a framework for lateral membrane trafficking and polar tethering of the pen3 atp binding cassette transporter

Plant Physiology Preview Published on November 1, 2016, as DOI:10.1104/pp.16.01252 Running title: PEN3 outer lateral domain trafficking and polarity Corresponding author: Markus Grebe, Institute of Biochemistry and Biology, Plant Physiology, University of Potsdam, Karl-Liebknecht-Str 24-25, Building 20, 14476 Potsdam-Golm, Germany A framework for lateral membrane trafficking and polar tethering of the PEN3 ATP-binding cassette transporter Hailiang Mao1, Moritaka Nakamura2, Corrado Viotti2, and Markus Grebe1,2* 10 11 12 University, SE-90 187 Umeå, Sweden 13 14 Potsdam, Karl-Liebknecht-Str 24-25, Building 20, 14476 Potsdam-Golm, 15 Germany Umeå Plant Science Centre, Department of Plant Physiology, Umeå Institute of Biochemistry and Biology, Plant Physiology, University of 16 17 18 19 One sentence summary: ACTIN7 is required for trans-Golgi network trafficking of outer lateral membrane cargo and to establish its polarity via the EXOCYST84b tethering factor 20 Author contributions: M.G conceived the project M.G., H.M designed 21 experiments H.M., C.V and M.N performed experiments M.G., H.M., M.N 22 and C.V interpreted the results M.G and H.M wrote the manuscript All 23 authors read and edited the manuscript prior to publication 24 25 Funding: This work was supported by the ERC starting (consolidator) grant 26 ERC-STG-2010 Green-Lat-Pol grant number 260699 to M.G 27 28 Corresponding author e-mail: markus.grebe@uni-potsdam.de 29 30 Word count 31 Title: 87 characters 32 Abstract: 177 words Introduction: 629 words Results + Discussion: 3059 + 33 698 = 3757 words Material and Methods: 2927 words Figure legends: 324 34 words; 282 words; 116 words; 188 words; 313 words; 395 words; 243 words; 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved Copyright 2016 by the American Society of Plant Biologists 35 267 words References: 54 36 Supplemental Figures: 5; Supplemental Tables: 2; Supplemental movies 37 38 39 ABSTRACT 40 41 The outermost cell layer of plants, the epidermis, and its outer (lateral) 42 membrane domain facing the environment are continuously challenged by 43 biotic and abiotic stresses Therefore, the epidermis and the outer membrane 44 domain provide important selective and protective barriers However, only a 45 small number of specifically outer membrane-localized proteins are known 46 Similarly, molecular mechanisms underlying the trafficking and the polar 47 placement of outer membrane domain proteins require further exploration 48 Here, we demonstrate that ACTIN7 (ACT7) mediates trafficking of the 49 PENETRATION3 (PEN3) outer membrane protein from the trans-Golgi 50 network (TGN) to the plasma membrane in the root epidermis of Arabidopsis 51 thaliana and that actin function contributes to PEN3 endocytic recycling In 52 contrast to such generic ACT7-dependent trafficking from the TGN, the 53 EXOCYST84b (EXO84b) tethering factor mediates PEN3 outer membrane 54 polarity Moreover, precise EXO84b placement at the outer membrane 55 domain itself requires ACT7 function Hence, our results uncover spatially and 56 mechanistically distinct requirements for ACT7 function during outer lateral 57 membrane cargo trafficking and polarity establishment They further identify 58 an exocyst tethering complex mediator of outer lateral membrane cargo 59 polarity 60 61 62 63 64 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 65 INTRODUCTION 66 67 Many cell types of diverse organisms display persistent, asymmetric 68 distribution of molecules or structures along an axis This phenomenon 69 referred to as cell polarity often enables cells to fulfill specific functions Cell 70 polarity may be reflected by the asymmetric, polar localization of proteins to 71 specific areas at the plasma membrane (PM) Much work has focused on 72 polar localization of auxin transport facilitators of the PIN-FORMED (PIN) 73 protein family in Arabidopsis thaliana (Gälweiler et al., 1998; Müller et al., 74 1998; Geldner et al., 2001; Wisniewska et al., 2006) For example, PIN2 75 marks the shootward-oriented (apical) PM domain of root epidermal cells, but 76 the root tip-oriented (basal) domain of meristematic cortical cells (Blilou et al., 77 2005), while PIN1 marks the basal domain of root vascular cells (Steinmann 78 et al., 1999) Thus, PIN2 and PIN1 highlight specific membrane domains 79 along the apical-basal axis of specific cell types and regulators of PIN1 activity 80 and polarity have been identified (Geldner et al., 2003; Michniewicz et al., 81 2007) Mechanisms underlying PIN protein trafficking and targeting to specific 82 domains have been addressed over the last two decades (Kleine-Vehn and 83 Friml, 2008) Similarly, polar emergence of root hairs from a local area at the 84 outer epidermal PM has been studied in detail (Grebe et al., 2002; Fischer et 85 al., 2006; Ikeda et al., 2009; Kiefer et al., 2015) However, only more recently, 86 proteins have become known that specifically localize broadly along the 87 epidermal PM at the root surface facing the soil, termed the outer (lateral) 88 membrane (Miwa et al., 2007; Strader and Bartel, 2009; Alassimone et al., 89 2010; Takano et al., 2010; Fendrych et al., 2013; Barberon et al., 2014) In 90 line with a function of the outer lateral membrane as a target and selective 91 barrier for inorganic and biotic compounds or stresses, proteins involved in 92 biotic stress response or transport of abiotic compounds display polar 93 localization at the outer domain These include the ATP-binding cassette 94 (ABC) transporter PENETRATION3 (PEN3)/PDR8/ABCG36 (Strader and 95 Bartel, 2009), originally identified due to its function in response to penetrating 96 fungal pathogens (Stein et al., 2006), and its close homologue ABCG37 97 (Łangowski et al., 2010, Ruzicka et al., 2010) Outer membrane proteins 98 involved in ion/nutrient uptake include the IRON-REGULATED 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 99 TRANSPORTER1 (IRT1; Barberon et al., 2014), the boron exporter BOR4 100 (Miwa et al., 2007) and the boric acid uptake channel NIP5;1 (Alassimone et 101 al., 2010; Takano et al., 2010) and NIP5;1 sub-cellular localization depends 102 on D-galactose (Uehara et al., 2014) Another boric acid/borate exporter, 103 BOR1, localizes to the inner lateral membrane of root epidermal cells 104 bordering the cortical cell layer and specific tyrosine residues in BOR1 105 mediate its polar localization and vacuolar targeting (Takano et al., 2010) 106 With respect to IRT1, the phosphatidylinositol-3-phosphate-binding protein 107 FYVE1 is required for IRT1 recycling and affects IRT1 polar delivery to the 108 outer domain (Barberon et al., 2014) Trafficking of PEN3, ABCG37 and 109 BOR4 proved sensitive to pharmacological