Aphid transmission of Lettuce necrotic leaf curl virus, a member of a tentative new subgroup within the genus Torradovirus

Aphid transmission of Lettuce necrotic leaf curl virus, a member of a tentative new subgroup within the genus Torradovirus V A t M W a A R R A A K L C N W C T 1 w p 2 a m e w o c a ( 2 r w P h 0 0 ART[.]

G Model VIRUS-97078; No of Pages ARTICLE IN PRESS Virus Research xxx (2017) xxx–xxx Contents lists available at ScienceDirect Virus Research journal homepage: www.elsevier.com/locate/virusres Aphid transmission of Lettuce necrotic leaf curl virus, a member of a tentative new subgroup within the genus Torradovirus Martin Verbeek ∗ , Annette M Dullemans, René A.A van der Vlugt Wageningen University and Research, P.O Box 16, 6700 AA, Wageningen, The Netherlands a r t i c l e i n f o Article history: Received 30 November 2016 Received in revised form 16 February 2017 Accepted 17 February 2017 Available online xxx Keywords: LNLCV Currant-lettuce aphid Nasonovia ribisnigri Willow-carrot aphid Cavariella aegopodii Taxonomy a b s t r a c t Lettuce necrotic leaf curl virus (LNLCV) was described as the first non-tomato-infecting member of the genus Torradovirus Until today, the virus was found only in The Netherlands in two different areas in open field crops of lettuce In 2015, LNLCV was accepted by the ICTV as a new member of the genus Torradovirus The tomato-infecting (TI) torradoviruses Tomato torrado virus (ToTV), Tomato marchitez virus (ToMarV) and Tomato chocolàte virus (ToChV) are transmitted by at least three whitefly species in a semi-persistent and stylet-borne manner As LNLCV was transmitted in open fields in The Netherlands, where whiteflies are present only in low incidence, transmission studies were set up to identify the natural vector of LNLCV Whitefly species which survive Dutch open field conditions during summer, as well as lettuce colonizing aphid species, were tested for their ability to transmit LNLCV Lengths of acquisition and inoculation periods were chosen in accordance with the conditions for TI torradoviruses Transmission experiments involving whiteflies were never successful Transmission with aphids was only successful in case of the lettuce-currant aphid, Nasonovia ribisnigri Localization of LNLCV virions in N ribisnigri with a nested RT-PCR indicated the stylets as possible retention sites The willow-carrot aphid Cavariella aegopodii did not transmit LNLCV in our transmission experiment but the virus could be detected in the stylets of this aphid, leaving C aegopodii as a possible vector for LNLCV © 2017 The Authors Published by Elsevier B.V This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/) Introduction The genus Torradovirus, family Secoviridae, comprises viruses with small spherical particles (28–30 nm in diameter) and a bipartite ssRNA genome (Sanfac¸on et al., 2012; Van der Vlugt et al., 2015) In 2013, Lettuce necrotic leaf curl virus (LNLCV) was described as the first non-tomato (Solanum lycopersicum L.)-infecting (NTI) member of the genus Torradovirus (family Secoviridae) (Verbeek et al., 2014a) Up to then only tomato-infecting (TI) torradoviruses were reported: Tomato torrado virus (ToTV), the type-member of the genus Torradovirus (Verbeek et al., 2007), Tomato marchitez virus (ToMarV) (Turina et al., 2007; Verbeek et al., 2008), and the tentative species Tomato chocolate spot virus (ToChV) (Batuman et al., 2010) and Tomato chocolàte virus (Verbeek et al., 2010a) Recently, the genus Torradovirus expanded with new torradoviruses and torrado-like viruses, both TI and NTI isolates Today we recognize Tomato necrotic dwarf virus (ToNDV) (Larsen et al., ∗ Corresponding author at: Wageningen Univeristy and Research, Wageningen Plant Research, P.O Box 16, 6700, AA, Wageningen, The Netherlands E-mail address: martin.verbeek@wur.nl (M Verbeek) 1984; Wintermantel and Hladky, 2013), Cassava torrado-like virus (CsTLV) (Carvajal-Yepes et al., 2014), Motherwort yellow mottle virus (MYMoV) (Seo et al., 2014), Carrot torrado virus (CaTV) (Rozado-Aguirre et al., 2016), Squash chlorotic leaf spot virus (SCLSV) (Lecoq et al., 2016) and Red clover torradovirus (RCTVˇ Budˇejovice, 1) (personal communication I Koloniuk, IPMB, Ceské Czech Republic) One of the key aspects in understanding the epidemiology of torradoviruses is their transmission mechanism, e.g whether and which natural vectors are involved and the persistency of transmission For the TI torradovirus ToTV, whitefly (family Aleyrodidae) transmission was already suspected after the observation of severe whitefly infestations of tomato crops showing the ‘torrado’ disease (recognized by heavy necrosis on leaves and fruits, which is referred to in the name torrado meaning burnt or roasted) (Alfaro-Fernández