original article © The American Society of Gene Therapy Expression of Long Anti-HIV-1 Hairpin RNAs for the Generation of Multiple siRNAs: Advantages and Limitations Masayuki Sano1,2, Haitang Li1, Mahito Nakanishi2 and John J Rossi1,3 Division of Molecular Biology, Beckman Research Institute of the City of Hope, Duarte, California, USA; 2Biotherapeutic Research Laboratory, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki, Japan; 3Division of Molecular Biology, Graduate School of Biological Science, Beckman Research Institute of the City of Hope, Duarte, California, USA Promoter expressed long-hairpin RNAs (lhRNAs) that can be processed into multiple small interfering RNA (siRNAs) are being considered as effective agents for treating rapidly mutating viruses such as human immunodeficiency virus (HIV) In the present study, we have generated human U6 promoter-driven lhRNAs of 50, 53, and 80 base pairs (bp) targeting contiguous sequences within the tat and rev genes of HIV-1 and evaluated the efficacy of these lhRNAs as well as their processing in cells By using multiple G:U mismatches in the stems, we have been able to readily incorporate the long-hairpin structures into a lentiviral vector transduction system Here we show that such long hairpins can be stably and functionally expressed for a long term in HIV-1 susceptible T cells, where they provide potent inhibition of HIV replication against both non-mutant and mutant variants of HIV-1 Our studies provide strong support for the use of the G:U wobble pair containing lhRNAs to generate multiple siRNAs from a single transcript, but we also show that lhRNAs of 80 bp may be the upper size limit for effectively producing multiple, functional siRNAs Received 18 May 2007; accepted August 2007; published online 28 August 2007 doi:10.1038/sj.mt.6300298 INTRODUCTION RNA interference (RNAi) is a eukaryotic regulatory mechanism that uses double-stranded RNA (dsRNA) molecules as triggers to direct homology-dependent, post-transcriptional gene silencing.1 Small interfering RNAs (siRNAs), are approximately 21–22 base pairs (bp) long; dsRNA molecules have characteristic nucleotide (nt) 3′ overhangs that allow them to be recognized by the enzymatic machinery of RNAi which leads to homology-dependent degradation of the target messenger RNA (mRNA).2 SiRNAs are produced from cleavage of longer dsRNA precursors by the RNase III endonuclease Dicer.3,4 In human cells, Dicer substrate recognition appears to be mediated via interactions with either one or both accessory RNA binding proteins, the TAR-RNA binding protein and PACT, which are presumably involved in the hand off of siRNAs to the RNA-induced silencing complex.5,6 Cleavageassisted removal of the passenger-strand leads to the activation of the RNA-induced silencing complex,7,8 where a catalytic endonuclease, AGO-2, cleaves the target mRNA.9,10 Synthetic siRNAs and expressed short hairpin RNAs (shRNAs) have been used to target virtually all of the human immunodeficiency virus (HIV)-encoded RNAs in cell lines, including tat, rev, gag, pol, nef, vif, env, vpr, and the long terminal repeat.11–15 Other studies have shown a host of other viruses, including the hepatitis B virus, hepatitis C virus, poliovirus and respiratory syncytial virus to be targeted by RNAi (recently reviewed in ref 16) Despite the early successes of RNAi-mediated inhibition of HIV-encoded RNAs in cell lines, targeting the virus directly presents a substantial challenge in clinical applications since the high viral mutation rate often leads to the outgrowth of mutants in the siRNA target sequences.17–19 In some cases, a single nucleotide mutation within the target site is sufficient to abolish the silencing efficacy of siRNAs or shRNAs.20,21 As with the conventional drugs used in the treatment of HIV infection, the best approach for preventing or delaying the emergence of escape mutants is to use multiplexed anti-HIV RNAi triggers or combinations of anti-HIV-1 RNAi approaches with other antiviral genetic elements.22,23 Use of a long hairpin RNA (lhRNA) is an attractive approach in controlling HIV-1 replication since a single long transcript can in theory be processed into multiple siRNAs It has recently been reported that lhRNAs of more than 50 bp, harboring multiple C to U (or A to G) mutations within the sense strand, can specifically inhibit gene expression without triggering type I interferon (IFN) gene expression.24 Multiple targeting can be achieved from a single long-hairpin precursor, suggesting that multiple siRNAs can be processed from the long hairpins in vivo This strategy has been applied in the inhibition of the hepatitis C virus and hepatitis B virus as well as in HIV-1 replication.25–27 Despite reports of transient target knockdown efficacy from previous studies, before this particular study was undertaken, the long-term expression and inhibitory function of lhRNAs in stably transduced cells had not been demonstrated Moreover, we also show that long hairpin containing lentiviral vectors can be packaged to generate vectors with titers similar to that of non-hairpin containing vectors, an Correspondence: John J Rossi, Division of Molecular Biology, Graduate School of Biological Science, Beckman Research Institute of the City of Hope, 1450 E Duarte Rd., Duarte, California 91010, USA E-mail: jrossi@coh.org 170 www.moleculartherapy.org vol 16 no 1, 170–177 jan 2008 © The American Society of Gene Therapy important consideration in gene therapy applications The processing patterns of siRNAs from long hairpins have been examined in transiently transfected cells27 but no attempts to monitor expression have been made in stable transduction settings We therefore set out to investigate the patterns of processing and functionality of expressed lhRNAs in both