª 2017 The Author(s) 287 This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/) A B C D E F G H gradient and silent enhancer are the foundational components of a synthetic regulatory network operating in parallel to the endogenous developmental networks The Synthetic Enhancer System Confirms the Role of Zelda as a Pioneer Factor To test the ability of the TALEA to drive expression on its own, we introduced one, two, or three TALEA binding sites into the silent enhancer (Figure 1B) None of these enhancers drove detectable expression (Figures 1G and 1H) This was surprising, because introduction of the same three TALEA binding sites into a native enhancer drives strong ectopic expression (Figures S1C and S1D) This result indicated that additional regulatory information, other than the TALEA binding sites, is required for enhancer activity One candidate for this additional input in the early Drosophila embryo is the sequence-specific transcription factor protein Zelda In Drosophila, Zelda is expressed ubiquitously just before most genes begin to be expressed in the blastoderm embryo and Zelda protein binds to many enhancers that are required to drive gene transcription in the early blastoderm embryo (Foo et al., 2014; Harrison et al., 2011; Li et al., 2014; Liang et al., 2008; Nien et al., 2011; Xu et al., 2014) Zelda activity is corre- 288 Cell Reports 18, 287–296, January 3, 2017 Figure Construction of a Synthetic Activation Gradient and a Silent Enhancer Illustrates That TALEA Binding Sites Alone Are Insufficient to Drive Expression (A) Schematic representation of the approach used to build a TALEA gradient using the hunchback (hb) promoter (B) Schematic of synthetic enhancers built to detect the TALEA gradient (C, E, and G) Stage embryos stained for the TALEA gradient (C) or for lacZ enhancer driven RNA expression for the indicated number of TALEA binding sites (E and G) The scale bar in (C) represents 100 mm (D, F, and H) Profiles of average expression levels across the region indicated by the bounding box in (C) for the indicated genotype (n = 10 for each genotype) In this and subsequent figures, the bounding areas around experimental data indicate SD AU indicates arbitrary units (a.u.’s) of fluorescence intensity lated with chromatin accessibility (Foo et al., 2014; Schulz et al., 2015; Sun et al., 2015), and Zelda appears to make enhancers accessible to transcription factors that drive specific patterns of gene expression (Foo et al., 2014; Li et al., 2014; Schulz et al., 2015; Xu et al., 2014) In particular, Xu et al (2014) have demonstrated that Zelda binding sites enhance Bicoid binding and can convert silent enhancers containing Bicoid sites into Bicoid-responsive enhancers To test the hypothesis that Zelda is the missing element in our silent enhancers, we introduced a variable number of TALEA binding sites and a constant number of Zelda binding sites into the silent enhancer backbone (Figures 2A and 2B) We observed no activity from an enhancer with five Zelda sites in embryos not expressing the TALEA, indicating that Zelda sites alone are not sufficient to drive expression (Figures 2C and 2D) However, a single TALEA binding site together with five Zelda sites drove low levels of RNA expression in the anterior region of early embryos (Figures 2E– 2H) Levels of expression were independent of the TALEA binding site location (compare Figures 2E and 2F with Figures 2G and 2H) Adding a second TALEA binding site increased the levels of expression in the anterior region (Figures 2I–2L) and activity remained independent of the location of the TALEA binding site within the 252-bp sequence These results suggest that the precise arrangement of binding sites is not important for this engineered system, consistent with results from studies of many native enhancers (Arnosti and Kulkarni, 2005; Brown et al., 2007; Hare et al., 2008; Ilsley et al., 2013; Jin et al., 2013; Lusk and Eisen, 2010; Menoret et al., 2013; Rastegar et al., 2008) (compare Figures 2I and 2J with Figures 2K and 2L) Adding a third TALEA binding site further increased the levels of expression We found that the levels of expression driven by the synthetic enhancer platform are similar to native gene expression A B C D E F G H I J K L M N Figure Zelda Binding Sites Allow TALEA Binding Sites to Provide Quantitative Control of Gene Expression (A) Expression patterns of the TALEA and of Zelda (B) Schematic of synthetic enhancers used to test the effect of systematically modifying the number of TALEA binding sites with five Zelda binding sites (C, E, G, I, K, and M) Stage embryos stained for lacZ expression for enhancers with the indicated number of TALEA and Zelda binding sites (D, F, H, J, L, and N) Profiles of average expression levels across the bounding box of Figure 1C for the indicated genotype (n = 10 for each genotype) (E–N) Enhancers with one (E–H), two (I–L), or three (M and N) TALEA binding sites Cell Reports 18, 287–296, January 3, 2017 289 (Figure S2) and that the synthetic enhancer can generate precise patterns of mRNA and protein expression (Figure S2) We performed a series of control experiments to confirm that the patterns of reporter gene expression resulted from binding of the TALEA to the synthetic enhancer First, to test whether expression required the TALEA gradient, we constructed an alternative TALEA with a different binding sequence, 50 -AAGTTGTGGTTTGTCT, driven by the Hb-promoter This new TALEA drove expression from a new 252-bp sequence containing binding sites for this alternative activator in a pattern similar to the original TALEA (Figure S3) Second, to