interference with the actin 110 cytoskeleton as well as chemical interference with secretory trafficking 111 mediated by small ARF1-type GTPases (Łangowski et al., 2010) Given the 112 limited number of studies performed, mechanisms mediating trafficking and 113 polarity of outer polar domain cargo still largely remain to be addressed The 114 last steps for a secretory vesicle carrying a transmembrane protein would be 115 tethering, docking and fusion with the target membrane during exocytosis 116 The tethering step may be facilitated by the exocyst tethering complex, a 117 conserved octameric protein complex in eukaryotes (Heider and Munson, 118 2012) Components of the exocyst complex, including EXO84b, EXO70A1 119 and others, are polarly localized at the outer lateral membrane of Arabidopsis 120 root epidermal cells (Fendrych et al., 2013) However, their functions in 121 establishment of outer membrane cargo polarity remain to be further explored 122 Here, we examine mechanisms underlying PEN3 trafficking to and its polar 123 localization at the outer lateral membrane domain 124 125 126 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 127 RESULTS 128 129 PEN3 endocytosis from and recycling to the outer lateral membrane 130 In contrast to apical and basal membrane cargos that largely rely on endocytic 131 trafficking or recycling for their polarity establishment (Geldner et al., 2001; 132 Geldner et al., 2003), polar delivery to the outer membrane domain in the root 133 epidermis has been suggested to be mainly mediated by polar secretion 134 (Łangowski et al., 2010) This interpretation is based on treatment of 135 Arabidopsis seedlings with the vesicle trafficking inhibitor brefeldin A (BFA; 136 Łangowski et al., 2010) BFA targets guanine nucleotide exchange factors 137 (GEFs) that regulate the activity of ADP-ribosylation factor (ARF)-type small 138 GTPases (Steinmann et al., 1999; Robineau et al., 2000; Geldner et al., 139 2003) BFA action may affect the secretory and/or endocytic recycling 140 pathway, depending on the BFA sensitivity of a given ARF GEF expressed in 141 a specific tissue and its respective action in a given trafficking pathway 142 (Richter et al., 2007) Compared to control cells treated with DMSO solvent 143 only (Fig 1A), a functional PEN3-green fluorescent protein (GFP) fusion 144 (PEN3-GFP) expressed from its own promoter (Stein et al., 2006), 145 accumulated in endomembrane agglomerations (so-called BFA compartments 146 or BFA bodies) upon BFA treatment, while PEN3-GFP polarity was not 147 affected in epidermal cells (Fig, 1B), consistent with previous observations 148 (Łangowski et al., 2010) After pre-treating seedlings with the protein 149 translation inhibitor cycloheximide (CHX) followed by co-treatment with CHX 150 and BFA, we found that this reduced the size and fluorescence intensity of 151 PEN3-GFP labeled BFA compartments (Fig 1, C and D) However, 152 quantitative and statistical analyses revealed that a significant number of BFA 153 compartments remained despite CHX co-treatment (Fig 1, I to K; 154 Supplemental Tables S1 and S2) We confirmed that CHX treatment targeted 155 translation of PEN3-GFP cargo contributing to secretory trafficking (see 156 below) Our findings indicate that in addition to the secretory pathway that we 157 find contributes to PEN3-GFP accumulation in BFA compartments as 158 previously highlighted (Łangowski et al., 2010), other trafficking pathways 159 such as endocytic trafficking may be involved as well 160 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 161 To address a potential contribution of endocytosis, we applied the endocytosis 162 inhibitor Wortmannin (Wm) which targets phosphoinositide (PI3)-kinases 163 (Volinia et al., 1995; Emans et al., 2002; Jaillais et al., 2006) When compared 164 to BFA treatment only (Fig 1B), Wm pre-treatment followed by combined Wm 165 and BFA treatment efficiently inhibited PEN3-GFP accumulation in BFA 166 compartments (Fig 1, E and F, arrowheads in 1F), as investigated by 167 quantitative and statistical analyses of the number of BFA bodies per root, the 168 area size of BFA compartments and their relative signal intensity (Fig 1, I to 169 K; Supplemental Tables S1 and S2) When using combined application of Wm 170 and CHX pretreatment followed by Wm, CHX and BFA, BFA compartment 171 formation was even further reduced (Fig 1, G to K; Supplemental Tables S1 172 and S2) These findings indicated a contribution of both the secretory and the 173 endocytic pathways to PEN3 accumulation in BFA compartments 174 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 175 To more directly monitor PEN3 endocytosis and recycling, we generated 176 plants expressing PEN3 fused to the green-to-red photo-convertible 177 fluorescent protein mEos2 (McKinney et al., 2009) under the control of the 178 PEN3 promoter (pPEN3:PEN3-mEos2; Fig 2A) The PEN3-mEos2 fusion 179 protein proved to be functional, restoring the long-root-hair phenotype of the 180 pen3-4 mutant to wild-type levels (Supplemental Fig S1, A and B) Similarly, 181 we generated a functional pPEN3:PEN3-mCherry in pen3-4 which reduced 182 the root hair length of the pen3-4 mutant even somewhat below wild-type 183 levels (Supplemental Fig S1, B and C) The subcellular distribution of PEN3- 184 mCherry in root epidermal cells was indistinguishable from functional PEN3- 185 GFP (Supplemental Fig S1D) described previously (Stein et al., 2006) In 186 order to track PEN3 endocytosis, we photo-converted PEN3-mEos2 at a 187 selected PM region (Fig 2, A and B) and monitored its trafficking in presence 188 of BFA Within 34 minutes after BFA treatment, the photo-converted red form 189 of PEN3-mEos2 (PEN3-mEos2-R, magenta, middle panel; Fig 2C) 190 accumulated inside BFA compartments together with the green form (green, 191 left panel; Fig 2C) We quantified the fluorescence intensity of photo- 192 converted PEN3-mEos2 both at the PM and in BFA compartments After 193 photo-conversion, PEN3-mEos2-R intensity was significantly increased at the 194 PM 195 compartments monitored at 30 ± after BFA application, when compared 196 to the time point directly after photo-conversion (Fig 2E), while the PEN3- 197 mEos2-R intensity at the PM was significantly decreased at 30 ± min, 198 demonstrating endocytosis of red-fluorescent PEN3-mEos2 from the outer 199 lateral PM (Fig 2, D and E) To test for potential recycling, we treated 200 seedlings with BFA to accumulate PEN3-mEos2 in BFA compartments, then 201 washed out BFA and, immediately after wash out, photo-converted PEN3- 202 mEos2 localized in BFA compartments (Fig 2, F and G) Strikingly, we 203 observed a re-accumulation of red-fluorescent PEN3-mEos2 at the outer 204 lateral PM (Fig 2, H and I), although the fluorescence intensity decreased 205 again after 