transiently transfected and stably transduced cells so as to better understand the mechanisms of action of expressed lhRNAs for use as anti-HIV agents In this study we show that lhRNAs generate a gradient of siRNAs through Dicer-mediated cleavage, suggesting a limitation in the maximum lengths of the hairpin structures for use in vivo Nevertheless, the stably expressed lhRNA targeting a tat/rev common exon can suppress HIV-1 replication for the long term without inducing type I IFN gene expression Moreover, the lhRNA is capable of effectively inhibiting the replication of an HIV-1 strain harboring a mutation in the tat/rev common exon, whereas a 21 bp shRNA targeting this exon failed to inhibit replication Given these attributes, we believe that there is a strong rationale for employing long hairpins in the treatment of HIV infection, and in other applications requiring simultaneous expression of two or three siRNAs RESULTS Efficient inhibition of HIV-1 gene expression by expressed lhRNAs We initially constructed vectors expressing either shRNAs or lhRNAs that target the essential viral regulatory genes, tat/rev (site I) and rev (site II), under the control of the human U6 promoter (Figure 1a) These target sequences have been previously identified as highly effective sites for RNAi mediated inhibition of HIV-1 replication.12 As controls, shRNAs (21 bp) harboring G: U wobble pairings were constructed for both the site I-tat/rev and site II rev targets To create the lhRNAs, we simply extended the 21 base sequences used in the shRNAs to be complementary to the targets 3′ of the 21-mer target sites This generated a 53 nt (site I-tat/rev) as well as 50 or 80 nt (site II-rev) hairpins Appropriate U or G residues were inserted within the sense strands to create G:U-U:G wobble pairings with the antisense strand (Figure 1b) To examine the RNAi activity of the lhRNAs, we first tested them using the non-infectious HIV-1 pNL4-3.Luc proviral DNA as a target This construct harbors the firefly luciferase gene in the place of the nef gene as well as frame-shift mutations within the vpr and env genes The pNL4-3.Luc plasmid, a separate plasmid encoding Renilla luciferase and the vectors expressing either shRNAs or lhRNAs were cotransfected into HEK293 cells The ratios of firefly luciferase versus Renilla luciferase activities were determined 24, 48 and 72 hours after transfection The shRNAs and lhRNAs targeting either site I or site II strongly inhibited the expression of firefly luciferase at each time point, with the lhRNAs inhibiting luciferase expression to approximately the same extent as the shRNAs at 72 hours post-transfection (Figure 2a) These results confirmed that the G:U wobble pairs within both the shRNAs and lhRNAs not impede RNAi Next, to examine the potential anti-HIV-1 inhibitory activities of the lhRNAs, we co-transfected each of the lhRNA expression vectors as well as the shRNA vectors with infectious HIV-1 pNL4-3 proviral DNA into HEK293 cells Two days post-transfection, supernatants Molecular Therapy vol 16 no jan 2008 Expression of Long Anti-HIV-1 Hairpin RNAs a LTR vpu gag pol rev tat vif Target site I b Site I LTR env vpr nef Target site II 21 53 SI probe SI probe SII probe SII probe SII probe 21 50 Site II 80 Figure 1 Schematic representation of human immunodeficiency virus (HIV)-1 targets and hairpin RNA constructs (a) The location of the hairpin RNA target sites, site I and site II, which are in the HIV-1 tat/rev common exon and rev exon, respectively (b) The sequences and predicted structures of short- and long-hairpin RNAs directed against site I and site II The superscripts in the sequence of the sense strands of the hairpin RNAs indicate altered nucleotides, which generate G:U wobble base-parings in the transcript The regions complementary to probes used in Northern blotting analysis are indicated by thick bars LTR, long terminal repeat were collected from the cell cultures and measurements of HIV-1 p24 viral antigen levels were carried out All of the shRNAs and lhRNAs potently inhibited HIV-1 replication in these co-transfections (Figure 2b) We next tried to find out if the lhRNAs were inducing a type I IFN responsive gene expression in HEK293 cells To this, we transfected the cells with shRNA or lhRNA expression vectors and monitored the expression of IFN-β, p56 and MxA mRNAs by quantitative real-time polymerase chain reaction (PCR) assays 48 h post-transfection Our results demonstrate that the lhRNAs not induce expression of the IFN-β, p56 and MxA mRNAs in this cell line (Figure 2d) To verify that HEK293 cells are capable of IFN mediated responses, cells were transfected with poly I:C, resulting in strong activation of the IFN responsive genes (Figure 2c) Expression profiles of siRNAs produced from lhRNAs We next examined the profiles of siRNAs produced from each of the lhRNAs using Northern blotting analyses HEK293 cells were transfected with either shRNA or lhRNA expression constructs and total RNAs were isolated, either 24 hours (site I) or 48 hours (site II) after transfection The RNAs were fractionated by electrophoresis and transferred to nylon membranes for probing with 32P labeled oligos complementary to the antisense strands of each of the putative siRNAs that could be derived from the hairpins Each of the probes used was non-overlapping and was complementary to a 21 nt sequence (Figure 1b) As shown in Figure 3a, each of the probes gave signals that corresponded to specific siRNAs For each of the lhRNAs, the strongest signal was obtained for the first 21 base sequence, with subsequent loss of intensity for the second siRNA and a greater reduction in signal intensity for the third siRNA produced from the 80 base lhRNA To exclude the possibility that the poor hybridization 171 © The American Society of Gene