test whether expression from the synthetic enhancer resulted from binding of unknown transcription factors to the ‘‘silent’’ DNA sequence, we constructed an independent 252-bp silent DNA sequence both with and without TALEA binding sites We found that these new sequences drove expression that was quantitatively equivalent to the original sequences (Figure S3), suggesting that the expression patterns we observed result from binding of the synthetic transcription factors Taken together, these results indicate that Zelda binding is required to enable an enhancer to respond quantitatively to a variable number of binding sites for an activator transcription factor in the early embryo Our synthetic enhancers therefore behave like native enhancers that contain different numbers of binding sites (Driever et al., 1989; Gaudet and Mango, 2002; Stathopoulos et al., 2002) To further test whether Zelda acts by making enhancers accessible to patterning transcription factors, as has been suggested by several previous studies (Foo et al., 2014; Li et al., 2014; Schulz et al., 2015; Xu et al., 2014), we systematically varied the number of Zelda motifs in synthetic enhancers containing three TALEA binding sites (33 TALEA) (Figures 3A and 3B) In embryos expressing the TALEA gradient, we did not detect any notable expression from enhancers containing one or two Zelda motifs (Figures 3C and 3D) However, enhancers containing three to five Zelda sites drove increased mRNA expression in a subset of cells in the anterior of the embryo, and the number of nuclei showing expression was correlated with the number of Zelda sites (Figures 3E–3J) To rule out the effect of position effects on the synthetic enhancers, we integrated the synthetic enhancers into two additional sites in the genome We found that, in each case, a minimum of three Zelda binding sites was required for expression (Figure S3) To test whether this pattern reflected stochastic transcription that is activated in different subsets of cells over time (Bothma et al., 2014; Chubb et al., 2006; Golding et al., 2005; Raj et al., 2006), we also examined patterns of expression for the proteins encoded by the reporter gene mRNA products, because the protein products perdure for much longer than the mRNA products (Figure S4) If transcription was temporally stochastic, then we would have expected more cells to express protein than mRNA Instead, we observed very similar patterns of mRNA and protein expression, indicating that a subset of cells activated gene transcription from the synthetic enhancers and that these enhancers remained ‘‘on’’ for an extended time Therefore, Zelda sites not trigger transient stochastic expression, but instead mark enhancers in a subset of nuclei as available for binding of activator transcription factors 290 Cell Reports 18, 287–296, January 3, 2017 These results are consistent with the hypothesis that Zelda marks enhancers as available for regulation and that other transcription factors control expression levels (Foo et al., 2014; Li et al., 2014; Schulz et al., 2015; Xu et al., 2014) To test this hypothesis, we segmented images to determine expression levels in each nucleus independently (Figure S5) In enhancers containing variable numbers of Zelda sites, we found that the levels of expression within each active nucleus are not different across enhancers, on average (Figures 3K and S5; ANOVA, F(2,9) = 1.76, p > 0.20) In contrast, increasing the number of TALEA sites in synthetic enhancers increased levels of expression within active nuclei (Figures 3M and S5; ANOVA, F(2,9) = 6.01, p < 0.02) Therefore, the number of Zelda sites alters the probability of transcription, whereas TALEA binding sites modulate the amplitude of expression The simplest proposed mechanism for Zelda activity is that Zelda makes DNA accessible to other transcription factors by displacing nucleosomes (Foo et al., 2014) We found that increasing the number of Zelda sites in synthetic enhancers increased DNA accessibility, as measured by DNase I digestion, even in the absence of TALEA expression (ANOVA, F(3,16) = 21.86, p < 0.001) (Figure 3L) In contrast, increasing the number of TALEA binding sites in the context of a constant number of Zelda binding sites did not significantly alter DNA accessibility (ANOVA, F(3,12) = 1.65, p > 0.20) (Figure 3N) These results agree with observations of native Drosophila enhancers (Foo et al., 2014) and confirm that binding of Zelda to enhancers increases local chromatin accessibility (Barozzi et al., 2014; Cirillo et al., 2002; Foo et al., 2014; Li et al., 2014; Schulz et al., 2015; Sherwood et al., 2014; Xu et al., 2014) (Figure 3O) Together, these results support the hypothesis that, in the blastoderm embryo, the regulatory state of an enhancer, ON versus OFF, is determined by Zelda binding and can be decoupled from the patterns and levels of expression driven by an enhancer (Figure 3O) Overlapping Activator and Repressor Binding Sites Provide Sharper Boundaries Than Non-overlapping Sites With this confirmation of the utility of our synthetic enhancer system for testing models of transcription factor function in enhancers, we next examined a classical problem in developmental biology, the use of broadly distributed gradients of transcription factors to produce sharp boundaries of gene expres€sslein-Volhard, 1988; Turing, 1990; sion (Driever and Nu Wolpert, 1969) The mechanisms that generate precise patterns of gene expression are not fully understood (Lagha et al., 2012; Little et al., 2013), and some authors have proposed that binding site competition, whereby activators and