et al., 2010) Later it was demonstrated that the whitefly species Trialeurodes vaporariorum and Bemisia tabaci (MEAM1, formerly known as biotype B) were vectors of ToTV (Amari et al., 2008; Pospieszny et al., 2007) but the mode of transmission of TI torradoviruses remained unclear In 2013 we reported that ToTV, ToMarV and ToChV are transmitted by three whitefly species, B tabaci (MEAM1), T vaporariorum and T abutilonea in a semi-persistent and stylet-borne manner (Verbeek et al., http://dx.doi.org/10.1016/j.virusres.2017.02.008 0168-1702/© 2017 The Authors Published by Elsevier B.V This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4 0/) Please cite this article in press as: Verbeek, M., et al., Aphid transmission of Lettuce necrotic leaf curl virus, a member of a tentative new subgroup within the genus Torradovirus Virus Res (2017), http://dx.doi.org/10.1016/j.virusres.2017.02.008 G Model VIRUS-97078; No of Pages ARTICLE IN PRESS M Verbeek et al / Virus Research xxx (2017) xxx–xxx 2014b) Barajas-Ortiz et al (2013) investigated the transmission of Tomato apex necrosis virus, belonging to the species ToMarV, and found transmission with B tabaci (MEAM1) For another TI torradovirus, ToNDV, transmission was demonstrated for different whitefly species e.g two B tabaci biotypes – New World (formerly known as biotype A) and MEAM1 – as well as for T abutilonea and T vaporariorum (personal communication W.M Wintermantel, USDA-ARS, Salinas, USA) These TI torradoviruses were the first spherical viruses reported to be transmitted by whiteflies (Jones, 2003; Verbeek et al., 2014b) Regarding the NTI torradoviruses, until today two (tentative) species were described from unprotected crops grown in maritime climate regions, where whiteflies are not present in large numbers For these two viruses, LNLCV and CaTV, experiments were conducted to investigate which vector was responsible for transmission Rozado-Aguirre et al (2016) demonstrated that CaTV was transmitted by the aphids Myzus persicae and Cavariella aegopodii In order to determine the vector for LNLCV, we conducted transmission studies involving whitefly and aphid species and virus localization studies within these tentative vectors Here we report on the transmission of LNLCV by the currant-lettuce aphid, Nasonovia ribisnigri and suggest that this virus is transmitted in a semi-persistent and stylet-borne manner resembling the transmission of TI torradoviruses by whiteflies Transmission by the willow-carrot aphid, C aegopodii was not demonstrated, but as LNLCV was detected in the stylets of the aphid, its involvement in transmission is suspected Being transmitted by aphids instead of whiteflies, LNLCV might be a member of a new subgroup within the genus Torradovirus, together with CaTV Materials and methods 2.1 Virus isolates LNLCV isolates NVWA5317015 (original isolate, year of isolation 2011) and NVWA4227253 (year of isolation 2013) were maintained in lettuce (Lactuca sativa L.) cultivars ‘White Boston’, ‘Patty’ or ‘Zomerdiamant’, or in Nicotiana occidentalis ‘37B’ LNLCV is easily propagated by mechanical inoculation using Carborundum and a standard inoculation buffer (0.03 M Na-K-phosphate buffer, pH 7.7) Systemically infected leaf material was stored in liquid nitrogen 2.2 Insect species 2.2.1 Whiteflies As LNLCV was until now only found in unprotected lettuce crops in The Netherlands, we tried to obtain colonies of whiteflies which are able to survive in the field during summertime A colony of T vaporariorum (Westwood), was obtained from J Klapwijk, Koppert BV, Berkel en Rodenrijs, The Netherlands This colony was propagated and maintained on N tabacum cv White Burley A colony of the cabbage whitefly Aleyrodes proletella (Linnaeus) (indigenous to The Netherlands) was received from K Pelgrom, Wageningen University and Research This colony was maintained on Emilia sonchifolia (L.) A third colony was of an indigenous whitefly, isolated from Squash plants grown in the first authors’ garden This whitefly was not identified to the species level and was kept on cucumber (Cucumis sativus L.) plants All whitefly colonies were kept in insect rearing cages (Bug-Dorm, Taichung, Taiwan) in a climate chamber at 20 ◦ C (±1 ◦ C) and a day-night regime of 16 h/8 h 2.2.2 Aphids A colony of M persicae (Sulzer), biotype Mp2 (Verbeek et al., 2010b) was maintained on Chinese cabbage (Brassica rapa var pekinensis L.) The lettuce colonizing aphids Macrosiphum euphorbiae (Thomas) and N ribisnigri (Mosley) biotypes Nas-0, Nas-1 and EN-1 were obtained from G Wiegers, Wageningen University and Research, or H.J van Zwol and B Andre, ENZA zaden, Enkhuizen, The Netherlands, and maintained on lettuce cultivars ‘Patty’, ‘White Boston’ or ‘Zomerdiamant’ These cultivars not