Therapy 60 40 SI probe2 SII probe1 30,000 SII probe2 SII probe3 20,000 10,000 20 SI probe1 C 80 a on SI tro I- l S I 21 I-5 SI I-8 C on SI tro I- l S I 21 I-5 SI I-8 C on SI tro I- l S I 21 I-5 SI I-8 40,000 C b 50,000 100 on SI trol -2 SI -5 C on SI trol -2 SI -5 120 p24 (pg/ml) a Relative luciferase activity (%) Expression of Long Anti-HIV-1 Hairpin RNAs * l tro 72 h I-8 SI -50 I SI -21 I SI on 48 h -5 SI 21 SI SI-53 SII-21 SII-50 SII-80 24 h C Control SI-21 d 3.0 1,000 100 10 Control IFN-� Poly I:C p56 MxA 2.5 2.0 1.5 1.0 0.5 U6 Control SI-21 SI-53 IFN-� SII-21 p56 SII-50 SII-80 MxA b psiCHECK-SI wt mut-1 mut-2 psiCHECK-SII wt mut-1 mut-2 c 140 120 100 80 60 40 20 SII-wt I-5 SII-21ol SI ntr o C SI-mut-2 I-5 SII-21ol SI ntr o C SI-mut-1 I-5 SII-21ol SI ntr o C 172 -5 SI 21 ol SI ntr o C SI-wt efficiency of probe to the complementary region was the reason for the weak signal, we designed two other probes, which partially overlapped probe and covered additional sequences (Supplementary Figure S1a) Northern analyses revealed no significant differences in signal intensities between these probes (Supplementary Figure S1a) Finally, we have carried out in vitro Dicing reactions using the lhRNA substrates (Supplementary Figure S5) For these experiments, we incubated in vitro transcribed long hairpins with recombinant human Dicer overnight The Diced RNAs were electrophoresed and blotted onto a nylon membrane The polarity that we observe in cell culture for processing of the third position of the 80 base lhRNA was observed in vitro Taken together these results strongly support the conclusion that processing of the hairpins by the Dicer is directional, beginning at the 5′ end of the duplex and proceeding towards the loop Moreover, the gradient of siRNAs produced -5 SI 21 ol SI ntr o C -5 SI 21 l - o SI ntr o C Figure 2 Inhibition of human immunodeficiency virus (HIV)-1 gene expression and monitoring for type I interferon (IFN) responses (a) Effects of short- and long hairpin RNA (lhRNA) expression vectors on the expression of pNL4-3.Luc transcripts The pNL4-3.Luc and Renilla luciferase expression plasmids were used along with the individual lhRNA and short hairpin RNA constructs in cotransfections of HEK293 cells Following the transfections, luciferase activities were determined at the indicated time points The luciferase activities of cells transfected with the empty vector were set at 100% for each time point, and relative luciferase activities of cells transfected with hairpin RNA expression vectors are indicated Values represent the means with standard deviations from three replicate experiments (b) Inhibition of HIV-1 p24 expression by lhRNAs HEK293 cells were cotransfected with pNL4-3 infectious proviral DNA along with the U6 empty vector or U6 hairpin RNA expression vectors Two days after transfection, supernatants were collected and p24 levels were determined The transfections were performed in duplicate and results are shown as the average values (c, d) The effects of lhRNA constructs on the levels of IFN-inducible messenger RNA (mRNA) HEK293 cells in each well of a 12-well plate were transfected with 0.2 µg poly I:C or 1 µg empty vector or hairpin-expression vector Twenty-four (poly I:C) or forty-eight (vector) hours after transfection, total RNA was isolated and the relative expression levels of IFN-β, p56 and MxA mRNAs were quantified by real-time polymerase chain reaction assays The levels of the IFN regulated mRNAs were normalized with the HPRT1 RNA The mRNA levels of cells transfected with the empty vector was set at 1, and relative mRNA levels are indicated The mean values and standard deviations from four (IFN-β) or three (p56 and MxA) replicate experiments are presented Relative luclferase activity (%) Relative mRNA levels Relative mRNA levels c 10,000 SII-mut-1 SII-mut-2 Figure 3 Processing of long-hairpin RNAs into multiple small interfering RNAs (siRNAs) (a) Detection of siRNAs in HEK293 cells transfected with each hairpin RNA expression vector Twenty micrograms of total RNA were electrophoresed in an 8% polyacrylamide-7M urea gel The separated RNAs were blotted onto nylon membranes and hybridized with the specific probes as illustrated in Figure 1b RNA extracted from cells transfected with the empty vector was used as a negative control U6 RNAs were probed as a loading standard Bands that correspond to siRNAs are indicated by an arrowhead Asterisks indicate non-specific bands (b) Sequences of DNA inserts used to create the reporter constructs Each synthesized DNA was inserted into the cloning site in the 3′UTR of the Renilla luciferase gene in the psiCHECK-2 plasmid Nucleotide changes from wild-type are underlined (c) Inhibition of reporter gene expression by the various hairpin constructs Each of the reporter constructs and hairpin RNA expression vectors were cotransfected into HEK293 cells, and luciferase activities were determined The luciferase activities determined from cells transfected with the empty plasmid were set at 100% The mean and standard deviations from three replicate experiments are presented www.moleculartherapy.org vol 16 no jan 2008 © The American Society of Gene Therapy Construction of lentiviral vectors expressing lhRNAs To evaluate the anti-HIV-1 activity of the lhRNAs in acute, longterm HIV-1 challenges, the genes encoding the lhRNAs or the shRNAs were inserted into the pHIV-7-GFP lentiviral vector The vectors were packaged and titered as described in the Materials and Methods section Following a 200-fold concentration of culture supernatant, approximately × 108 transduction units/ ml was achieved for vectors harboring lhRNAs as well as shRNAs Thus, the inclusion of a long hairpin did not significantly Molecular Therapy vol 16 no jan 2008 affect the packaging and transduction