repressors compete to bind to the same DNA sites, might produce sharp boundaries of gene expression (Rushlow et al., 2001; Saller and Bienz, 2001; Small et al., 1991; Stanojevic et al., 1991) Consistent with this hypothesis, overlapping activator and repressor binding sites are a common feature in transcriptional enhancers (Cheng et al., 2013; Makeev et al., 2003; Papatsenko et al., 2009; Stanojevic et al., 1991) However, there have been no experimental tests of this hypothesis in embryos (Payankaulam et al., 2010) Our synthetic enhancer provides an ideal platform for testing this hypothesis Figure Increasing the Number of ZELDA Sites Increases the Probability That an Enhancer Will Be Active in a Cell B A C D 0X Zelda Sites+3X TALEA Sites 1X Zelda Sites+3X TALEA Sites 2X Zelda Sites+3X TALEA Sites E F 3X Zelda Sites+3X TALEA Sites G H 4X Zelda Sites+3X TALEA Sites I J 5X Zelda Sites+3X TALEA Sites K O L M (A) Expression of the synthetic TALEA and Zelda (B) Schematic of synthetic enhancers used to test the effect of varying the number of Zelda binding sites (C and D) Enhancers with zero, one, or two Zelda binding (C, E, G, and I) Stage embryos stained for lacZ expression from enhancers with the indicated number of Zelda binding sites (E–J) Enhancers with three (E and F), four (G and H), or five (I and J) Zelda binding sites (D, F, H, J, L, and N) Profiles of average expression levels across the region indicated in the bounding box of Figure 1E for the indicated genotype (n = 10 for each genotype) (K) Cell-by-cell quantification of the staining intensities in all cells displaying expression for enhancers with the indicated number of Zelda binding sites, each with three TALEA binding sites Mean and median are shown as black crosses and green squares, respectively (L) The effect of the number of Zelda binding sites on DNase I sensitivity, each with three TALEA binding sites N = samples of embryos per genotype (M) Cell-by-cell quantification of the staining intensities in cells displaying expression for enhancers with the indicated number of TALEA binding sites, each with five Zelda binding sites (N) The effect of the number of TALEA binding sites on DNase I sensitivity, each with five Zelda binding sites N = samples of embryos per genotype (O) Heuristic model of the synthetic enhancer activity Zelda opens chromatin and allows binding by transcription factors that modulate expression amplitude N Cell Reports 18, 287–296, January 3, 2017 291 A Figure Transcription Factor Competition Provides Precision in Animal Development B D C E F G H I J K L To test the role of overlapping activator and repressor binding sites, we first generated orthogonal gradients of an activator and a repressor We started with the anterior-posterior gradient of 292 Cell Reports 18, 287–296, January 3, 2017 (A) Expression patterns of the TALEA, and TALER (B) Schematic of synthetic enhancers used to test the effect of tandem versus overlapping activator and repressor binding sites (C) Stage embryos stained for the TALER gradient Embryo is oriented with the ventral surface facing up (D) Profiles of average expression levels across the region indicated by the bounding box in panel (C) AU indicates a.u.’s of fluorescence intensity, ‘‘V’’ indicates ventral, and ‘‘D’’ indicates dorsal (E–G) Ventral views of stage embryos, stained for lacZ expression for enhancers with the indicated TALEA and TALER arrangement Each construct contains five Zelda binding sites Enhancers contain only TALEA sites (E), overlapping TALEA/ TALER binding sites (F), or tandem TALEA/TALER binding sites (G) (H–J) Models of the expression profiles of embryos with the indicated TALEA and TALER arrangement Models containing only TALEA sites (H), overlapping TALEA/TALER binding sites (I), or tandem TALEA/TALER binding sites (J) (K) Profiles of average expression levels across the bounding box of Figure 4F for the indicated genotype (n = 10 for each genotype), compared to the model outputs (L) Schematic of the model outputs, comparing the overlapping and tandem modes of repression AU indicates a.u.’s of fluorescence intensity, ‘‘V’’ indicates ventral, and ‘‘D’’ indicates dorsal the TALEA described above and added an orthogonal ventral-dorsal gradient of a TALE fused to a Hairy repression domain (TALER) (Figure 4A) The TALER protein gradient was generated by driving TALER expression with the snail promoter (Ip et al., 1992) (sna-TALER) This results in a smooth ventral-dorsal gradient (Figures 4C and 4D) We then created two synthetic enhancers, one with three activator and three repressor binding sites in an alternating tandem array and one where activator and repressor sites shared exactly the same three binding sites (Figure 4B) For the enhancer with tandem binding sites, the TALER targeted the sequence 50 -AAGTTGTGGTTTGTCT For the enhancer with overlapping sites, the TALER and TALEA both targeted the sequence 50 -CCGGATGCTCCTCTT To test for potential differential affinity of the two binding sites, we targeted these two sites separately with a TALEA and found that they drove indistinguishable patterns of expression (Figure S3) Therefore, the two binding sites arranged in a tandem array appear to have similar affinity for the TALEs and therefore provide a useful comparison with the enhancer containing overlapping binding sites We observed that both the tandem and overlapping enhancers generated repression of reporter gene expression in the region in which the TALER was expressed (Figures 4E–4G) However, the enhancer with overlapping sites generated stronger reduction in reporter gene expression at the highest levels of TALER