display resistance to N ribisnigri and were accepted by the three aphid biotypes as host plants C aegopodii (Scopoli), which is a vector of CaTV, was received from L Collins, FERA, York, UK, and maintained on carrot (Daucus carota L cv Napoli) All colonies were kept in Bug-Dorm insect rearing cages in a climate chamber at 20 ◦ C (±1 ◦ C) and a day-night regime of 16 h/8 h 2.3 Transmission studies Transmission studies were initially carried out with various whitefly species as described earlier (Verbeek et al., 2014b), allowing 50–100 whiteflies to acquire LNLCV from an infected lettuce or N occidentalis ‘37B’ plant for an Acquisition Access Period (AAP) of 24 h Following the AAP, 50–100 adults were transferred to a single test plant (young seedlings of lettuce or N occidentalis ‘37B’ in 2–4 leaf stage) covered by a small cage for an Inoculation Access Period (IAP) of 24 h or longer Whiteflies were removed from the inoculated plants as described earlier (Verbeek et al., 2014b) and the plants were transferred to a greenhouse and grown at 20 ◦ C and 16 h light until evaluation for LNLCV-characteristic symptoms Transmission studies involving aphids were performed by removing aphids from their colonies using a small brush Aphids of different ages (colonies were not synchronized), both alate and apterae, were transferred to a small plastic cage in which they were given a starvation period of h Subsequently, aphids were transferred to LNLCV-infected lettuce or N occidentalis ‘37B’ plants Following the AAP of 24 h, cohorts of 20 aphids were transferred to single test plants which were covered with small insect cages Following an IAP of 24 h or longer, aphids were killed using imida® cloprid (Admire ) and the plants were transferred to a greenhouse ◦ at 20 C and 16 h light until evaluation for symptom development 2.4 Detection of LNLCV in plants Virus infection in symptomatic plants and absence of virus in asymptomatic plants was verified using an RT-PCR Two sets of primers were designed based on the sequences of LNLCV-NVWA5317015 (GenBank accession numbers KC855266 (RNA1) and KC855267 (RNA2)) LNLCV-specific primers, LNLCV1F, LNLCV-1R, LNLCV-2F, and LNLCV-2R (Table 1), were designed on similar genomic regions in RNA1 or RNA2 used earlier for designing the generic primer pairs Torrado1F/Torrado1R and Torrado2F/Torrado2R, able to detect all currently known TI torradoviruses (Verbeek et al., 2012) However, these generic primers have considerable mismatches with the NTI torradoviruses Total RNA was extracted from plant material using the Qiagen RNeasy plant mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol and ␮l per 25 ␮l mastermix was tested in a one-step RT-PCR with the Promega Access RT-PCR System (Promega, Madison, WI, USA) according to the following PCR program: 45 48 ◦ C (RT), 94 ◦ C, 40 cycles of 30 s 94 ◦ C, 60 s 50 ◦ C, 60 s 68 ◦ C, and a final extension for at 68 ◦ C Amplicons were analyzed by mixing a ␮l aliquot with ␮l of Orange G (Sigma-Aldrich, St Louis, MO, USA) loading buffer containing 1.25% GelRed (Biotium, Hayward, CA, USA) and electrophoresis in a 1% agarose gel (Roche, Mannheim, Germany) in 0.5 × TBE buffer The amplicon sizes were compared to a kb plus DNA ladder (Invitrogen, Carlsbad, CA, USA) Please cite this article in press as: Verbeek, M., et al., Aphid transmission of Lettuce necrotic leaf curl virus, a member of a tentative new subgroup within the genus Torradovirus Virus Res (2017), http://dx.doi.org/10.1016/j.virusres.2017.02.008 G Model VIRUS-97078; No of Pages ARTICLE IN PRESS M Verbeek et al / Virus Research xxx (2017) xxx–xxx Table Used primers, primer sequences, targets, and expected amplicon sizes Name Sequence 5 ––––––––––3 Target Expected amplicon size LNLCV-1F LNLCV-1R GCTGACTATTCCTCCTTCGATGG GGAACTGCAACCAAGTTGTCATC RNA1 RNA1 371 LNLCV-2F LNLCV-2R TTTGGGATGAGGGGGATGTTC AGTCCACCATCTACAGTTTCG RNA2 RNA2 515 LNLCV-1FN LNLCV-1RN TTCGATGGYCGWGCTCCAG AAGTTGTCATCACCATAAATGGC Amplicon LNLCV-1F/1R Amplicon LNLCV-1F/1R 344 LNLCV-2FN LNLCV-2RN AGCTAGGAAAGACAACATCAACC AAATTGCAAAGCAGTGAAGGC Amplicon LNLCV-2F/2R Amplicon LNLCV-2F/2R 465 2.5 Detection and localization of LNLCV in insect vectors Based on the localization of TI torradoviruses in their whitefly vectors, the retention site of LNLCV was suspected to be in the stylets of its vector (Verbeek et al., 2014b) To investigate this, the probosces including the stylets were removed from whiteflies and aphids after an 24 h AAP on LNLCV-infected plants This was done essentially as described earlier (Verbeek et al., 2014b), by removing the probosces of whiteflies with an ophthalmic scalpel with an angle of 30◦ (Feather, Osaka, Japan) The probosces of aphids, which are larger than those of whiteflies, were removed using micro