efficiencies of the lentiviral vector The packaged vectors were used to transduce human CEM T cells and the transduction efficiencies were determined by fluorescence activated cell sorting analyses of green fluorescent protein (GFP) expression At a multiplicity of infection of 10, the transduction efficiency for each of the hairpin constructs was approximately 90% (data not presented) To confirm that shRNAs or lhRNAs were expressed in transduced cells, total RNA was extracted from the transduced cells and probed for siRNA expression by Northern blotting Probe for either sI or sII, as shown in Figure 1b, yielded signals that corresponded to the cognate siRNAs in each of the lhRNA transduced cell lines, whereas probes and yielded signals in RNA preps from the lhRNA transduced cells but not the shRNA transduced cells (Figure 4a) Only weak hybridization signals corresponding to precursors were observed for each of the probes, suggesting that the hairpin precursor processing reaction is efficient in these stably transduced CEM T cells We next examined whether the lhRNAs were capable of inducing the expression of the IFN responsive genes, 2′,5′oligoadenylate synthetase (OAS1) and p56 in the transduced a SII probe2 SII probe3 c SI tor ISI 21 I-5 SI I-8 Ve c SI tor ISI 21 ISI 50 I-8 Ve c SI tor I-2 SI ISI 50 I-8 SII probe1 Ve Ve c SI tor -2 SI -5 Ve c SI tor -2 SI -5 SI probe1 SI probe2 SI -5 SI I-2 SI I-5 SI I-8 c -2 SI IF N Ve EM SI I-2 SI I-5 SI I-8 SI -5 c SI -2 N Ve EM Relative p56 mRNA level 18 16 14 12 10 C c 100 90 80 70 60 50 40 30 20 10 IF b Relative OAS1 mRNA level U6 C from these constructs also suggests that the polarity of Dicer processing could be a rate limiting step for the production of multiple siRNAs from a single long precursor, especially those longer than 80 bp To investigate whether the individual siRNAs (processed from the lhRNA precursors) had indeed functioned in triggering RNAi, we constructed psiCHECK reporter plasmids harboring target sequences complementary to the full length of the 50 bp lhRNAs, as well as targets in which the sequences complementary to the first siRNA were mutated (Figure 3b) These sequences were inserted within the 3′UTR of the Renilla luciferase gene for functional assays Each luciferase reporter plasmid was co-transfected into HEK293 cells with the vector expressing either the shRNA or lhRNA, and the ratios of Renilla luciferase versus firefly luciferase activities were determined 24 hours post-transfection The 21 bp shRNAs targeting site I and site II reduced the luciferase activity from psiCHECK-SI-wt and psiCHECK-SII-wt, respectively, but did not downregulate the luciferase from the other reporter plasmids harboring mutations in the target region (Figure 3c) In contrast, the lhRNAs targeting site I and site II, inhibited luciferase expression from both the wt- and mut-1-reporter plasmids, indicating that at least two different species of functional siRNAs could be generated during the processing of the lhRNAs Importantly, each lhRNA was less efficient at knocking down luciferase activity from the psiCHECK-mut-1 than the psiCHECK-wt, consistent with our observations of a gradient of siRNAs being produced from the hairpins The lhRNAs showed no reduction of luciferase activities from mut-2 reporter plasmids, reaffirming the specificity of the siRNAs for their cognate, fully complementary targets (Figure 3c) Northern blotting analysis revealed that the 80 bp lhRNA produced marginal levels of siRNAs from the region near the loop (Figure 3a and Supplementary Figure S1b) To examine whether these siRNAs contributed to the target knockdown, we once again used the psiCHECK reporter assay We constructed reporter plasmids with different short targets (Supplementary Figure S2a) and monitored the efficacy of each siRNA produced from the processing of the 80 bp lhRNA The inhibition of luciferase expression from the plasmid containing the sequence complementary to the third siRNA was 12%, whereas the inhibitory activities of luciferase expressed from the plasmids containing the sequences complementary to the first or second siRNAs were 97 and 91% respectively (Supplementary Figure S2b) The 50 bp lhRNA also efficiently inhibited luciferase expression from a plasmid that contained target These results suggest that Dicer processing rates decline somewhat dramatically after the second siRNA is processed Expression of Long Anti-HIV-1 Hairpin RNAs Figure 4 Processing of long-hairpin RNAs (lhRNAs) and measurements of type I interferon (IFN) response gene expression in stably transduced CEM T cells (a) Detection of small interfering RNAs produced from lhRNAs Total RNA was extracted from CEM T cells transduced with the lentiviral vectors harboring short hairpin RNA or lhRNA genes and Northern blotting analyses were performed with the specific probes shown in Figure 1b RNA prepared from cells transduced with the pHIV-7 lentiviral vector-backbone was used as a negative control U6 RNAs were probed as loading controls Bands that correspond to siRNA are indicated by the arrowhead (b) Effects of lhRNAs on the levels of OAS1 messenger RNA (mRNA) Total RNA was isolated from the vector-backbone- or hairpin RNA-transduced CEM T cells and the level of OAS1 was detected by real-time polymerase chain reaction The level of OAS1 mRNA was normalized to GAPDH mRNA An RNA extract from cells treated with 1,000 U/ml of IFN-α for 24 hours was used as a positive control The mRNA level of untransduced CEM T cells was set at 1, and the relative levels of mRNA are indicated The means and standard deviations from four replicate experiments are presented (c) Effects of lhRNAs on the levels of p56 mRNA The experimental procedures and values are the same as in (b) 173 © The American Society of Gene Therapy Expression of Long Anti-HIV-1 