60 (Fig 2I), probably due to endocytosis and/or additional 206 photo-bleaching Taken together, our findings strongly suggest that PEN3 is 207 endocytosed from and recycled back to the outer lateral PM domain (Fig 2D) PEN3-mEos2-R strongly accumulated inside BFA 208 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 209 PEN3 endocytic and secretory trafficking via the trans-Golgi network 210 In addition to its polar localization at the outer lateral PM, PEN3-GFP 211 accumulated in intracellular membrane compartments (Fig 3, A and B) 212 Biochemical co-purification experiments of PEN3 with the TGN-localized 213 SYP61 syntaxin suggest that these intracellular compartments include TGN 214 membranes (Drakakaki et al., 2012) To investigate whether PEN3 localizes 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 215 to the TGN in vivo, we generated transgenic plants co-expressing PEN3-GFP 216 and the TGN markers VHA-a1-mRFP (Dettmer et al., 2006) or Vti12- 217 mCherry/WAVE13R (Geldner et al., 2009) Indeed, cytoplasmic PEN3-GFP 218 co-localized with both VHA-a1-mRFP (Fig 3A) as well as Vti12- 219 mCherry/WAVE 13R (Fig 3B) Quantitative co-localization analyses of the 220 geometrical centers of compartments labeled in two different channels, 221 revealed 46% of intracellular PEN3-GFP to co-localize with VHA-a1-mRFP 222 and 50% with Vti12-mCherry/WAVE 13R (Fig 3C) We also co-expressed 223 PEN3-GFP with SYP61-CFP (Robert et al., 2008) and the cis-Golgi marker 224 SYP32-mCherry/WAVE22R (Geldner et al., 2009) Strikingly, PEN3-GFP 225 fluorescence in endomembrane compartments overlapped with SYP61-CFP 226 but was regularly flanked only by the SYP32-mCherry/WAVE22R signal (Fig 227 3D) This became even more evident after BFA treatment, when PEN3-GFP 228 and SYP61-CFP strongly co-aggregated in the core of BFA bodies, which was 229 surrounded by SYP32-mCherry/WAVE22R labeled Golgi bodies (Fig 3E) 230 These 231 agglomeration of TGN-derived material in the core of BFA compartments and 232 the positioning of Golgi stacks at the periphery of BFA compartments (Grebe 233 et al., 2003; Geldner et al., 2003) Quantitative analysis of non-treated cells observations were highly similar to the previously reported 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 234 showed that 48% of intracellular PEN3-GFP co-localized with SYP61-CFP 235 compared to 22% co-localizing with SYP32-mCherry/WAVE22R (Fig 3C) 236 Our results demonstrate that PEN3-GFP preferentially localizes to TGN 237 compartments, providing in vivo support for previous biochemical membrane 238 isolation studies (Drakakaki et al., 2012) 239 240 In light of PEN3-GFP localization to the TGN, we investigated whether PEN3 241 secretory and/or endocytic trafficking occurred via this intracellular sorting 242 hub About after application of the widely used endocytic tracer FM4-64 243 (Vida and Emr, 1995), we observed PEN3-GFP co-localization with FM4-64 244 (Fig 4A) Such rapidly FM4-64-labeled membranes have previously been 245 identified as VHA-a1-positive TGN/early endosomal compartments (Dettmer 246 et al., 2006) After BFA treatment, PEN3-GFP and FM4-64 co-aggregated in 247 the core of BFA compartments (Fig 4B) These findings strongly support that 248 PEN3 traverses a TGN compartment involved in early endocytic trafficking 249 We next tested the effect of Concanamycin A (ConcA), a specific inhibitor of 250 V-ATPase that can block secretory and endocytic trafficking at the TGN 251 (Drose et al., 1993; Dettmer et al., 2006) After ConcA treatment, PEN3-GFP 252 formed intracellular agglomerations, most of which overlapped with VHA-a1- 253 mRFP (Fig 4C), indicating that ConcA blocked PEN3-GFP at the TGN 254 Strikingly, CHX co-treatment greatly reduced PEN3-GFP, in the ConcA- 255 induced agglomerations (Fig 4, D to G), indicating that most PEN3-GFP in 256 these agglomerations was derived from de novo-synthesized protein VHA- 257 a1-mRFP was less affected (Fig 4, D to G), most likely, because it prevalently 258 resides at the TGN at steady state Similarly outer lateral membrane 259 localization of PEN3-GFP appeared unaffected (Fig 4D) These findings 260 confirmed efficient CHX action on PEN3-GFP synthesis Together, our results 261 strongly suggest that both endocytic and secretory trafficking contribute to 262 PEN3 aggregation in BFA-induced compartments as well as to its localization 263 at the TGN 264 265 ACT7 mediates TGN-PM trafficking of outer lateral membrane cargo 266 To investigate potential cytoskeletal requirements of PEN3 trafficking to and 267 from the TGN, we applied inhibitors affecting microtubule (MT) or actin 10 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 738 ligation at the SmaI site The coding sequence of mEos2 (McKinney et al., 739 2009) was amplified from Addgene plasmid 20341, pRSETa mEos2 740 (https://www.addgene.org/20341/), employing primers BamHIEOS2F3, 5’- 741 GGATCCGCTGCTGCCGCTGCCGCTGCGGCAGCGGCCGGACCGGTCGC 742 CACCATGAGTGCGATTAAGCCAGACATGAAGA-3’ and SalIEos2R2, 5’- 743 ttgtcgacTTATCGTCTGGCATTGTCAGGCAATCC-3’ In this way, 15 amino 744 acids serving as a linker between PEN3 and mEos2 were added prior to the 745 ATG of mEos2 The resulting fragment was also subcloned into pBluescript 746 SKII Finally, PEN3PC in pGREENII0029 was digested by EcoRI and BamHI, 747 mEos2 in pBluescript SKII was digested by BamHI and SalI, and the 3’UTR in 748 pBluescript SKII was digested by SalI and KpnI These three fragments were 749 concomitantly ligated into pGREENII0029 digested by EcoRI and KpnI The 750 same procedure was used to generate the PEN3-mCherry fusion, but without 751 inserting a linker between PEN3 and mCherry 752 753 To generate an H2B fusion to mCherry, the vector pGreenII0179 (John Innes 754 Centre, Norwich, UK; Hellens et al., 2000) was digested with KpnI and SacI to 755 remove the multiple cloning site, and both 5’ and 3’ overhangs were blunted 756 for blunt-end ligation A 35S-CaMV cassette (John Innes Centre; Hellens et 757 al., 2000), including a CaMV 35S promoter and a CaMV terminator derived 758 from vector p35S-2 (John Innes Centre; Hellens et al., 2000) was excised with 759 EcoRV and cloned into the blunted pGreenII0179 vector (John Innes Centre; 760 Hellens et al., 2000) generating pGreenII0179_35S-CaMV An Arabidopsis 761 thalliana HISTONE2B cDNA fragment followed by the sequence encoding for 762 a poly-alanine linker and the Venus coding sequence was synthesized with 763 XbaI and EcoRI sites (Genscript, Piscataway, NJ, USA) and cloned into 764 pGreenII0179_35S-CaMV 765 pGreenII0179_35S::H2B-Venus An mCherry fragment with poly-alanine 766 linker was amplified by PCR from synthesized mCherry-LTI6a cloned into 767 pUC57 (Genscript, Piscataway, NJ, USA), employing forward primer 768 H2B_Cherry_F, 769 GCGGCCGCTGCCGCTGCGGCAGCGGCCatggtgagcaagggcgagg-3’ 770 reverse