scissors (EMS, Hatfield, PA, USA) Samples consisting of ten pooled stylets or five pooled rest bodies in 25 ␮l of Milli-Q water were stored in −20 ◦ C until further processed After slow thawing on ice, the samples were ground using a small Teflon pestle (tissue grinder for 1.5 ml eppendorf tubes) Subsequently, they were subjected to RNA extraction using the Qiagen RNeasy Plant Mini Kit (Qiagen, Hilden, Germany), following the manufacturer’s protocol For elution 30 ␮l RNase-free water was used LNLCV detection with primer pairs LNLCV-1F/LNLCV-1R and LNLCV-2F/LNLCV-2R proved to be suitable to detect LNLCV in infected plant material, however, RT-PCR using these primers was not sensitive enough to detect LNLCV in insects For this purpose, and thus enabling localization of the virus in insects, nested primer pairs were designed based on the amplicon sequences derived by amplification of the two used LNLCV isolates by RT-PCR and direct sanger-sequencing of those amplicons Primer LNLCV-1F needed a small degeneration as the sequences of both LNLCV isolates had nucleotide polymorphisms in two places (primers and their sequences are listed in Table 1) RT-PCR using the first primer pair was done as described above, the nested PCR was performed with the Roche PCR master kit (Roche, Mannheim, Germany) with the following PCR program: 94 ◦ C, 40 cycles of 30 s 94 ◦ C, 30 s 50 ◦ C, 30 s 72 ◦ C, and a final extension for 10 at 72 ◦ C Amplicons were analyzed as described above 2.6 Phylogenetic analysis The amino acid sequence of the region between the protease CG motif and the GDD RdRp motif or Pro-Pol region (aa 1,065–1,526 in RNA1-ORF1 of LNLCV, GenBank accession number AGR55590.1) was aligned with sequences of the same region of currently known torradoviruses The alignment and phylogenetic analysis were performed with the CLC Main Workbench package (CLC Bio, Aarhus, Denmark) using the neighbour-joining algorithm and a bootstrap analysis with the software’s default settings (100 replicates) Results Transmission experiments with LNLCV and using whiteflies as possible vectors never led to infection, either in N occidentalis ‘37B’, nor in lettuce plants (Table 2) Inoculated plants were evaluated for symptom development up to one month after the inoculation Fig Nested (RT-)PCR on samples of stylets and bodies of whitefly species using A) LNLCV-1F/LNLCV-1R and LNLCV-1FN/LNLCV-1RN targeting the RNA1 of LNLCV, and B) LNLCV-2F/LNLCV-2R and LNLCV-2FN/LNLCV-2RN targeting RNA2 of LNLCV Insects were taken from their healthy host plants (−) or were given an AAP of 24 h on an LNLCV-infected lettuce plant (+) T.v.: Trialeurodes vaporariorum, Wf unknown: whitefly species of garden-grown squash, not determined to species, A.p.: Aleyrodes proletella Stylet and body samples of the currant-lettuce aphid Nasonovia ribisnigri (N.r.) were included as positive controls MQ: water control date, where mechanical inoculation usually leads to characteristic LNLCV symptoms consisting of severe mosaic in N occidentalis or necrosis and leaf curling in lettuce between one and two weeks The evaluations for symptom development were verified by RT-PCR using the LNLCV-specific primer pairs 1F/1R and 2F/2R (Table 1) and positive signals were only observed in symptomatic plants Based on observations that TI torradoviruses are quite inefficiently transmitted by their whitefly vectors (Verbeek et al., 2014b), relatively large numbers of possible whitefly vectors (50 or 100 adults per test plant) were used in the transmission studies All experiments with whiteflies were conducted with optimal acquisition and inoculation periods according to the transmission of TI torradoviruses, e.g an AAP 24 h and an IAP of ≥24 h In order to check whether whiteflies had acquired LNLCV during the AAP, the whitefly bodies and their probosces including the stylets were sampled separately and subjected to RNA extraction and RT-PCR Using primer pairs LNLCV1F/LNLCV-1R and LNLCV-2F/LNLCV-2R turned out to be useless for the detection of LNLCV in these insects Only when a nested PCR was performed using the nested primers LNLCV-2FN and LNLCV-2RN on amplicons derived from the RT-PCR with primer pair LNLCV2F/LNLCV-2R, a virus-specific signal could be observed in the bodies of T vaporariorum (Fig 1) However, LNLCV-positive signals were Please cite this article in press as: Verbeek, M., et al., Aphid transmission of Lettuce necrotic leaf curl virus, a member of a tentative new subgroup within the genus Torradovirus Virus Res (2017), http://dx.doi.org/10.1016/j.virusres.2017.02.008 G Model VIRUS-97078; No of Pages ARTICLE IN PRESS M Verbeek et al / Virus Research xxx (2017) xxx–xxx Table Results of inoculation experiments with Lettuce necrotic leaf curl virus (LNLCV) Virus isolate Source