Hairpin RNAs a 109 109 108 107 107 106 Luminescence (RLU) Luminescence (RLU) 10 105 104 103 10 10 14 Days post-infection Vector SI-21 106 105 104 103 102 21 10 SI-53 Wt 10 Luminescence (RLU) 107 106 105 104 103 10 14 Days post-infection Vector SI-21 21 SI-53 Figure 5 Inhibition of human immunodeficiency virus (HIV)-1 infection in CEM T cells expressing anti-tat/rev hairpin RNAs (a) CEM T cells transduced with the vector-backbone or each of the hairpin RNA expression vectors were infected with HIV-1 IIIB at a multiplicity of infection of 0.01 Culture supernatants were collected on the days indicated and viral RNA levels were determined by a branched DNA assay (b) (top) The sequences of the site I target region of the 21 base pair short hairpin RNA in wild-type (Wt) and mutant (Mut) strains of HIV-1 IIIB Nucleotide mutations in the mutant strain are indicated by underlining (Bottom) Transduced CEM T cells challenged with the mutant HIV-1 IIIB isolate CEM T cells Quantitative real-time PCR assays revealed that stably expressed lhRNAs not induce expression of the OAS1 and p56 mRNAs (Figure 4b and c) To verify that CEM T cells are capable of IFN mediated responses, CEM cells were treated with IFN-α (1,000 U/ml), resulting in potent activation of the IFN responsive genes Other IFN-inducible mRNAs, MxA, and RIG-I, had no appreciable increases in CEM cells expressing lhRNAs (Supplementary Figure S3a and b) Effective suppression of acute HIV-1 infection in cells transduced with lhRNAs We next sought to demonstrate the antiviral activity of the lhRNA CEM T cells transduced with either the lhRNA or the shRNA, targeting sI-tat/rev, were challenged with HIV-1 IIIB (Figure 5a) or a variant harboring a mutation in the tat/rev common exon, which corresponds to the first siRNA produced from the lhRNA (Figure 5b) The lhRNA that targeted tat/rev provided over 3 logs 174 21 28 35 Days post-infection SI-21 41 48 SI-53 Figure 6 Long-term Inhibition of human immunodeficiency virus (HIV)-1 replication in CEM T cells expressing an anti-tat/rev long hairpin RNA (lhRNA) CEM T cells transduced with the vector-backbone, a short hairpin RNA or a lhRNA targeting the tat/rev common exon were infected with HIV IIIB at a multiplicity of infection of 0.001 Culture supernatants were collected on the days indicated and viral RNA levels were determined with the branched DNA assay system 108 10 14 Vector Mut b of inhibition of viral RNA production (relative to the controls) in both the wild-type and mutant viral challenges, whereas the shRNA that targeted tat/rev site I was only effective against the wild-type virus (Figure 5b) CEM T cells transduced with either the 50 bp or 80 bp lhRNA that targeted sII-rev also conferred resistance to virus infection up to 14 days after infection (Supplementary Figure S4) Importantly, both the lhRNAs that targeted sII-rev showed more potent inhibition than the shRNA To evaluate the anti-HIV-1 activity of the lhRNA under conditions of long-term incubation, we challenged CEM T cells transduced with either the shRNA or the lhRNA, that targetted sI-tat/rev, with HIV-1 IIIB at a multiplicity of infection of 0.001 As shown in Figure 6, the lhRNA maintained suppression of HIV-1 replication for over 6 weeks, whereas cells transduced with the single shRNA had a viral replicactive breakthrough on approximately day 41 The branched chain DNA assay used for these analyses quantitatively measures viral RNA production, thereby providing a stringent analysis of the antiviral activities of these constructs DISCUSSION It has been largely assumed that the application of long dsRNAs as RNAi triggers was only appropriate in undifferentiated embryonic stem cells and embryonic carcinoma cells due to their lack of IFNinducible gene expression.28,29 However, recent studies suggested that endogenously expressed long dsRNAs and lhRNAs not activate the IFN pathway, perhaps due to their being rapidly processed into siRNAs by Dicer.24,25,30–33 In the present study, we have shown that transiently or stably expressed lhRNAs with several G:U mismatches are processed into two or more siRNAs which can effectively suppress replication of HIV-1 We have demonstrated that the ability to produce two siRNAs from a single transcript has distinct advantages over a single siRNA, in conferring long-term repression of HIV-1 replication and inhibition of a virus harboring a mutation to one of the two siRNAs www.moleculartherapy.org vol 16 no jan 2008 © The American Society of Gene Therapy The use of G:U wobble pairings for the cloning and expression of lhRNAs may have several advantages over perfectly complementary lhRNAs For instance, the presence of wobble pairing (which in DNA is G:T) prevents the formation of thermodynamically stable hairpin structures which often result in deletions during plasmid propagation in Escherichia coli This feature also facilitates sequencing of these constructs, which is often a problem with perfectly complementary hairpin structures Previously published results from our lab and others show that an shRNA sequence encoded in a lentiviral vector results in reduced packaging titers.22,34 In the present study we have routinely obtained titers that are comparable to the backbone vector, perhaps owing to the G:U wobbles which lower the thermodynamic stabilities of the hairpins, thereby allowing more efficient reverse transcription Another possible advantage of using the G:U wobble pairing in the stem is that it may abrogate RNAi mediated cleavage of the vector transcripts, triggered by siRNAs produced from the hairpins, during the packaging reaction We thus believe that the incorporation of G:U wobble pairings in the sense strand of both shRNAs and lhRNAs has several advantages when the hairpins are going to be incorporated into lentiviral