expression and a steeper transition from high to low levels of expression along the TALER gradient, compared with the enhancer containing tandem binding sites (Figures 4F and 4G) To clarify the mechanisms that may be acting to generate these differences between the two enhancers, we constructed simple steady-state models of activators and repressors binding to enhancers with either tandem arrays or overlapping binding sites (Figures 4H–4L and S6) We assumed that activators and repressors compete to bind to overlapping binding sites The model of overlapping binding sites predicts a similar pattern of reporter gene expression as we observed empirically, with an early and sharp reduction in reporter gene expression across the repressor gradient and a strong reduction in reporter gene expression at the highest levels of repressor concentration (Figures 4F and 4I) Notably, in real embryos, reporter gene expression in the region of highest repression was indistinguishable from background (Figure 4F) This indicates that there is virtually no binding of activators to this enhancer at the highest repressor concentrations This observation agrees with the model, which predicts that when repressors entirely outcompete activators, the reporter gene expression should drop to background levels (Figures 4K and 4L) To explore the results for the tandem enhancer, we built a series of models in which activators and repressors can enhance or inhibit activity of factors bound at neighboring sites through various mechanisms (Figure S6) We fixed the apparent affinities of the activator and repressor using the experimental results from the enhancer containing overlapping binding sites The apparent affinities account for differences in the absolute concentrations between the factors and any additional interactions that may affect their binding and transcriptional activity All models make the same qualitative prediction that the enhancer should display incomplete repression in the region of highest repressor concentration (Figure S6), because in all models activator proteins remain bound to the enhancer This pattern is consistent with our experimental observations (Figures 4K and 4L) An additional salient experimental result was most consistent with one of the models of tandem sites We observed that the enhancer with tandem binding sites displayed the first signs of reduced expression at higher repressor concentrations than the enhancer with overlapping sites (e.g., approximately at 15% of ventral/dorsal axis) and that the slope of the reduction in expression across the repressor gradient was more shallow than the slope for the enhancer with overlapping sites (Figures 4K and 4L) These two results were most consistent with a model where repressors bound to sites flanking an activator site prevented binding of, or suppressed activity of, the TALEA at the intervening activator binding site (Figures 4K and 4L) The neighboring sites in our tandem arrays should be separated sufficiently to prevent direct competition We therefore hypothesize that the repression domain on the TALER is responsible for this novel activity The mechanism underlying this repressor activity remains to be investigated Additionally, our model required a much higher apparent affinity for the repressor than for the activator to achieve complete transcriptional shutdown with overlapping binding sites This may reflect a real activity difference between the activation and repression domains we used It will be valuable to learn the mechanism of this repressor-activator interaction because tandem activator and repressor binding sites are observed in many native enhancers (Fakhouri et al., 2010; Gray and Levine, 1996; Payankaulam et al., 2010; Small et al., 1991) DISCUSSION Disentangling regulatory networks in multicellular eukaryotic development has proven challenging because native enhancers usually contain activator and repressor binding sites for multiple factors that each exert nuanced, context-dependent control of enhancer activity (Crocker et al., 2008) Drawing from our experience exploring the activity of engineering TALEs in developing embryos (Crocker and Stern, 2013; Crocker et al., 2016) and dissecting native enhancer elements (Crocker et al., 2015), we have constructed a simple yet functional synthetic enhancer platform in Drosophila blastoderm embryos We have thus extended techniques from cellular synthetic biology (Amit et al., 2011; Atkinson et al., 2003; Basu et al., 2005; Elowitz and Leibler, 2000; Endy, 2005; Friedland et al., 2009; Garcia and Phillips, 2011; Gardner et al., 2000; Mukherji and van Oudenaarden, 2009) to organismal systems Our system provides clean tests of hypotheses of regulatory function, as we demonstrate for the function of Zelda and the role of overlapping binding sites (Driever et al., 1989; Gaudet and Mango, 2002; Stathopoulos et al., 2002) In particular, our results comparing overlapping with tandem arrays of repressor and activator binding sites show how overlapping binding sites can create well-defined expression boundaries during development The specific design of our engineered enhancer raises several caveats First, previous studies suggest that enhancers rarely contain three or more Zelda binding sites (Xu et al., 2014) Second, some enhancers clearly not require Zelda activity For example, the binary UAS-Gal4 expression system drives high levels of expression in Drosophila melanogaster, and these constructs not contain Zelda binding sites One explanation for our results is that TALE proteins bind poorly to nucleosomal DNA Indeed, GAL4 can bind to nucleosomal