plant Insect type Insect species Test plant Total infected/total inoculated plants (%) NVWA5317015 NVWA4227253 NVWA5317015 NVWA4227253 NVWA5317015 NVWA4227253 NVWA5317015 NVWA4227253 NVWA5317015 NVWA4227253 NVWA5317015 NVWA4227253 NVWA5317015 NVWA4227253 NVWA5317015 NVWA4227253 NVWA5317015 NVWA4227253 N occidentalis N occidentalis N occidentalis/lettuce N occidentalis/lettuce N occidentalis N occidentalis N occidentalis/lettuce N occidentalis/lettuce N occidentalis/lettuce N occidentalis/lettuce N occidentalis/lettuce N occidentalis/lettuce lettuce lettuce lettuce lettuce N occidentalis N occidentalis Whitefly Whitefly Whitefly Whitefly Whitefly Whitefly Aphid Aphid Aphid Aphid Aphid Aphid Aphid Aphid Aphid Aphid Aphid Aphid Aleyrodes proletella Aleyrodes proletella Trialeurodes vaporariorum Trialeurodes vaporariorum Unknown NL Unknown NL Myzus persicae Myzus persicae Nasonovia ribisnigri NAS-0 Nasonovia ribisnigri NAS-0 Nasonovia ribisnigri NAS-1 Nasonovia ribisnigri NAS-1 Nasonovia ribisnigri EN-1 Nasonovia ribisnigri EN-1 Cavariella aegopodii Cavariella aegopodii Macrosiphum euphoribiae Macrosiphum euphoribiae N occidentalis N occidentalis N occidentalis/lettuce N occidentalis/lettuce N occidentalis N occidentalis N occidentalis/lettuce N occidentalis/lettuce N occidentalis/lettuce N occidentalis/lettuce N occidentalis/lettuce N occidentalis/lettuce lettuce lettuce lettuce lettuce lettuce lettuce 0/10 (0%) 0/10 (0%) 0/40 (0%) 0/40 (0%) 0/10 (0%) 0/10 (0%) 0/30 (0%) 0/30 (0%) 14/30 (47%) 19/30 (63%) 0/10 (0%) 0/10 (0%) 2/10 (20%) 3/10 (30%) 0/10 (0%) 0/10 (0%) 0/10 (0%) 0/10 (0%) Discussion Fig Nested (RT-)PCR targeting the LNLCV-RNA2 (primers LNLCV-2F/LNLCV-2R and LNLCV-2FN/LNLCV-2RN) on samples of stylets and bodies of four aphid species Nasonovia ribisnigri NAS-0 (N.r.) was tested from healthy lettuce plants (−), and after a 24 h AAP on LNLCV-infected lettuce (+,L) or LNLCV-infected Nicotiana occidentalis ‘37B’(+,N) Cavariella aegopodii (C.a.), Macrosiphum euphorbiae (M.e.), and Myzus persicae (M.p.) were tested after a 24 h AAP on LNLCV-infected lettuce (C.a and M.e.) or N occidentalis ‘37B’ (M.p.) PC: positive control N occidentalis ‘37B’, MQ: water control never observed in the tested probosces/stylets, in which the retention sites for TI torradoviruses in whiteflies are located Transmission experiments with the aphid species M persicae, M euphorbiae, and C aegopodii did not result in transmission of LNLCV However, transmission was observed in experiments with N ribisnigri biotypes NAS-0 or EN-1, resulting in an average of 55% and 25% transmission between the experiments with the two LNLCV isolates, respectively Both aphid biotypes were able to transmit LNLCV from N occidentalis or lettuce to test plants of the same species (Table 2) A third biotype, NAS-1, was not successful in the transmission of LNLCV Localization studies for LNLCV within the aphids performed in a similar way as described for whiteflies, showed that all aphid species were able to acquire LNLCV virions from the offered source plants However, only in N ribisnigri NAS-0 (EN1 and NAS-1 were not tested) and C aegopodii the virus was detected in the dissected probosces/stylets (Fig 2) Phylogenetic analysis that was based on the Pro-Pol region of TI and NTI torradoviruses clearly groups the TI torradoviruses apart from the NTI torradoviruses, as was reported earlier (Van der Vlugt et al., 2015) Within the NTI torradoviruses, LNLCV groups together with CaTV and MYMoV, but these three viruses are clearly divergent from the recently described SCLSV, which was reported to be whitefly-transmitted (Lecoq et al., 2016) The torradovirus-like CsTLV, for which no vector was determined yet, does not group with any of the known TI or NTI torradoviruses (Fig 3) LNLCV, recognized as the third species within the genus Torradovirus, has been found so far only in field grown lettuce crops in The Netherlands in 2011 and 2013 (Van der Vlugt et al., 2015; Verbeek et al., 2014a) LNLCV was the first torradovirus described from another crop than tomato Considering the whitefly-borne nature of the TI torradoviruses, investigations were started to see if also LNLCV had whiteflies as its natural vectors Whiteflies occur in the open field in The Netherlands in summer, but not cause serious problems in lettuce (Janssen, 2011) However, they still might transmit viruses such as LNLCV Colonies of T vaporariorum, which can survive in the open field during the summer season, and two indigenous whitefly species, A proletella and an unknown species isolated from a garden-grown squash plant, were used in transmission studies Transmission parameters (an AAP of 24 h and an IAP of 24 h or longer) were chosen similar to the optimal conditions as were determined for