or retroviral vectors Most importantly, our stably integrated lhRNA expression cassettes produce efficacious levels of multiple siRNAs and confer long-term suppression of HIV replication (Figures 4a, 5a and 6) It has been suggested that endogenously expressed lhRNAs not activate the expression of type I IFN inducible genes in cultured cell lines.24,26,27 However, in some cases, some genes have been shown to be up-regulated by perfectly complementary lhRNAs, whereas lhRNAs with G:U mismatches attenuated such activation.24,26 Since G:U wobble parings most probably change the thermodynamic properties of hairpin structures, these may evade recognition by dsRNA-binding proteins such as PKR Recently, it was reported that the cytoplasmic helicase proteins RIG-I and MDA5 recognize single and dsRNAs bearing a 5′triphosphate, leading to type I IFN expression.35,36 These proteins sense infection from a variety of viruses and trigger antiviral responses.37 Interestingly, RIG-I can also recognize chemically synthesized blunt-ended 27 nt siRNAs.38 Since stably expressed lhRNAs with G:U wobble parings did not induce the activation of IFN-inducible genes (Figure 4b and c, Supplementary Figure S3a and b), it is unlikely that these lhRNAs are recognized by RIG-I and MDA5 Further analyses will be required to examine the potential activation of the IFN pathway in the presence of these long RNAs in immune cells such as monocytes, plasmacytoid dendritic cells and non-plasmacytoid dendritic cells Consistent with previous reports, we observed that lhRNAs produce multiple active siRNAs We have also observed by both functional assays and Northern analyses that the processing of lhRNAs is processive and produces a gradient of siRNAs from the stem towards the loop The reduction in the amount of the third position siRNA in our constructs suggests a limitation in the useful length of lhRNAs (Figure 3a) This processive processing was observed in transient transfections, and in stably transduced cells (Figure 4a) as well as in vitro (Supplementary Figure S5) A recent report has demonstrated that the first 21 bp siRNA produced from a 62 bp lhRNA showed stronger silencing Molecular Therapy vol 16 no jan 2008 Expression of Long Anti-HIV-1 Hairpin RNAs efficacy than the second siRNA in transiently transfected cells27 although the mechanism for this was not elaborated upon We observed a similar polarity in target knockdown by the siRNAs produced from an 80 bp lhRNA (Supplementary Figure S2b) Nevertheless, our 53 bp tat/rev targeting-lhRNA, which produces two distinct siRNAs, provided a significant advantage over a single shRNA in both longevity of inhibition of HIV and the ability to inhibit a variant harboring two point mutations in the target sequence complementary to the first siRNA (Figure 5b) Sequence-specific target degradation by siRNAs is usually negatively affected by even a single point mutation, although the degree of silencing efficacy varies depending on the position of nucleotide mismatches A single mutation at position or 12 relative to the 5′-end of the sense strand has been shown to be tolerated in suppression of HIV-1.20,21 However, two point mutations at both positions and 12 completely abolished the activity of our shRNA (Figure 5b) It has recently been reported that a human Tcell line expressing an integrase-targeting lhRNA showed limited anti-HIV activity days post infection.39 In contrast, our lhRNA strongly inhibited HIV-1 replication for several weeks (Figures 5a and 6) By targeting contiguous sequences in the tat/rev common exon, mutants that arise should also have a selective disadvantage because the reading frames for these two proteins are different, and silent third-position codon changes for one gene will very often result in an amino acid alteration for the other gene, thereby affecting expression of that gene Overall, our studies demonstrate the potential advantage of using lhRNAs over shRNAs for long-term control of HIV-1 replication Nevertheless, there are limitations to this approach, the most significant of which is the polariy of processing by Dicer as it proceeds along the hairpin structure, rendering hairpins longer than 80 or so bp less useful than those below this length A final consideration is that producing multiple siRNAs from a single transcript could in some cases result in competition for endogenous RNA-induced silencing complex components, thereby impacting on the functionality of the multiple siRNAs themselves as well as the micro RNA pathway Strand selectivity is another potential concern, but this can be controlled by thermodynamic properties of the ends of the siRNAs produced from the lhRNAs.40,41 Competition among the lhRNA produced siRNAs with each other and/or the cellular micro RNAs will depend upon the sequences of the lhRNAs and how effectively they compete for the RNA-induced silencing complex.42 The number of integrated copies and the strength of the promoters used to transcribe the lhRNAs are also important factors for controlling potential siRNA mediated toxicities MATERIALS AND METHODS Plasmid construction Plasmids that contain a human U6 promoter were described previously.43 To create 21, 50 and 53 bp-hairpin RNA expression vectors, the hybridized sense and antisense strands were inserted within a BspMI site downstream of the U6 promoter To create the 80 bp lhRNA expression vector, the DNA was amplified by PCR using primers with BspMI sites Following digestion, the double-stranded DNA was inserted immediately downstream of the U6 promoter Sequences used for shRNAs and lhRNAs were as follows (sense mutations indicated in lower case and loop sequence underlined): SI-21: 5′-GCGGAGAtAGC GAtGAAGAGtTTCAAGAGAGCTCTTCGTCGCTGTCTCCGCTTT 175 © The American Society of Gene Therapy Expression of Long Anti-HIV-1 