templates, and different transcription factors vary in their ability to bind to nucleosomal templates (Taylor et al., 1991) This variability may be important to the function of different transcription factors, and our engineered system provides a novel platform for examining these phenomena in vivo Finally, we used strong activation and repression domains to test our engineered system It is possible that DNA accessibility plays a more important role for our assays than during native developmental gene expression It will be possible to use this system to test different activation and repression domains and their context-dependent activity on transcription (Stampfel et al., 2015) Our synthetic system will allow deeper investigation into how different combinations of protein domains contribute to Cell Reports 18, 287–296, January 3, 2017 293 enhancer activity than is possible using native enhancers alone It is possible to imagine extending this system to build more sophisticated synthetic regulatory systems that could be engineered to test the roles of specific features of regulatory architecture during development EXPERIMENTAL PROCEDURES Construction of TALE Plasmids TALE constructs were based on the VP64 TALEA construct (Crocker and Stern, 2013) and were assembled using the Golden Gate method (Cermak et al., 2011) The TALE binding domain was previously characterized in a plant system for use as a TALEN (Christian et al., 2013) TALE expression was driven directly by the hb-promoter (Perry et al., 2010) (see the construct sequences in Supplemental Experimental Procedures), which replaced the UAS-binding sites in the original TALEA construct (Crocker and Stern, 2013) via the HindIII (6,489)/BglII (7,254) restriction enzyme sites Construction of Synthetic Enhancers We made an enhancer that would not respond to any known factors active in the early Drosophila embryo by starting with a 252-bp stretch of random DNA sequence with a GC content of 43%, to match the GC content of the D melanogaster genome, and systematically mutagenizing any sequences that resembled binding sites for known factors based on the TRANSFAC database (Matys et al., 2003) Enhancer sequences were subcloned into placZattB (Crocker et al., 2015) Fly Strains and Crosses D melanogaster strains were maintained under standard laboratory conditions Transgenic TALE constructs were created by Rainbow Transgenic Flies and were integrated at the attP2 landing site Embryo Manipulations Embryos were raised at 25 C and fixed and stained according to standard protocols Briefly, anti-DIG RNA probes were used against lacZ Antibody staining was subsequently carried out against the DIG-antigen, according to standard procedures LacZ protein was detected using an anti-b-Gal antibody (1:1000; Promega) Detection of primary antibodies was done using secondary antibodies labeled with Alexa Fluor dyes (1:500; Invitrogen) Synthetic Enhancer, 50 - CGGATGCTCCTCTTTTCCCA; Synthetic Enhancer, 30 - [T7]ggGGTTCCCCAGCAGCTTAACT; Neg Enhancer, 50 - TGCCTAGCCATAGAGAGCCA; Neg Enhancer, 30 - [T7]ggCTGGCTGATTGCAAAACCCC Each set of 30 -primers contained a T7 promoter, 50 -GAAATTAATACGACT CACTATA Samples were subjected to six rounds of amplification The PCR products were cleaned with a QIAGEN PCR purification and were then added to a MEGAshortscript T7 Transcription kit (Thermo Fisher Scientific) for a 12-hr linear DNA amplification (Shankaranarayanan et al., 2011) The resulting RNA products were run on a denaturing gel, and the fluorescence intensity was quantified Fluorescence values were normalized and DNase I hypersensitivity values were calculated as described previously (Foo et al., 2014) Enhancer Modeling Total transcription output of the synthetic enhancer was modeled assuming that the system is in steady state For overlapping binding sites available to an activator or a repressor, transcriptional repression occurs because binding of a repressor prevents an activator from accessing the same site In this case, each binding site introduces the following term: + KA A + KR R: The elements in the term describe the relative probabilities that the site is, respectively, unbound (1), bound by an activator (KA A), or bound by a repressor (KR R) A and R are the relative concentrations of the activator and repressor normalized so that the maximum concentration is KA and KR are the apparent affinities of the activator and the repressor to the site and include all molecular mechanisms that influence activity, including DNA affinity Note that, because the concentrations of the activator and repressor are relative, the apparent binding affinities also include adjustments for their absolute concentrations and any additional interactions that may modify the activity of either factor With three overlapping binding sites, the population with no activator bound is the following: PO;0 ðA; RÞ = + KR R + KR2 R2 + KR3 R3 : The population with one activator bound is the following: PO;1 ðA; RÞ = + KR R + KR2 R2 KA A: The population with two activators bound is the following: PO;2 ðA; RÞ = ð3 + KR RÞKA2 A2 : Microscopy Each series of experiments to measure transcript levels was performed entirely in parallel Embryo collections, fixations, and hybridizations, and image acquisition and processing were performed side-by-side in identical conditions Confocal exposures were identical for each series and were set to not exceed the 255 maximum level Series of images were acquired over a 1-day time frame, to minimize any signal loss or aberration Confocal images were obtained on a Leica DM5500 Q Microscope with an ACS APO 203/ 0.60 IMM CORR lens and Leica