primer H2B_Cherry_R, 5’-TTACTTGTACAGCTCGTCCATGC-3’, and 771 subcloned into pBluescriptII SK(-) (Stratagene, La Jolla, CA, USA) To obtain via XbaI and EcoRI giving rise 30 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved to 5’and 772 the H2B fused to mCherry, the region of Venus in pGreenII0179_35S::H2B- 773 Venus 774 (pGreenII0179_35S::H2B-mCherry) was replaced with mCherry with NotI and BsrGI 775 776 Phusion DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA) was 777 used in all PCR reactions Restriction enzymes were purchased from 778 Fermentas (Thermo Fisher Scientific) Synthetic oligonucleotides were 779 obtained from MWG (MWG, Biotech AG, Ebersberg, Germany) Plasmid 780 constructs were sequenced by MWG and introduced into Agrobacterium 781 tumefaciens GV3101, which were used to transform Arabidopsis thaliana Col- 782 by floral dipping (Clough and Bent, 1998) 783 784 Genetic screen for subcellular PEN3-GFP mis-localization 785 Plasmid 786 Agrobacterium tumefaciens strain GV3101 and introduced into pPEN3:PEN3- 787 GFP; pen3-1 (Stein et al., 2006) employing the floral dip method (Clough and 788 Bent, 1998) Transgenic plants were selected based on resistance to 20 µg/ml 789 hygromycin 790 homozygous for both transgenes and stably expressing both the PEN3-GFP 791 and the H2B-mCherry fusion proteins with no abnormality in localization was 792 chosen for mutagenesis More than 8,000 T4 seeds were immersed in 0.3% 793 (v/v) ethyl methanesulfonate (EMS; Sigma-Aldrich) in sterile ddH2O for 12 794 hours at room temperature, followed by eight washes with sterile ddH2O The 795 resulting M1 seeds were immediately surface sterilized and plated on MS 796 plates M1 seedlings were vertically grown on MS plates for more than days 797 under growth condition described above and transferred to soil Seeds were 798 independently harvested from 8,000 individual M1 plants About 1,200 799 independent M2 lines were screened for mis-localization of PEN3-GFP To 800 this end, about 30 seedlings of each independent M2 line (about 36,000 M2 801 seedlings in total) were examined using a Leica TCS SP2 AOBS spectral 802 confocal laser scanning system act7-8, act7-9 and act7-10 were isolated as 803 lines displaying aberrant localization of PEN3-GFP As the overall seedling 804 morphology of these mutants resembled act7, act7-8 was crossed to act7-6 805 which failed to complement the PEN3-GFP mis-localization phenotype in the pGreenII0179_35S::H2B-mCherry (Duchefa Biochemie, Haarlem, was transformed Netherland) A T4 31 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved into line 806 F1 indicating allelelism The coding sequence of ACT7 was amplified and 807 sequenced revealing the above-described mutations Further analyses were 808 performed in the act7-6 T-DNA insertion mutant background characterized 809 previously (Kiefer et al., 2015) 810 811 Accession Numbers 812 Sequence data from this article can be found in the Arabidopsis Genome 813 Initiative or GenBank/EMBL databases under the following accession 814 numbers: PEN3 (At1g59870), VHA-a1 (At2g28520), SYP61 (At1g28490), 815 SYP32 (At3g24350), ACT2 (At3g18780), ACT7 (At5g09810), EXO84b 816 (At5g49830), VTI12 (At1g26670), H2B (At5g22880) and TUA5 (At5g19780) 817 818 Supplemental Data 819 The following supplemental materials are available 820 Supplemental Figure S1 Complementation of the pen3-4 long-root-hair 821 phenotype 822 Supplemental Figure S2 Contributions of the actin and tubulin 823 cytoskeletons to outer lateral membrane protein trafficking 824 Supplemental Figure S3 ACT7 is required for trafficking of PM proteins 825 including outer lateral membrane domain proteins 826 Supplemental Figure S4 Whole-cell FRAP analyses of PEN3-GFP in wild 827 type and exo84b-1 cells (additional data points) 828 Supplemental Figure S5 EXO84b mediates EGFP-LTI6a localization at 829 the plasma membrane 830 Supplemental Table S1 Significant differences between the average 831 number of BFA bodies per root 832 Supplemental Table S2 Significant differences between BFA body size or 833 fluorescence intensity per BFA body among treatments 834 Supplemental Movie PEN3-GFP in exo84b-1 in green channel 835 Supplemental Movie PEN3-GFP in exo84b-1 in gray channel 836 837 838 32 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 839 Acknowledgments 840 We thank David Ehrhardt, Niko Geldner, Natasha Raikhel, Staffan Persson, 841 Karin Schumacher, Shauna Somerville and Viktor Žárský for sharing 842 published materials We thank the Nottingham Arabidopsis Stock Centre for 843 providing seed stocks We thank Jürgen Hartmann at the Max Planck Institute 844 of Colloids and Interfaces, Potsdam-Golm, Germany, for providing access to 845 high-pressure freezing equipment for sample preparation for electron 846 microscopy We thank Stefano Pietra and Michael Sauer for critical reading of 847 the manuscript 848 849 Competing interests 850 The authors declare no competing financial interests 851 852 853 FIGURE LEGENDS 854 855 Figure Pharmacological interference indicates contributions of secretory 856 and endocytic pathways to PEN3 trafficking 857 A to H, Root epidermal cells of five-day-old Arabidopsis thaliana seedlings 858 expressing PEN3-GFP treated with (A) 60 0.2% DMSO, (B) 60 50 859 μM brefeldin A (BFA), (C) 60 50 μM cycloheximide (CHX), (D) 60 50 860 μM CHX pre-treatment, followed by 60 50 μM CHX, 50 μM BFA, (E) 60 861 33 μM Wortmannin (Wm), (F) 60 33 μM Wm pre-treatment followed 862 by 60 33 μM Wm, 50 μM BFA, (G) 60 33 μM Wm, 50 μM CHX, (H) 60 863 33 μM Wm, 50 μM CHX pre-treatment followed by 60 33 μM Wm, 50 864 μM CHX, 50 μM BFA I to K, Quantitative and statistical analysis of (I) BFA 865 bodies per root, (J) BFA body size, (K) fluorescence intensity per BFA body 866 from experiments such as B, D, F, H from one mid-plane optical CLSM 867 section of n = 20 roots per condition Images were acquired between 60 ± 868 after BFA application (60’) Note, very small BFA bodies in F 869 (arrowheads) and no BFA body in H I, Student’s two-tailed t-test with equal 870 variance was used to detect significances of differences between average 871 number of BFA bodies from n = 20 roots per treatment ** indicates P < 0.01 * 872 indicates P < 0.05 Exact P values are shown in Supplemental Table S1 33 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 873 Statistical differences of BFA body size (J) and fluorescence intensity per BFA 874 body (K) between treatments were determined by non-parametric, two-sample 875 Kolmogorov–Smirnov (K–S) test ** indicates P = 0.000 Exact P values are 876 shown in Supplemental Table S2 Total numbers of BFA bodies analyzed 877 were (B) n = 743 for BFA treatment, (D) n = 639 for CHX and BFA treatment, 878 (G) n = 470 for Wm and BFA treatment, (H) n = 326 for Wm, CHX and BFA 879 treatment Scale bars, 10 μm 880 