Hairpin RNAs TT-3′, SI-53: 5′-GCGGAGAtAGCGAtGAAGAGtTCATtAGAACAGTt AGACTtATCAAGtTTCTCTTCAAGAGAGAGAAGCTTGATGAGTC TGACTGTTCTGATGAGCTCTTCGTCGCTGTCTCCGCTTTTT-3′, SII-21: GCCTGTGtCTCTTCAGtTACtTTCAAGAGAGGTAGCTGAAG AGGCACAGGCttttt-3′, SII-50: 5′-GCCTGTGtCTCTTCAGtTACtACCG tTTGAGAGgCTTAtTCTTGgTTGTATTCAAGAGATACAATCAAGAG TAAGTCTCTCAAGCGGTGGTAGCTGAAGAGGCACAGGCTTTTT3′, SII-80: 5′-GCCTGTGtCTCTTCAGtTACtACCGtTTGAGAGgCTTA tTCTTGgTTGTAAtGAGGgTTGTGGAgCTTCTGGGgCGtAGGTTCA AGAGACCTGCGTCCCAGAAGTTCCACAATCCTCGTTACAATCA AGAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGGCACAGGC3′ Construction of the lentiviral vector was described previously.44 Each hairpin RNA expression cassette was excised from the U6-based vectors with BglII and BamHI or EcoRI and BamHI followed by filling in of the digested sites with DNA polymerase I (Klenow), and the fragments were ligated into either the unmodified BamHI site or the blunt-ended BamHI site of pHIV-7-GFP Luciferase reporter plasmids were constructed by inserting the double stranded target sequences into the BglII and NotI sites of the psiCHECK-2 plasmid (Promega, Madison, WI) Cell culture HEK293, 293T and HT1080 cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum The human T-cell line CEM was cultured in the Roswell Park Memorial Institute’s 1640 medium, supplemented with 10% fetal bovine serum Luciferase assays HEK293 cells were grown to approximately 70–80% confluency in 24-well plates and cotransfected with 100 ng of the luciferase reporter plasmid, 100 ng of the hairpin RNA expression vector and, in the case of the pNL4-3.Luc plasmid, 1 ng of a renilla luciferase expression plasmid (Promega, Madison, WI) All transfections were performed with Lipofectamine 2000 (Invitrogen) At the designated time points, luciferase activities were analyzed with a Dual Luciferase system (Promega, Madison, WI) Northern blotting Total RNAs were extracted and purified with RNA STAT-60 (TEL-TEST “B”, Friendswood, TX) according to the manufacturer’s instructions Twenty micrograms of total RNA per lane were loaded in an 8% polyacrylamide denaturing gel Following electrophoresis, bands of RNA were electro-transferred to a Hybond-N membrane (Amersham Bioscience, Piscataway, NJ) The membrane was probed with γ-32P-labeled synthetic oligonucleotides complementary to the antisense sequences of hairpin RNAs Lentiviral vector production The packaging system used has been described previously 293T cells were cultured until they reached 80% confluency in a 100-mm culture dish Fifteen micrograms of the lentiviral vectors, 15 µg of pCHGP-2, 5 µg of pCMV-G, and 5 µg of pCMV-rev were cotransfected into 293T cells using the calcium phosphate precipitation procedure Six hours after transfection, the culture medium was replaced The culture supernatants were collected 42 hours after transfection The supernatants were pooled together, passed through a 0.45-µm-pore-size filter, concentrated by ultracentrifugation, and stored at –80 °C until use Vector titers were determined by transduction of HT1080 cells and assayed for enhanced GFP expression using flow cytometry The vectors were free of replication-competent lentivirus as determined by both genomic PCR and p24 antigen assays 45 Transduction of target cells For transduction of CEM T cells, × 105 cells were placed in a 15-ml centrifuge tube with 1 ml culture medium and 4 µg/ml polybrene in the presence of the lentiviral vector at a multiplicity of infection of 10 Following centrifugation at 2,000 rpm for 30 minutes, the cells were transferred into a 24-well culture plate and after 24 hours the culture medium was replaced Transduced cells were sorted by means of fluorescence activated cell sorting before use, when the transduction efficiency was less than 90% (based on enhanced GFP expression) 176 RNA expression analysis Expression of human mRNAs encoding, IFN-β, MxA, p56, OAS1 and RIG-I were determined by a real-time PCR using 2× iQ SyberGreen Mastermix (Bio-Rad, Hercules, CA) and specific primer sets for these genes.46 RNA STAT-60 was used to extract total RNA Residual DNA was digested with DNase I (Roche, Nutley, NJ), and then complementary DNA was produced using 2 µg of total RNA, moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA) and 100 ng of random primers in a 25 µl reaction HPRT1 or GAPDH expressions were used as internal controls and for normalization of the PCR data HIV-1 challenge One million CEM T cells were infected with wild- type or mutant strains of HIV-1IIIB at a multiplicity of infection of 0.01 or 0.001 After overnight incubation, the cells were washed three times with Hank’s balanced salts solution and cultured using the Roswell Park Memorial Institute’s 1640 medium with 10% fetal bovine serum At designated time points, culture supernatants were collected and analyzed for viral RNA levels by a branched DNA (bDNA) assay using the QuantiGene Reagent System (Panomics, Fermont, CA), according to the manufacturer’s instructions HIV-1 antiviral assays Cells were cotransfected with HIV-1 pNL4-3 proviral DNA and each hairpin RNA expression vector in 1:1 wt/wt ratio using Lipofectamine Plus (Invitrogen, Carlsbad, CA), according to the manufacturer’s instructions Culture supernatants were collected days after transfection and analyzed for HIV-1 p24 antigen using an enzyme-linked immunosorbent assay (Beckman Coulter, Fullerton, CA) The p24 values were calculated using a Dynatech MR5000 enzyme-linked immunosorbent assay plate reader (Dynatech Lab, Chantilly, VA) In vitro Dicer cleavage of lhRNAs Template DNAs, including the 21, 50 or 80 bp-hairpin sequences, were prepared by PCR of the various sII-rev hairpin plasmids The primers for producing the T7 transcription units were: upper (5′-TAATACGACTCACTATAGCCTGTGTCTCTTCAGTT ACT-3′) and lower (5′-AAGCCTGTGCCTCTTCAGCTACC) Once