Microsystems LAS AP software Sum projections of confocal stacks were assembled, embryos were scaled to match sizes, background was subtracted using a 50-pixel rolling-ball radius, and plot profiles of fluorescence intensity were analyzed using ImageJ software (https://imagej.nih.gov/ij/) Data from the plot profiles were further analyzed in MATLAB Expression levels of the nuclei in Figure were obtained by segmenting the nuclei based on DAPI expression and measuring the average level of expression within each nucleus The expression levels were then further analyzed in MATLAB DNase I Sensitivity DNase I digestion was performed on 1.5- to 3-hr-old embryos as described previously (Foo et al., 2014; Thomas et al., 2011), with some modifications Four biological replicates were performed for each DNase I digestion experiment PCR experiments were performed on the isolated nuclei with primers for the synthetic enhancer and control regions with the following set of common synthetic and negative control (Neg) primers: 294 Cell Reports 18, 287–296, January 3, 2017 Finally, the population with three activators bound is the following: PO;3 ðA; RÞ = KA3 A3 : Note that the sum of all populations is the following: PO;0 ðA; RÞ + PO;1 ðA; RÞ + PO;2 ðA; RÞ + PO;3 ðA; RÞ = ð1 + KA A + KR RÞ3 : Assuming that each activator additively contributes one unit of transcriptional activity and that the maximum transcriptional output is 3, the total transcriptional output is the following: Tsxoverlap ðA; RÞ = PO;1 ðA; RÞ + PO;2 ðA; RÞ + PO;3 ðA; RÞ : PO;0 ðA; RÞ + PO;1 ðA; RÞ + PO;2 ðA; RÞ + PO;3 ðA; RÞ With separate binding sites for activators and repressors, the sum of the relative probabilities of activator site being unbound or bound are described by the following: + KA A: The sum of the relative probabilities of a repressor site being unbound or bound are the following: + KR R: With six total alternating activator and repressor sites in tandem, the model that best describes the experimental results assumes that having two bound repressor sites flanking an activator site precludes the activator site in question from functioning After removing configurations prohibited by the above rule, the relative populations for no activator bound is the following: PT;0 ðA; RÞ = + KR R + KR2 R2 + KR3 R3 : The term for one activator bound is the following: PT;1 ðA; RÞ = + KR R + KR2 R2 + KR3 R3 KA A: The term for two activators bound is the following: PT;2 ðA; RÞ = + KR R + KR2 R2 KA2 A2 ; The term for three activators bound is the following: PT;3 ðA; RÞ = + KR R + KR2 R2 KA2 A3 : The total transcriptional output is the following: PT;1 ðA; RÞ + PT;2 ðA; RÞ + PT;3 ðA; RÞ Tsxtandem ðA; RÞ = : PT;0 ðA; RÞ + PT;1 ðA; RÞ + PT;2 ðA; RÞ + PT;3 ðA; RÞ The panels in Figures 4H–4J were generated using Mathematica (Wolfram) with the following parameters: KA = and KR = 500 SUPPLEMENTAL INFORMATION Supplemental Information includes Supplemental Experimental Procedures and six figures and can be found with this article online at http://dx.doi.org/ 10.1016/j.celrep.2016.12.025 AUTHOR CONTRIBUTIONS J.C conceived of, designed, and executed the experiments and analyzed the data, with mentorship of D.L.S A.T led the modeling analyses J.C., A.T., and D.L.S wrote the manuscript ACKNOWLEDGMENTS We thank T Shirangi for critical insight into the experimental results; Colby Starker and Daniel Voytas for kindly providing the TALE binding domain; G Ilsley, R Mann, and E Preger-Ben Noon for valuable discussions; and several anonymous reviewers for helpful comments A.T is a Damon Runyon Fellow supported by the Damon Runyon Cancer Research Foundation (DRG2220-15) Received: November 9, 2015 Revised: December 14, 2015 Accepted: December 7, 2016 Published: January 3, 2017 REFERENCES Amit, R., Garcia, H.G., Phillips, R., and Fraser, S.E (2011) Building enhancers from the ground up: a synthetic biology approach Cell 146, 105–118 Arnosti, D.N., and Kulkarni, M.M (2005) Transcriptional enhancers: intelligent enhanceosomes or flexible billboards? J Cell Biochem 94, 890–898 Atkinson, M.R., Savageau, M.A., Myers, J.T., and Ninfa, A.J (2003) Development of genetic circuitry exhibiting toggle switch or oscillatory behavior in Escherichia coli Cell 113, 597–607 Barozzi, I., Simonatto, M., Bonifacio, S., Yang, L., Rohs, R., Ghisletti, S., and Natoli, G (2014) Coregulation of transcription factor binding and nucleosome occupancy through DNA features of mammalian enhancers Mol Cell 54, 844–857 Basu, S., Gerchman, Y., Collins, C.H., Arnold, F.H., and Weiss, R (2005) A synthetic multicellular system for programmed pattern formation Nature 434, 1130–1134 Bothma, J.P., Garcia, H.G., Esposito, E., Schlissel, G., Gregor, T., and Levine, M (2014) Dynamic regulation of eve stripe expression reveals transcriptional bursts in living Drosophila embryos Proc Natl Acad Sci USA 111, 10598– 10603 Brown, C.D., Johnson, D.S., and Sidow, A (2007) Functional architecture and evolution of transcriptional elements that drive gene coexpression Science 317, 1557–1560 Cermak, T., Doyle, E.L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J.A., Somia, N.V., Bogdanove, A.J., and Voytas, D.F (2011) Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting Nucleic Acids Res 39, e82 Cheng, Q., Kazemian, M., Pham, H., Blatti, C., Celniker, S.E., Wolfe, S.A., Brodsky, M.H., and Sinha, S (2013) Computational identification of diverse mechanisms underlying transcription factor-DNA occupancy PLoS Genet 9, e1003571 Christian, M., Qi, Y., Zhang, Y., and Voytas, D.F (2013) Targeted mutagenesis of Arabidopsis thaliana using engineered TAL effector nucleases G3 (Bethesda) 3, 1697–1705 Chubb, J.R., Trcek, T., Shenoy, S.M., and Singer, R.H (2006) Transcriptional pulsing of a developmental gene Curr Biol 16, 1018–1025 Cirillo, L.A., Lin, F.R., Cuesta, I., Friedman, D., Jarnik, M., and Zaret, K.S (2002) Opening of compacted chromatin by early developmental transcription factors HNF3 (FoxA) and GATA-4 Mol Cell 9, 279–289 Crocker, J., and Stern, D.L (2013) TALE-mediated modulation of transcriptional enhancers in vivo Nat Methods 10, 762–767 Crocker, J., Tamori, Y., and Erives, A (2008) Evolution acts on enhancer organization to fine-tune gradient threshold readouts PLoS Biol 6, e263 Crocker, J., Abe, N., Rinaldi, L., McGregor, A.P., Frankel, N., Wang, S., Alsawadi, A., Valenti, P., Plaza, S., Payre, F., et al (2015) Low affinity binding site clusters confer hox specificity and regulatory robustness Cell 160, 191–203 Crocker, J., Ilsley, G.R., and Stern, D.L (2016) Quantitatively predictable control of Drosophila transcriptional enhancers in vivo with engineered transcription factors Nat Genet 48, 292–298 €sslein-Volhard, C (1988) The bicoid protein determines Driever, W., and Nu position in the Drosophila embryo in a concentration-dependent manner Cell 54, 95–104 €sslein-Volhard, C (1989) Determination of Driever, W., Thoma, G., and Nu spatial domains of zygotic gene expression in the Drosophila embryo by the affinity of binding sites for the bicoid morphogen Nature 340, 363–367 Elowitz, M.B., and Leibler, S (2000) A synthetic oscillatory network of transcriptional regulators Nature 403, 335–338 Endy, D (2005) Foundations for engineering biology Nature 438, 449–453 Erceg, J., Saunders, T.E., Girardot, C., Devos, D.P., Hufnagel, L., and Furlong, E.E.M (2014) Subtle changes in motif positioning cause tissue-specific effects on robustness of an enhancer’s activity PLoS Genet 10, e1004060 Fakhouri, W.D., Ay, A., Sayal, R., Dresch, J., Dayringer, E., and Arnosti, D.N (2010) Deciphering a transcriptional regulatory code: modeling short-range repression in the Drosophila embryo Mol Syst Biol 6, 341 Foo, S.M., Sun, Y., Lim, B., Ziukaite, R., O’Brien, K., Nien, C.-Y., Kirov, N., Shvartsman, S.Y., and Rushlow, C.A (2014) Zelda potentiates morphogen activity by increasing chromatin accessibility Curr Biol 24, 1341–1346 Friedland, A.E., Lu, T.K., Wang, X., Shi, D., Church, G., and Collins, J.J (2009) Synthetic gene networks that count Science 324, 1199–1202 Garcia, H.G., and Phillips, R (2011) Quantitative dissection of the simple repression input-output function Proc Natl Acad Sci USA 108, 12173– 12178 Gardner, T.S., Cantor, C.R., and Collins, J.J (2000) Construction of a genetic toggle switch in Escherichia coli Nature 403, 339–342 Gaudet, J., and Mango, S.E (2002) Regulation of organogenesis by the Caenorhabditis elegans FoxA protein PHA-4 Science 295, 821–825 Cell Reports 18, 287–296, January 3, 2017 295 Golding, I., Paulsson, J., Zawilski, S.M., and Cox, E.C (2005) Real-time kinetics of gene activity in individual bacteria Cell 123, 1025–1036 Payankaulam, S., Li, L.M., and Arnosti, D.N (2010) Transcriptional repression: conserved and evolved features Curr Biol 20, R764–R771 Gray, S., and Levine, M (1996) Short-range transcriptional repressors mediate both quenching and direct repression within complex loci in Drosophila Genes Dev 10, 700–710 Perry, M.W., Boettiger, A.N., Bothma, J.P., and Levine, M (2010) Shadow enhancers foster robustness of Drosophila gastrulation Curr Biol 20, 1562– 1567 Hare, E.E., Peterson, B.K., Iyer, V.N., Meier, R., and Eisen, M.B (2008) Sepsid even-skipped enhancers are functionally conserved in Drosophila despite lack of sequence conservation PLoS Genet 4, e1000106 Raj, A., Peskin, C.S., Tranchina, D., Vargas, D.Y., and Tyagi, S (2006) Stochastic mRNA synthesis in mammalian cells PLoS Biol 4, e309 Harrison, M.M., Li, X.-Y., Kaplan, T., Botchan, M.R., and Eisen, M.B (2011) Zelda binding in the early Drosophila melanogaster embryo marks regions subsequently activated at the maternal-to-zygotic transition PLoS Genet 7, e1002266 Ilsley, G.R., Fisher, J., Apweiler, R., De Pace, A.H., and Luscombe, N.M (2013) Cellular resolution models for even skipped regulation in the entire Drosophila embryo eLife 2, e00522 Ip, Y.T., Park, R.E., Kosman, D., Yazdanbakhsh, K., and Levine, M (1992) dorsal-twist interactions establish snail expression in the presumptive mesoderm of the Drosophila embryo Genes Dev 6, 1518–1530 Jin, H., Stojnic, R., Adryan, B., Ozdemir, A., Stathopoulos, A., and Frasch, M (2013) Genome-wide screens for in vivo Tinman binding sites identify cardiac enhancers with diverse functional architectures PLoS Genet 9, e1003195 Johnson, L.A., Zhao, Y., Golden, K., and Barolo, S (2008) Reverse-engineering a transcriptional enhancer: a case study in Drosophila Tissue Eng Part A 14, 1549–1559 Lagha, M., Bothma, J.P., and Levine, M (2012) Mechanisms of transcriptional precision in animal development Trends Genet 28, 409–416 Li, X.Y., MacArthur, S., Bourgon, R., Nix, D., Pollard, D.A., Iyer, V.N., Hechmer, A., Simirenko, L., Stapleton, M., Luengo Hendriks, C.L., et al (2008) Transcription factors bind thousands of active and inactive regions in the Drosophila blastoderm PLoS Biol 6, e27 Li, X.-Y., Harrison, M.M., Villalta, J.E., Kaplan, T., and Eisen, M.B (2014) Establishment of regions of genomic activity during the Drosophila maternal to zygotic transition eLife 3, e03737 Liang, H.L., Nien, C.Y., Liu, H.Y., Metzstein, M.M., Kirov, N., and Rushlow, C (2008) The zinc-finger protein Zelda is a key activator of the early zygotic genome in Drosophila Nature 456, 400–403 Little, S.C., Tikhonov, M., and Gregor, T (2013) Precise developmental gene expression arises from globally stochastic transcriptional activity Cell 154, 789–800 Rastegar, S., Hess, I., Dickmeis, T., Nicod, J.C., Ertzer, R., Hadzhiev, Y., Thies, W.