881 Figure PEN3-mEos2 endocytosis from and recycling to the outer lateral 882 membrane 883 A to E, PEN3-mEos2 (P3-Eos) internalization from the outer lateral domain 884 into BFA bodies after green-to-red photo-conversion in the indicated region of 885 interest (ROI) frame A to C, PEN3-mEos2 treated with 50 μM BFA after 886 photo-conversion Time points (A) prior to (pre) photo-conversion, (B) after 887 photo-conversion (0’) and (C) after application of 50 μM BFA (34’) are 888 indicated D and E, Quantitative and statistical analysis of photo-converted 889 PEN3-mEos2 (PEN3-Eos-R) intensity at (D) the plasma membrane (PM) or 890 (E) in BFA compartments (BC) Box-and-whiskers plots are displayed for n = 891 10 cells prior to photo-conversion (pre), directly after photo-conversion (0 min) 892 and 30 after photo-conversion Whiskers indicate maximum and minimum 893 values of the population Violet boxes, 25% of values above median Green 894 boxes, 25% of values below median Data is derived from CLSM images such 895 as in A-C Images at 30 were acquired between 29 - 34 after BFA 896 application Statistical differences were determined by two-tailed, type 897 paired t-test with n = 10 cells (from seven roots) D, **P = 0.000 pre versus 898 min; *P = 0.003 versus 30 E, *P = 0.001 pre versus min; **P = 899 0.000 versus 30 F to I, PEN3-mEos2 recycling from a BFA body to 900 the outer lateral PM after photo-conversion After 60 of 50 μM BFA pre- 901 treatment followed by BFA washout, photo-conversion was conducted 902 between pre (F) and 0’ (G) after BFA wash out PEN3-mEos2 redistribution 903 monitored at indicated time points after BFA wash out n = 17 cells (from 15 904 roots) were observed with similar results Scale bars, 10 μm 905 34 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 906 Figure Cytoplasmic PEN3 preferentially co-localizes with trans-Golgi 907 network markers 908 A and B, CLSM co-localization analyses in root epidermal cells of five-day-old 909 seedlings (A) co-expressing PEN3-GFP (P3-G, green) with VHA-a1-mRFP 910 (Va1-R, magenta); and (B) with VTI12-mCherry/WAVE13R (Vti12-mCh, 911 magenta) C, Quantitative co-localization analysis given as the percentage 912 (%) of intracellular PEN3-GFP co-labeled with marker compartments Data is 913 derived from CLSM images such as in A, B and D with averages ± SD given 914 for n = 15 cells per marker D and E, Co-localization analysis of TGN marker 915 SYP61-CFP (SYP61-C, blue), PEN3-GFP (green) and Golgi marker SYP32- 916 mCherry/WAVE-22R (S32-mCh, magenta) (D) after 37 of 0.1% DMSO 917 and (E) 37 50 μM BFA Scale bars, 10 μm 918 919 Figure PEN3 endocytic and secretory trafficking via the trans-Golgi 920 network 921 A, Untreated cells expressing PEN3-GFP (P3-G, green) labeled with FM4-64 922 (FM, magenta) for B, Cells expressing PEN3-GFP treated with BFA for 923 30 in presence of FM4-64 Images at 30 were acquired between 27 - 924 32 after BFA application n = independent roots analyzed with similar 925 results C, Cells co-expressing PEN3-GFP (P3-G, green) and VHA-a1-mRFP 926 (Va1-R, magenta) treated for 70 with μM concanamycin A (ConcA) D, 927 Cells co-expressing PEN3-GFP (P3-G, green) and VHA-a1-mRFP (Va1-R, 928 magenta) pre-treated 45 50 μM CHX followed by 70 μM ConcA, 50 929 μM CHX Images at 70 were acquired between 65 - 75 after ConcA 930 application E to G, Quantitative and statistical analysis of average 931 intracellular fluorescence intensity per cell of PEN3-GFP (E, F) and for (E, G) 932 VHA-a1-mRFP from experiments such as in C, D from one mid-plane CLSM 933 section per root n = 73 cells from 10 roots per treatment Statistical 934 differences were determined by non-parametric, two-sample Kolmogorov– 935 Smirnov (K–S) test **P = 0.000 Scale bars, 10 μm 936 937 Figure F-actin contributes to PEN3 endocytic trafficking and recycling 938 A to L, Root epidermal cells of five-day-old seedlings A to D, Cells expressing 939 PEN3-GFP (P3-G, green) pre-treated 30 0.1% DMSO, followed by 25 μM 35 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 940 FM4-64 (FM, magenta) and two washes E to H, Cells expressing PEN3-GFP 941 pre-treatment 30 10 μM Latrunculin B (LatB), followed by 25 μM FM4-64 942 and two washes in presence of 10 μM LatB (+LatB) Time points after washes 943 are indicated n = independent roots analysed with similar results I to L, 944 PEN3-mEos2 recycling from a BFA body to the outer lateral PM after photo- 945 conversion After 60 of 50 μM BFA pre-treatment followed by BFA 946 washout in presence of 10 μM LatB, photo-conversion was conducted I, Prior 947 to photo-conversion (pre) J, Immediately after photo-conversion (0’) PEN3- 948 mEos2 redistribution monitored at indicated time points after BFA wash out n 949 = 17 cells (from 14 roots) were observed M, Statistical analysis of red 950 fluorescent photo-converted PEN3-mEos2 (PEN3-Eos-R) relative intensity 951 redistribution at the outer lateral PM domain after 30 and 60 BFA 952 washout in presence or absence of LatB (-LatB or +LatB), respectively 953 Intensity of PEN3-Eos-R fluorescence at PM after 30 or 60 BFA 954 washout (Itx) divided by the respective PM intensity immediately after photo- 955 conversion (It0) is presented as PEN3-Eos-R PM intensity ratio relative to t0 956 (Itx/It0) Box-and-whiskers plots are displayed for n = 17 cells Whiskers 957 indicate maximum and minimum values Violet boxes, 25% of values above 958 median Green boxes, 25% of values below median Data is derived from 959 CLSM images such as in I-L for +LatB or Figures 2F-2I for the -LatB control 960 Statistical differences between Itx/It0 ratios at different time points were 961 determined by two-tailed, unpaired t-test with equal variance **P = 0.003 - 962 LatB versus +LatB at 30 min; *P = 0.019 -LatB versus +LatB at 60 Scale 963 bars, 10 μm 964 965 Figure ACT7 mediates outer lateral membrane protein trafficking from the 966 TGN 967 A to D, Subcellular PEN3-GFP localization in (A) act7-8, (B) act 7-9, (C) act7- 968 and (D) act7-6/act7-8 transheterozygote E and F, NIP5;1-mCherry (N5- 969 mCh) in (E) wild type, (F) act7-6 Note, large subcellular aggregations of 970 PEN3-GFP in A-D and of NIP5;1-mCherry in F in act7 mutants G and H, 971 PEN3-GFP co-aggregation with (G) VHA-a1-mRFP (Va1-R) but not with (H) 972 SYP32-mCherry/WAVE22R (S32-mCh) in act7-6 I to L, Pre-treatment 30 973 0.1% DMSO followed by 25 μM FM4-64 (FM) and two washes n = 36 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 974 independent roots observed with similar results M to P, PEN3-mEos2 (P3- 975 Eos) in act7-6 Distinct small dots of autofluorescence are visible (middle 976 panel, right panel merge) Different time points after photo-conversion to red 977 (N) directly after (0’), (O) 30 (30’) and (P) 65 (65’) after photo- 978 conversion Q and R, Quantitative and statistical analysis of