the semi-persistent transmission of the TI torradoviruses ToTV, ToMarV and ToChV (Verbeek et al., 2014b) Despite of the relatively large numbers of whiteflies used per test plant, no transmission of both isolates of LNLCV was observed Involvement of another natural vector of LNLCV, such as aphids, was suspected, but became evident when another torradovirus from field-grown carrots in the UK, CaTV, was found to be aphid transmissible (Rozado-Aguirre et al., 2016) Using AAPs of 24 h and IAPs of ≥24 h, which are in line with the AAP and IAP used by Rozado-Aguirre et al in the CaTV experiments, transmission of LNLCV was established only when two out of three biotypes of N ribisnigri were used as vector Localization of LNLCV in stylets of insects that had an AAP on LNLCV-infected plants was only successful in N ribisnigri and C aegopodii and not in other aphid species or whiteflies This was in line with the observation of transmission of LNLCV by N ribisnigri, supporting the idea that the transmission of LNLCV by aphids is stylet-borne, like was observed in the transmission of TI torradoviruses by the whitefly species B tabaci, T vaporariorum and T abutilonea The conditions and lengths of AAP and IAP were chosen according to the semi-persistent transmission of TI torradoviruses, and also for the aphid-transmitted NTI torradoviruses, a semi-persistent manner of transmission is suspected However, the project we report on here did not allow us to perform transmission studies with varying AAP, retention period and IAP, which would have enabled a confirmation on the semi-persistent character of the transmission of LNLCV by aphids Remarkably, M persicae biotype Mp2 turned out to be a nonvector for LNLCV where it is a rather efficient vector for numerous aphid-borne viruses In the work of Rozado-Aguirre et al (2016), Please cite this article in press as: Verbeek, M., et al., Aphid transmission of Lettuce necrotic leaf curl virus, a member of a tentative new subgroup within the genus Torradovirus Virus Res (2017), http://dx.doi.org/10.1016/j.virusres.2017.02.008 G Model VIRUS-97078; No of Pages ARTICLE IN PRESS M Verbeek et al / Virus Research xxx (2017) xxx–xxx Fig Phylogenetic analysis of members and tentative members of the genus Torradovirus, based on an alignment of amino acid sequences of the region between the protease CG motif and the GDD RdRp motif (ProPol region) Bootstrap values are indicated at the nodes The bar represents a p-distance of 0.7 Sequences included in the analysis are from the following viruses (with virus acronyms and GenBank accession numbers in parentheses): tomato necrotic dwarf virus (ToNDV; AHU86525.1), tomato marchitez virus (ToMarV; ABV44416.1), tomato chocolate spot virus (ToChSV; ACT79982.1), tomato chocolàte virus (ToChV; ACU01024.1), tomato torrado virus (ToTV; ABD38934.1), squash chlorotic leaf spot virus (SCLSV; AMN91910.1), motherwort yellow mottle virus (MYMoV; AIT59085.1), lettuce necrotic leaf curl virus (LNLCV, AGR55590.1), carrot torradovirus (CaTV, AHA85556.1), and cassava torrado-like virus (CsTLV; AHA91817.1) The sequence of potato virus Y, genus Potyvirus (PVY; CAA30988.1) was used as an outgroup in this analysis another M persicae biotype was found to transmit the NTI torradovirus CaTV Also C aegopodii was identified as a vector for CaTV, but was found to be less efficient We did not observe transmission of LNLCV with C aegopodii in our experiments, however, this aphid species may still be a vector for LNLCV as the virus was detected in the stylets, presumably the retention site of the virus It might be due to a very low transmission efficiency of the vector biotype used that no plant became infected in our transmission experiments Moreover, as biotype effects on transmission efficiency might occur, it has to be noted that our colony of C aegopodii may not be the same biotype as was used in CaTV transmission studies Differences in transmission efficiencies between biotypes of aphids and whiteflies were described for vectors of viruses which are transmitted in a persistent, semi-persistent or non-persistent manner (Cicero and Brown, 2016; Fereres, 2016; Wintermantel, 2016) Besides the differences in transmission efficiency between biotypes that may influence the results in transmission studies, also many other factors may so like differences between alate and apterae, between nymph or adult, or low virus titers in source plants Ng and Zhou (2015) clearly state: semi-persistent transmission or non-circulative semi-persistent transmission (NCSP) requires the concerted actions of the virus, the vector, and the plant in order to fulfil an unhindered continuum of processes such as virion acquisition, retention and inoculation Understanding the complex relationships