-G., Scherer, G., and Straăhle, U (2008) The words of the regulatory code are arranged in a variable manner in highly conserved enhancers Dev Biol 318, 366–377 Rushlow, C., Colosimo, P.F., Lin, M.C., Xu, M., and Kirov, N (2001) Transcriptional regulation of the Drosophila gene zen by competing Smad and Brinker inputs Genes Dev 15, 340–351 Saller, E., and Bienz, M (2001) Direct competition between Brinker and Drosophila Mad in Dpp target gene transcription EMBO Rep 2, 298–305 Schulz, K.N., Bondra, E.R., Moshe, A., Villalta, J.E., Lieb, J.D., Kaplan, T., McKay, D.J., and Harrison, M.M (2015) Zelda is differentially required for chromatin accessibility, transcription factor binding, and gene expression in the early Drosophila embryo Genome Res 25, 1715–1726 Shankaranarayanan, P., Mendoza-Parra, M.-A., Walia, M., Wang, L., Li, N., Trindade, L.M., and Gronemeyer, H (2011) Single-tube linear DNA amplification (LinDA) for robust ChIP-seq Nat Methods 8, 565–567 Sherwood, R.I., Hashimoto, T., O’Donnell, C.W., Lewis, S., Barkal, A.A., van Hoff, J.P., Karun, V., Jaakkola, T., and Gifford, D.K (2014) Discovery of directional and nondirectional pioneer transcription factors by modeling DNase profile magnitude and shape Nat Biotechnol 32, 171–178 Small, S., Kraut, R., Hoey, T., Warrior, R., and Levine, M (1991) Transcriptional regulation of a pair-rule stripe in Drosophila Genes Dev 5, 827–839 Stampfel, G., Kazmar, T., Frank, O., Wienerroither, S., Reiter, F., and Stark, A (2015) Transcriptional regulators form diverse groups with context-dependent regulatory functions Nature 528, 147–151 Stanojevic, D., Small, S., and Levine, M (1991) Regulation of a segmentation stripe by overlapping activators and repressors in the Drosophila embryo Science 254, 1385–1387 Stathopoulos, A., Van Drenth, M., Erives, A., Markstein, M., and Levine, M (2002) Whole-genome analysis of dorsal-ventral patterning in the Drosophila embryo Cell 111, 687–701 Lusk, R.W., and Eisen, M.B (2010) Evolutionary mirages: selection on binding site composition creates the illusion of conserved grammars in Drosophila enhancers PLoS Genet 6, e1000829 Sun, Y., Nien, C.-Y., Chen, K., Liu, H.-Y., Johnston, J., Zeitlinger, J., and Rushlow, C (2015) Zelda overcomes the high intrinsic nucleosome barrier at enhancers during Drosophila zygotic genome activation Genome Res 25, 1703–1714 Makeev, V.J., Lifanov, A.P., Nazina, A.G., and Papatsenko, D.A (2003) Distance preferences in the arrangement of binding motifs and hierarchical levels in organization of transcription regulatory information Nucleic Acids Res 31, 6016–6026 Taylor, I.C., Workman, J.L., Schuetz, T.J., and Kingston, R.E (1991) Facilitated binding of GAL4 and heat shock factor to nucleosomal templates: differential function of DNA-binding domains Genes Dev 5, 12851298 Matys, V., Fricke, E., Geffers, R., Goăssling, E., Haubrock, M., Hehl, R., Hornischer, K., Karas, D., Kel, A.E., Kel-Margoulis, O.V., et al (2003) TRANSFAC: transcriptional regulation, from patterns to profiles Nucleic Acids Res 31, 374–378 Menoret, D., Santolini, M., Fernandes, I., Spokony, R., Zanet, J., Gonzalez, I., Latapie, Y., Ferrer, P., Rouault, H., White, K.P., et al (2013) Genome-wide analyses of Shavenbaby target genes reveals distinct features of enhancer organization Genome Biol 14, R86 Mukherji, S., and van Oudenaarden, A (2009) Synthetic biology: understanding biological design from synthetic circuits Nat Rev Genet 10, 859–871 Nien, C.-Y., Liang, H.-L., Butcher, S., Sun, Y., Fu, S., Gocha, T., Kirov, N., Manak, J.R., and Rushlow, C (2011) Temporal coordination of gene networks by Zelda in the early Drosophila embryo PLoS Genet 7, e1002339 Papatsenko, D., Goltsev, Y., and Levine, M (2009) Organization of developmental enhancers in the Drosophila embryo Nucleic Acids Res 37, 5665– 5677 296 Cell Reports 18, 287–296, January 3, 2017 Thomas, S., Li, X.-Y., Sabo, P.J., Sandstrom, R., Thurman, R.E., Canfield, T.K., Giste, E., Fisher, W., Hammonds, A., Celniker, S.E., et al (2011) Dynamic reprogramming of chromatin accessibility during Drosophila embryo development Genome Biol 12, R43 Treisman, J., and Desplan, C (1989) The products of the Drosophila gap € genes hunchback and Kruppel bind to the hunchback promoters Nature 341, 335–337 Turing, A.M (1990) The chemical basis of morphogenesis 1953 Bull Math Biol 52, 153–197, discussion 119–152 Vincent, B.J., Estrada, J., and DePace, A.H (2016) The appeasement of Doug: a synthetic approach to enhancer biology Integr Biol 8, 475–484 Wolpert, L (1969) Positional information and the spatial pattern of cellular differentiation J Theor Biol 25, 1–47 Xu, Z., Chen, H., Ling, J., Yu, D., Struffi, P., and Small, S (2014) Impacts of the ubiquitous factor Zelda on Bicoid-dependent DNA binding and transcription in Drosophila Genes Dev 28, 608–621 ... TGCCTAGCCATAGAGAGCCA; Neg Enhancer, 30 - [T7]ggCTGGCTGATTGCAAAACCCC Each set of 30 -primers contained a T7 promoter, 50 -GAAATTAATACGACT CACTATA Samples were subjected to six rounds of amplification... Resource A Fully Synthetic Transcriptional Platform for a Multicellular Eukaryote Justin Crocker,1,2,* Albert Tsai,1 and David L Stern1 1Janelia Research Campus, Howard Hughes Medical Institute,... cleaned with a QIAGEN PCR purification and were then added to a MEGAshortscript T7 Transcription kit (Thermo Fisher Scientific) for a 12-hr linear DNA amplification (Shankaranarayanan et al.,