photo-converted 979 PEN3-mEos2 (PEN3-Eos-R) intensity (Q) in ACT7-compartments (AC) and 980 (R) at the outer lateral PM Box-and-whiskers plots are displayed for n = 10 981 cells prior to photo-conversion (pre), directly after photo-conversion (0 min), 982 30 and 60 after photo-conversion Whiskers indicate maximum and 983 minimum values Violet boxes, 25% of values above median Green boxes, 984 25% of values below median Images at 30 acquired between 30 - 32 985 after photo-conversion Images at 60 acquired between 60 - 65 after 986 photo-conversion Data was derived from CLSM images such as in M-P n = 987 10 cells from nine independent roots analyzed Statistical differences were 988 determined by two-tailed, type paired t-test Q, **P = 0.000 pre versus 989 min; **P = 0.002 versus 30 min; *P = 0.037 30 versus 60 R, P 990 = 0.111 pre versus min; P = 0.121 versus 30 min; P = 0.935 30 991 versus 60 S to U, Ultrastructural analysis of intracellular vesicle 992 aggregate in act7-6 surrounded by Golgi stacks T, Golgi apparatus next to a 993 normal, tubular-vesicular trans-Golgi network/early endosome (TGN/EE) in a 994 wild-type Columbia-0 (WT) root meristematic cell S and U, Aberrant TGN/EE 995 composed of several vesicles but no tubular structures (arrowhead in U 996 compared to T) next to a morphologically normal Golgi (g) in act7-6 n = 997 five-day-old roots analyzed per genotype Scale bars, 10 μm in A to P; 200 998 nm in S to U 999 1000 Figure exo84b mutants display defective polar outer lateral membrane 1001 protein localization with preferential localization to the TGN 1002 A to G, Root epidermal cells of five-day-old seedlings A, PEN3-mCherry (P3- 1003 mCh, magenta) and EXO84b-GFP (Exo-G) at polar outer lateral PM domain 1004 B, PEN3-GFP (P3-G) in wild type C, PEN3-GFP (P3-G) in exo84b-1 Note, 1005 intracellular accumulation of PEN3-GFP, and loss of PEN3 polarity in one cell 1006 in C D, NIP5;1-mCherry (N5-mCh) in wild type E, NIP5;1-mCherry in 1007 exo84b-1 F and G, Cells expressing PEN3-GFP (P3-G, green) labeled with 37 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 1008 FM4-64 (FM, magenta) for in (F) wild type (WT) and (G) exo84b-1 (H), 1009 Quantification of the lateral PM domain/cytoplasmic PEN3-GFP signal 1010 intensity ratio in wild type (WT) and exo84b-1 Data is derived from CLSM 1011 images such as in F and G ** P = 0.000 WT versus exo84b-1, determined by 1012 Student’s two-tailed t-test with equal variance, n = 30 cells from 15 wild type 1013 roots and from 17 exo84b-1 roots I and J, Co-localization analyses in root 1014 epidermal cells of five-day-old exo84b-1 seedlings co-expressing (I) PEN3- 1015 GFP (P3-G, green) and VHA-a1-mRFP (Va1-R, magenta) (J) P3-G (green) 1016 and SYP32-mCherry/WAVE23R (S32-mCh, magenta) K, Quantitative co- 1017 localization analysis between intracellular PEN3-GFP and the VHA-a1 or 1018 SYP32 markers Data is derived from CLSM images such as in I and J ** P = 1019 0.000 VHA-a1 versus SYP32, determined by Student’s two-tailed t-test with 1020 equal variance Data was average ± SD from n = 15 cells per marker Scale 1021 bars, 10 μm 1022 1023 Figure Actin-dependent EXO84b mediates polar PEN3 polarity at the outer 1024 lateral membrane 1025 A and B, Representative images of whole-cell FRAP analyses of PEN3-GFP 1026 in (A) wild type (WT), (B) exo84b-1 Pre-bleach images (pre) with a 1027 rectangular bleach ROI are indicated Post-bleach time points during 1028 fluorescence recovery are indicated in minutes C, Quantitative analysis of 1029 FRAP experiments *** P = 0.000 WT versus exo84b-1, determined by 1030 Student’s two-tailed t-test with equal variance, n = 13 cells from six wild-type 1031 roots and n = 10 cells from five exo84b-1 roots The ratio of intensity of PEN3- 1032 GFP fluorescence at the outer lateral plasma membrane region to the inner 1033 lateral membrane region is indicated as the polar index Averages and ± SD 1034 are indicated with n = 13 and n = 10 for wild type and exo84b-1, respectively 1035 EXO84b-GFP localization in (D) wild type, (E) act7-6 mutant Note, signal 1036 clusters at the outer membrane in E F, Quantitative analysis of relative 1037 EXO84b-GFP 1038 fluorescence at the outer lateral PM domain was extracted using Fiji software 1039 and the outer membrane was evenly divided into twenty sections from basal 1040 to apical The mean fluorescence intensity of each section was divided by the fluorescence intensity Pixel intensity of EXO84b-GFP 38 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved 1041 mean intensity of outer lateral PM domain to obtain the relative fluorescence 1042 intensity Averages and ± SD are indicated with n = 16 cells from six wild-type 1043 roots and from seven act7-6 roots Student’s two-tailed t-test with equal 1044 variance was employed to detect significances of differences *** indicates P < 1045 0.001 ** indicates P < 0.01 * indicates P < 0.05 Scale bars, 10 μm 1046 1047 39 7, 2016 - Published by www.plantphysiol.org Downloaded from www.plantphysiol.org on November Copyright © 2016 American Society of Plant Biologists All rights reserved Parsed Citations Alassimone J, Naseer S, Geldner N (2010) A developmental framework for endodermal differentiation and polarity Proc Natl Acad Sci USA 107: 5214-5219 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Barberon M, Dubeaux G, Kolb C, Isono E, Zelazny E, Vert G (2014) Polarization of IRON-REGULATED TRANSPORTER (IRT1) to the plant-soil interface plays crucial role in metal homeostasis Proc Natl Acad Sci USA 111: 8293-8298 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Bendezú FO, Vincenzetti V, Martin SG (2012) Fission yeast Sec3 and Exo70 are transported on actin cables and localize the exocyst complex to cell poles PLoS One 7: e40248 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Blankenship JT, Fuller MT, Zallen JA (2007) The Drosophila homolog of the Exo84 exocyst subunit promotes apical epithelial identity J Cell Sci 120: 3099-3110 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Blilou I, Xu J, Wildwater M, Willemsen V, Paponov I, Friml J, Heidstra R, Aida M, Palme K, Scheres B (2005) The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots Nature 433: 39-44 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Boutté Y, Crosnier MT, Carraro N, Traas J, Satiat-Jeunemaitre B (2006) The plasma membrane recycling pathway and cell polarity in plants: studies on PIN proteins J Cell Sci 119: 1255-1265 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Boutté Y, Frescatada-Rosa M, Men S, Chow CM, Ebine K, Gustavsson A, Johansson L, Ueda T, Moore I, Jürgens G, Grebe M (2010) Endocytosis restricts Arabidopsis KNOLLE syntaxin to the cell division plane during late cytokinesis EMBO J 29: 546-558 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana Plant J 16: 735-743 