between virus, vector and host plant, which are influenced by the environment, requires evenly complex biological studies in which optimal conditions for all players have to be explored However, modern techniques such as Next Generation Sequencing might prove to be a helpful tool in understanding the interactions between plant viruses and insect vectors e.g by studying the transcriptomes of biotypes of vectors, by characterizations of the genetic background of relationships between viruses and their vectors, or by examination of changing expression profiles in vectors upon acquisition of plant viruses (Kaur et al., 2016) Within the family of Secoviridae the current demarcation criteria encompass the number of genomic RNAs, the number of protein domains and/or processing sites within the polyprotein(s), the number of CPs, and the presence of additional ORFs and/or subgenomic RNAs (Sanfac¸on et al., 2012) According to these criteria, the observation of some members of the genus Torradovirus having aphids as vector instead of whiteflies does not lead to the creation of a new genus for the aphid-borne NTI torradoviruses However, a grouping of whitefly-borne and aphid-borne seems to be valid based on the current knowledge on vector transmission of CaTV and LNLCV In our phylogenetic analysis, the NTI torradovirus MYMoV which was described from the medical herb motherwort (Leonurus sibiricus L.), and for which no vector was described until today (Seo et al., 2014), groups together with CaTV and LNLCV It is therefore suspected that this virus is also transmitted by aphids This may also be the case for the new NTI torradovirus from red clover (Trifolium pratense L.) RCTV-1, which appears in the same clade of aphid-borne torradoviruses based upon the aa sequence ˇ of the Pro-Pol region (unpublished results I Koloniuk, IPMB, Ceské Budˇejovice, Czech Republic) Funding This work was supported by the Ministry of Economic Affairs, Netherlands Food and Consumer Product Safety Authority [grant number 60003533] Conflict of interest The authors declare no conflict of interest Acknowledgements The authors wish to thank G Wiegers and K Pelgrom, Wageningen University and Research, J Klapwijk, Koppert BV, Berkel en Rodenrijs, The Netherlands, H.J van Zwol and B Andre, ENZA zaden, Enkhuizen, The Netherlands, and L Collins, FERA, York, UK, for sharing their colonies of whitefly and aphid species Please cite this article in press as: Verbeek, M., et al., Aphid transmission of Lettuce necrotic leaf curl virus, a member of a tentative new subgroup within the genus Torradovirus Virus Res (2017), http://dx.doi.org/10.1016/j.virusres.2017.02.008 G Model VIRUS-97078; No of Pages ARTICLE IN PRESS M Verbeek et al / Virus Research xxx (2017) xxx–xxx References Alfaro-Fernández, A., Córdoba-Sellés, M.D.C., Juárez, M., Herrera-Vásquez, J.A., Sánchez-Navarro, J.A., Cebrián, M.D.C., Font, M.I., Jordá, C., 2010 Occurrence and geographical distribution of the ‘torrado’ disease in Spain J Phytopathol 158, 457–469 Amari, K., Gonzalez-Ibeas, D., Gómez, P., Sempere, R.N., Sanchez-Pina, M.A., Aranda, M.A., Diaz-Pendon, J.A., Navas-Castillo, J., Moriones, E., Blanca, J., Hernandez-Gallardo, M.D., Anastasio, G., 2008 Tomato torrado virus is transmitted by Bemisia tabaci and infects pepper and eggplant in addition to tomato Plant Dis 92, 1139 Barajas-Ortiz, M., León-Sicairos, C.R., López-Valenzuela, J.A., Reyes-Moreno, C., Valdez-Ortiz, A., Velarde-Félix, S., Peraza-Garay, F., Garzón-Tiznado, J.A., 2013 Transmission efficiency of Tomato apex necrosis virus by Bemisia tabaci (Hemiptera: Aleyrodidae) biotype B in tomato J Econ Entomol 106, 1559–1565 Batuman, O., Kuo, Y.W., Palmieri, M., Rojas, M.R., Gilbertson, R.L., 2010 Tomato chocolate spot virus, a member of a new torradovirus species that causes a necrosis-associated disease of tomato in Guatemala Arch Virol 155, 857–869 ˜ M., Cuellar, W.J., 2014 Carvajal-Yepes, M., Olaya, C., Lozano, I., Cuervo, M., Castano, Unraveling complex viral infections in cassava (Manihot esculenta Crantz) from Colombia Virus Res 186, 76–86 Cicero, J.M., Brown, J.K., 2016 Bemisia tabaci-mediated transmission of begomoviruses: history and anatomical, biological, and cellular interactions In: Brown, J.K (Ed.), Vector-Mediated Transmission of Plant Pathogens The American Phytopathological Society, pp 211–230 Fereres, A., 2016 Aphid behavior and the transmission of noncirculative viruses In: Brown, J.K (Ed.), Vector-Mediated Transmission of Plant Pathogens The American Phytopathological Society., pp 31–45 Janssen, M.G.M., 2011 The whiteflies of The Netherlands, including two species new for the dutch fauna (Hemiptera: aleyrodidae) Nederlandse Faunistische Mededelingen 36, 69–98 Jones, D.R., 2003 Plant viruses transmitted by whiteflies Eur J Plant Pathol 109, 195–219 Kaur, N., Hasegawa, D.K., Ling, K.