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Dettmer J, Hong-Hermesdorf A, Stierhof YD, Schumacher K (2006) Vacuolar H+-ATPase activity is required for endocytic and secretory trafficking in Arabidopsis Plant Cell 18: 715-730 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Drakakaki G, van de Ven W, Pan S, Miao Y, Wang J, Keinath NF, Weatherly B, Jiang L, Schumacher K, Hicks G, Raikhel N (2012) Isolation and proteomic analysis of the SYP61 compartment reveal its role in exocytic trafficking in Arabidopsis Cell Res 22: 413424 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Drdova EJ, Synek L, Pecenkova T, Hala M, Kulich I, Fowler JE, Murphy AS, Žárský V (2013) The exocyst complex contributes to PIN auxin efflux carrier recycling and polar auxin transport in Arabidopsis Plant J 73: 709-719 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Drose S, Bindseil KU, Bowman EJ, Siebers A, Zeeck A, Altendorf K (1993) Inhibitory effect of modified bafilomycins and concanamycins on P- and V-type adenosinetriphosphatases Biochemistry 32: 3902-3906 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Emans N, Zimmermann S, Fischer R (2002) Uptake of a fluorescent marker in plant cells is sensitive to brefeldin A and wortmannin Plant Cell 14: 71-86 Pubmed: Author and Title CrossRef: Author and Title Downloaded from www.plantphysiol.org on November 7, 2016 - Published by www.plantphysiol.org Copyright © 2016 American Society of Plant Biologists All rights reserved Google Scholar: Author Only Title Only Author and Title Fendrych M, Synek L, Pecenkova T, Drdova EJ, Sekeres J, de Rycke R, Nowack MK, Žárský V (2013) Visualization of the exocyst complex dynamics at the plasma membrane of Arabidopsis thaliana Mol Biol Cell 24: 510-520 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Fendrych M, Synek L, Pecenkova T, Toupalova H, Cole R, Drdova E, Nebesarova J, Sedinova M, Hala M, Fowler JE, Žárský V (2010) The Arabidopsis exocyst complex is involved in cytokinesis and cell plate maturation Plant Cell 22: 3053-3065 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Frescatada-Rosa M, Stanislas T, Backues SK, Reichardt I, Men S, Boutté Y, Jürgens G, Moritz T, Bednarek SY, Grebe M (2014) High lipid order of Arabidopsis cell-plate membranes mediated by sterol and DYNAMIN-RELATED PROTEIN1A function Plant J 80: 745-757 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Fischer U, Ikeda Y, Ljung K, Serralbo O, Singh M, Heidstra R, Palme K, Scheres B, Grebe M (2006) Vectorial information for Arabidopsis planar polarity is mediated by combined AUX1, EIN2, and GNOM activity Curr Biol 16: 2143-2149 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Gälweiler L, Guan C, Müller A, Wisman E, Mendgen K, Yephremov A, Palme K (1998) Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue Science 282: 2226-2230 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Geldner N, Friml J, Stierhof YD, Jürgens G, Palme K (2001) Auxin transport inhibitors block PIN1 cycling and vesicle trafficking Nature 413: 425-428 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Geldner N, Denervaud-Tendon V, Hyman DL, Mayer U, Stierhof YD, Chory, J (2009) Rapid, combinatorial analysis of membrane compartments in intact plants with a multicolor marker set Plant J 59: 169-178 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Geldner N, Anders N, Wolters H, Keicher J, Kornberger W, Müller P, Delbarre A, Ueda T, Nakano A, Jürgens G (2003) The Arabidopsis GNOM ARF-GEF mediates endosomal recycling, auxin transport, and auxin-dependent plant growth Cell 112: 219-230 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Grebe M, Xu J, Möbius W, Ueda T, Nakano A, Geuze HJ, Rook MB, Scheres B (2003) Arabidopsis sterol endocytosis involves actin-mediated trafficking via ARA6-positive early endosomes Curr biol 13: 1378-1387 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Grebe M, Friml J, Swarup R, Ljung K, Sandberg G, Terlou M, Palme K, Bennett MJ, Scheres B (2002) Cell polarity signaling in Arabidopsis involves a BFA-sensitive auxin influx pathway Curr Biol 12: 329-334 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Gutierrez R, Lindeboom JJ, Paredez AR, Emons AM, Ehrhardt DW (2009) Arabidopsis cortical microtubules position cellulose synthase delivery to the plasma membrane and interact with cellulose synthase trafficking compartments Nat Cell Biol 11: 797-806 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Heider MR, Munson M (2012) Exorcising the exocyst complex Traffic 13: 898-907 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Hellens RP, Edwards EA, Leyland NR, Bean S, Mullineaux PM (2000) pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation Plant Mol Biol 42: 819-832 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Downloaded from www.plantphysiol.org 2016 Local - Published www.plantphysiol.org Ikeda Y, Men S, Fischer U, Stepanova AN, Alonso JM, Ljungon K,November Grebe M 7, (2009) auxinbybiosynthesis modulates gradientCopyright © 2016 American Society of Plant Biologists All rights reserved directed planar polarity in Arabidopsis Nat Cell Biol 11: 731-738 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Jaillais Y, Fobis-Loisy I, Miège C, Rollin C, Gaude T (2006) AtSNX1 defines an endosome for auxin-carrier trafficking in Arabidopsis Nature 443: 106-109 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Kiefer CS, Claes AR, Nzayisenga JC, Pietra S, Stanislas T, Hüser A, Ikeda Y, Grebe M (2015) Arabidopsis AIP1-2 restricted by WERmediated patterning modulates planar polarity Development 142: 151-161 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Kleine-Vehn J, Friml J (2008) Polar targeting and endocytic recycling in auxin-dependent plant development Annu Rev Cell Dev Biol 24: 447-473 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Langowski L, Ružicka K, Naramoto S, Kleine-Vehn J, Friml J (2010) Trafficking to the outer polar domain defines the root-soil interface Curr Biol 20: 904-908 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title McKinney SA, Murphy CS, Hazelwood KL, Davidson MW, Looger LL (2009) A bright and photostable photoconvertible fluorescent protein Nat Methods 6: 131-133 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Men S, Boutté Y, Ikeda Y, Li X, Palme K, Stierhof YD, Hartmann MA, Moritz T, Grebe M (2008) Sterol-dependent endocytosis mediates post-cytokinetic acquisition of PIN2 auxin efflux carrier polarity Nat Cell Biol 10: 237-244 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Michniewicz M, Zago MK, Abas L, Weijers D, Schweighofer A, Meskiene I, Heisler MG, Ohno C, Zhang J, Huang F, Schwab R, Weigel D, Meyerowitz, EM, Luschnig C, Offringa R, Friml J (2007) Antagonistic Regulation of PIN Phosphorylation by PP2A and PINOID Directs Auxin Flux Cell 130: 1044-1056 