-S., Wintermantel, W.M., 2016 Application of genomics for understanding plant virus-insect vector interactions and insect vector control Phytopathology 106, 1213–1222 Larsen, R.C., Duffus, J.E., Liu, H.Y., 1984 Tomato chlorotic dwarf-a new type of whitefly transmitted virus Phytopathology 74, 795 Lecoq, H., Verdin, E., Tepfer, M., Wipf-Scheibel, C., Millot, P., Dafalla, G., Desbiez, C., 2016 Characterization and occurrence of squash chlorotic leaf spot virus, a tentative new torradovirus infecting cucurbits in Sudan Arch Virol 161, 1651–1655 Ng, J.C.K., Zhou, J.S., 2015 Insect vector-plant virus interactions associated with non-circulative, semi-persistent transmission: current perspectives and future challenges Curr Opin Virol 15, 48–55 ˛ ˛ Pospieszny, H., Borodynko, N., Obrepalska-St eplowska, A., Hasiów, B., 2007 The first report of Tomato torrado virus in Poland Plant Dis 91, 1364 Rozado-Aguirre, Z., Adams, I., Collins, L., Fox, A., Dickinson, M., Boonham, N., 2016 Detection and transmission of Carrot torrado virus, a novel putative member of the Torradovirus genus J Virol Methods 235, 119–124 Sanfac¸on, H., Iwanami, T., Karasev, A.V., Van der Vlugt, R.A.A., Wellink, J., Wetzel, T., Yoshikawa, N., 2012 Secoviridae In: King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J (Eds.), Ninth Report of the International Committee on Taxonomy of Viruses Elsevier Academic PressSan Diego, pp 881–899 Seo, J.-K., Kang, M., Kwak, H.-R., Kim, M.-K., Kim, C.-S., Lee, S.-H., Kim, J.-S., Choi, H.-S., 2014 Complete genome sequence of motherwort yellow mottle virus, a novel putative member of the genus Torradovirus Arch Virol 160, 587–590 Turina, M., Ricker, M.D., Lenzi, R., Masenga, V., Ciuffo, M., 2007 A severe disease of tomato in the Culiacan area (Sinaloa, Mexico) is caused by a new picorna-like viral species Plant Dis 91, 932–941 Van der Vlugt, R.A.A., Verbeek, M., Dullemans, A.M., Wintermantel, W.M., Cuellar, W.J., Fox, A., Thompson, J.R., 2015 Torradoviruses Annu Rev Phytopathol 53, 485–512 Verbeek, M., Dullemans, A.M., Van den Heuvel, J.F.J.M., Maris, P.C., Van der Vlugt, R.A.A., 2007 Identification and characterisation of Tomato torrado virus: a new plant picorna-like virus from tomato Arch Virol 152, 881–890 Verbeek, M., Dullemans, A.M., Van den Heuvel, J.F.J.M., Maris, P.C., Van der Vlugt, R.A.A., 2008 Tomato marchitez virus, a new plant picorna-like virus from tomato related to Tomato torrado virus Arch Virol 153, 127–134 Verbeek, M., Dullemans, A.M., Van den Heuvel, J.F.J.M., Maris, P.C., Van der Vlugt, R.A.A., 2010a Tomato chocolàte virus: a new plant virus infecting tomato and a proposed member of the genus Torradovirus Arch Virol 155, 751–755 Verbeek, M., Piron, P.G.M., Dullemans, A.M., Cuperus, C., Van Der Vlugt, R.A.A., 2010b Determination of aphid transmission efficiencies for N, NTN and Wilga strains of Potato virus Y Ann Appl Biol 156, 39–49 Verbeek, M., Tang, J., Ward, L.I., 2012 Two generic PCR primer sets for the detection of members of the genus Torradovirus J Virol Methods 185, 184–188 Verbeek, M., Dullemans, A.M., Raaij, H.G., Verhoeven, J.T.J., Vlugt, R.A.A., 2014a Lettuce necrotic leaf curl virus, a new plant virus infecting lettuce and a proposed member of the genus Torradovirus Arch Virol 159, 801–805 Verbeek, M., van Bekkum, P.J., Dullemans, A.M., van der Vlugt, R.A.A., 2014b Torradoviruses are transmitted in a semi-persistent and stylet-borne manner by three whitefly vectors Virus Res 186, 55–60 Wintermantel, W.M., Hladky, L.L., 2013 Genome characterization of Tomato necrotic dwarf virus, a torradovirus from southern California Phytopathology 103, 160 Wintermantel, W.M., 2016 Semipersistent whitefly-transmitted viruses: criniviruses In: Brown, J.K (Ed.), Vector-Mediated Transmission of Plant Pathogens The American Phytopathological Society., pp 111–119 Please cite this article in press as: Verbeek, M., et al., Aphid transmission of Lettuce necrotic leaf curl virus, a member of a tentative new subgroup within the genus Torradovirus Virus Res (2017), http://dx.doi.org/10.1016/j.virusres.2017.02.008 ... LNLCV-1RN TTCGATGGYCGWGCTCCAG AAGTTGTCATCACCATAAATGGC Amplicon LNLCV-1F/1R Amplicon LNLCV-1F/1R 344 LNLCV-2FN LNLCV-2RN AGCTAGGAAAGACAACATCAACC AAATTGCAAAGCAGTGAAGGC Amplicon LNLCV-2F/2R Amplicon... Whitefly Whitefly Aphid Aphid Aphid Aphid Aphid Aphid Aphid Aphid Aphid Aphid Aphid Aphid Aleyrodes proletella Aleyrodes proletella Trialeurodes vaporariorum Trialeurodes vaporariorum Unknown NL... to these criteria, the observation of some members of the genus Torradovirus having aphids as vector instead of whiteflies does not lead to the creation of a new genus for the aphid- borne NTI torradoviruses