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Miwa K, Takano J, Omori H, Seki M, Shinozaki K, Fujiwara T (2007) Plants tolerant of high boron levels Science 318: 1417 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Müller A, Guan C, Gälweiler L, Tänzler P, Huijser P, Marchant A, Parry G, Bennett M, Wisman E, Palme K (1998) AtPIN2 defines a locus of Arabidopsis for root gravitropism control EMBO J 17: 6903-6911 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Nishimura T, Yokota E, Wada T, Shimmen T, Okada K (2003) An Arabidopsis ACT2 dominant-negative mutation, which disturbs Factin polymerization, reveals its distinctive function in root development Plant Cell Physiol 44: 1131-1140 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Richter S, Geldner N, Schrader J, Wolters H, Stierhof YD, Rios G, Koncz C, Robinson DG, Jürgens G (2007) Functional diversification of closely related ARF-GEFs in protein secretion and recycling Nature 448: 488-492 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Robert S, Chary SN, Drakakaki G, Li S, Yang Z, Raikhel NV, Hicks GR (2008) Endosidin1 defines a compartment involved in endocytosis of the brassinosteroid receptor BRI1 and the auxin transporters PIN2 and AUX1 Proc Natl Acad Sci USA 105: 84648469 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Robineau S, Chabre M, Antonny B (2000) Binding site of brefeldin A at the interface between the small G protein ADP-ribosylation factor (ARF1) and the nucleotide-exchange factor Sec7 domain Proc Natl Acad Sci USA 97: 9913-9918 Downloaded from www.plantphysiol.org on November 7, 2016 - Published by www.plantphysiol.org Copyright © 2016 American Society of Plant Biologists All rights reserved Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Ruzicka K, Strader LC, Bailly A, Yang H, Blakeslee J, Langowski L, Nejedla E, Fujita H, Itoh H, Syono K, Hejatko J, Gray WM, Martinoia E, Geisler M, Bartel B, Murphy AS, Friml J (2010) Arabidopsis PIS1 encodes the ABCG37 transporter of auxinic compounds including the auxin precursor indole-3-butyric acid Proc Natl Acad Sci U S A 107: 10749-10753 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Sampathkumar A, Lindeboom JJ, Debolt S, Gutierrez R, Ehrhardt DW, Ketelaar T, Persson S (2011) Live cell imaging reveals structural associations between the actin and microtubule cytoskeleton in Arabidopsis Plant Cell 23: 2302-2313 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Stein M, Dittgen J, Sanchez-Rodriguez C, Hou BH, Molina A, Schulze-Lefert P, Lipka V, Somerville S (2006) Arabidopsis PEN3/PDR8, an ATP binding cassette transporter, contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration Plant Cell 18: 731-746 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Steinmann T, Geldner N, Grebe M, Mangold S, Jackson CL, Paris S, Gälweiler L, Palme K, Jürgens G (1999) Coordinated polar localization of auxin efflux carrier PIN1 by GNOM ARF GEF Science 286: 316-318 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Strader LC, Bartel B (2009) The Arabidopsis PLEIOTROPIC DRUG RESISTANCE8/ABCG36 ATP binding cassette transporter modulates sensitivity to the auxin precursor indole-3-butyric acid Plant Cell 21: 1992-2007 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Takano J, Tanaka M, Toyoda A, Miwa K, Kasai K, Fuji K, Onouchi H, Naito S, Fujiwara T (2010) Polar localization and degradation of Arabidopsis boron transporters through distinct trafficking pathways Proc Natl Acad Sci USA 107: 5220-5225 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Uehara M, Wang S, Kamiya T, Shigenobu S, Yamaguchi K, Fujiwara T, Naito S, Takano J (2014) Identification and characterization of an Arabidopsis mutant with altered localization of NIP5;1, a plasma membrane boric acid channel, reveals the requirement for Dgalactose in endomembrane organization Plant Cell Physiol 55: 704-714 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Underwood W, Somerville SC (2013) Perception of conserved pathogen elicitors at the plasma membrane leads to relocalization of the Arabidopsis PEN3 transporter Proc Natl Acad Sci USA 110: 12492-12497 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Vida TA, Emr SD (1995) A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast J Cell Biol 128: 779792 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Volinia S, Dhand R, Vanhaesebroeck B, MacDougall LK, Stein R, Zvelebil MJ, Domin J, Panaretou C, Waterfield MD (1995) A human phosphatidylinositol 3-kinase complex related to the yeast Vps34p-Vps15p protein sorting system EMBO J 14: 3339-3348 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Wang YS, Yoo CM, Blancaflor EB (2008) Improved imaging of actin filaments in transgenic Arabidopsis plants expressing a green fluorescent protein fusion to the C- and N-termini of the fimbrin actin-binding domain New Phytol 177: 525-536 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Wisniewska J, Xu J, Seifertova D, Brewer PB, Ruzicka K, Blilou I, Rouquie D, Benkova E, Scheres B, Friml J (2006) Polar PIN localization directs auxin flow in plants Science 312: 883 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Zhang X, Zajac A, Zhang J, Wang P, Li M, Murray J, TerBush D, Guo W (2005) The critical role of Exo84p in the organization and Downloaded from www.plantphysiol.org on November 7, 2016 - Published by www.plantphysiol.org Copyright © 2016 American Society of Plant Biologists All rights reserved polarized localization of the exocyst complex J Biol Chem 280: 20356-20364 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Zhu J, Bailly AL, Zwiewka M, Sovero V, di Donato M, Ge P, Oehri J, Aryal B, Hao P, Linnert M, Burgardt N, Lucke C, Weiwad M, Michel M, Weiergraber, OH, Pollmann S, Azzarello E, Mancuso S, Ferro N, Fukao Y, Hoffmann C, Wedlich-Soldner R, Friml J, Thomas C, Geisler M (2016) TWISTED DWARF1 mediates the action of auxin transport inhibitors on actin cytoskeleton dynamics Plant Cell 28: 930-948 Pubmed: Author and Title CrossRef: Author and Title Google Scholar: Author Only Title Only Author and Title Downloaded from www.plantphysiol.org on November 7, 2016 - Published by www.plantphysiol.org Copyright © 2016 American Society of Plant Biologists All rights reserved ... 5’-gaattcATTAGAGCTCGAAACTGAGATGGA-3’ 726 CCATGAAGAGTGTCTTAGTAGGTCCA-3’; 727 TCTCAAAGTGAGTCCAACTCTCGCCT-3’ 728 ggatccTCTGGTCTGGAAGTTGAGAGTTCTGA-3’, 729 fragments were ligated at the overlapping XbaI site located... Only Author and Title Uehara M, Wang S, Kamiya T, Shigenobu S, Yamaguchi K, Fujiwara T, Naito S, Takano J (2014) Identification and characterization of an Arabidopsis mutant with altered localization... transport of abiotic compounds display polar 93 localization at the outer domain These include the ATP- binding cassette 94 (ABC) transporter PENETRATION3 (PEN3) /PDR8/ABCG36 (Strader and 95 Bartel,