the PCR products were produced, the corresponding RNAs were transcribed in vitro using the MEGAshortscript T7 kit (Ambion, Austin, TX), according to the manufacturer’s instructions One microgram of transcript was incubated with 1 U of a recombinant human Dicer (Genlantis) for 16 hours at 37 °C The products of the reaction were resolved in an 8% polyacrylamide denaturing gel After electrophoresis, Northern blotting was performed as described in the Northern blotting analysis section ACKNOWLEDGMENTS This research was supported by National Institutes of Health (NIH) AI29329; AI42552 and HL07470 The authors thank Kazunari Taira for helpful discussion, Ming-Jie Li (Department of Neuroscience, Washington University Medical School, St Louis, MO) and Hideo Akashi (National Institute of Advanced Industrial Science and Technology, Tsukuba, Japan) for technical support and NIH AIDS Research and Reference Reagent Program for providing the pNL4-3.Luc.R-E-plasmid Supplementary material Figure S1 Expression of siRNAs from the 80bp lhRNA Figure S5 In vitro Dicer cleavage of shRNAs and lhRNAs Figure S2 Efficacy of individual siRNAs produced from lhRNAs Figure S3 Effects of lhRNAs on the levels of MxA and RIG-I mRNA in transduced cells Figure S4 Inhibition of HIV-1 infection in CEM T cells expressing sII-rev hairpin RNAs REFERENCES Almeida, R and Allshire, RC (2005) RNA silencing and genome regulation Trends Cell Biol 15: 251–258 Elbashir, SM, Lendeckel, W and Tuschl, T (2001) RNA interference is mediated by 21- and 22-nucleotide RNAs Genes Dev 15: 188–200 www.moleculartherapy.org vol 16 no jan 2008 © The American Society of Gene Therapy Bernstein, E, Caudy, AA, Hammond, SM and Hannon, GJ (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference Nature 409: 363–366 Zhang, H, Kolb, FA, Jaskiewicz, L, Westhof, E and Filipowicz, W (2004) Single processing center models for human Dicer and bacterial RNase III Cell 118: 57–68 Chendrimada, TP, Gregory, RI, Kumaraswamy, E, Norman, J, Cooch, N, Nishikura, K et al (2005) TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing Nature 436: 740–744 Lee, Y, Hur, I, Park, SY, Kim, YK, Suh, MR and Kim, VN (2006) The role of PACT in the RNA silencing pathway EMBO J 25: 522–532 Matranga, C, Tomari, Y, Shin, C, Bartel, DP and Zamore, PD (2005) Passenger-strand cleavage facilitates assembly of siRNA into Ago2-containing RNAi enzyme complexes Cell 123: 607–620 Rand, TA, Petersen, S, Du, F and Wang, X (2005) Argonaute2 cleaves the anti-guide strand of siRNA during RISC activation Cell 123: 621–629 Liu, J, Carmell, MA, Rivas, FV, Marsden, CG, Thomson, JM, Song, JJ et al (2004) Argonaute2 is the catalytic engine of mammalian RNAi Science 305: 1437–1441 10 Song, JJ, Smith, SK, Hannon, GJ and Joshua-Tor, L (2004) Crystal structure of Argonaute and its implications for RISC slicer activity Science 305: 1434–1437 11 Jacque, JM, Triques, K and Stevenson, M (2002) Modulation of HIV-1 replication by RNA interference Nature 418: 435–438 12 Lee, NS, Dohjima, T, Bauer, G, Li, H, Li, MJ and Ehsani, A et al (2002) Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells Nat Biotechnol 20: 500–505 13 Martinez, MA, Clotet, B and Este, JA (2002) RNA interference of HIV replication Trends Immunol 23: 559–561 14 Novina, CD, Murray, MF, Dykxhoorn, DM, Beresford, PJ, Riess, J, Lee, SK et al (2002) siRNA-directed inhibition of HIV-1 infection Nat Med 8: 681–686 15 Coburn, GA and Cullen, BR (2002) Potent and specific inhibition of human immunodeficiency virus type replication by RNA interference J Virol 76: 9225–9231 16 Leonard, JN and Schaffer, DV (2006) Antiviral RNAi therapy: emerging approaches for hitting a moving target Gene Ther 13: 532–540 17 Boden, D, Pusch, O, Lee, F, Tucker, L and Ramratnam, B (2003) Human immunodeficiency virus type escape from RNA interference J Virol 77: 11531–11535 18 Das, AT, Brummelkamp, TR, Westerhout, EM, Vink, M, Madiredjo, M, Bernards, R et al (2004) Human immunodeficiency virus type escapes from RNA interference-mediated inhibition J Virol 78: 2601–2605 19 Westerhout, EM, Ooms, M, Vink, M, Das, AT and Berkhout, B (2005) HIV-1 can escape from RNA interference by evolving an alternative structure in its RNA genome Nucleic Acids Res 33: 796–804 20 Pusch, O, Boden, D, Silbermann, R, Lee, F, Tucker, L and Ramratnam, B (2003) Nucleotide sequence homology requirements of HIV-1-specific short hairpin RNA Nucleic Acids Res 31: 6444–6449 21 Sabariegos, R, Gimenez-Barcons, M, Tapia, N, Clotet, B and Martinez, MA (2006) Sequence homology required by human immunodeficiency virus type to escape from short interfering RNAs J Virol 80: 571–577 22 Li, MJ, Kim, J, Li, S, Zaia, J, Yee, JK, Anderson, J et al (2005) Long-term inhibition of HIV-1 infection in primary hematopoietic cells by lentiviral vector delivery of a triple combination of anti-HIV shRNA, anti-CCR5 ribozyme, and a nucleolar-localizing TAR decoy Mol Ther 12: 900–909 23 Unwalla, HJ, Li, HT, Bahner, I, Li, MJ, Kohn, D and Rossi, JJ (2006) Novel Pol II fusion promoter directs human immunodeficiency virus type 1-inducible coexpression of a short hairpin RNA and protein J Virol 80: 1863–1873 24 Akashi, H, Miyagishi, M, Yokota, T, Watanabe, T, Hino, T and Nishina, K et al (2005) Escape from the interferon response associated with RNA interference using vectors that encode long modified hairpin-RNA Mol Biosyst 1: 382–390 25 Konstantinova, P, de Vries, W, Haasnoot, J, ter Brake, O, de Haan, P and Berkhout, B (2006) Inhibition of human immunodeficiency virus type by RNA interference using long-hairpin RNA Gene Ther 13: 1403–1413 Molecular Therapy vol 16 no jan 2008 Expression of Long Anti-HIV-1 Hairpin RNAs 26 Watanabe, T, Sudoh, M, Miyagishi, M, Akashi, H, Arai, M, Inoue, K et al (2006) Intracellular-diced dsRNA has enhanced efficacy for silencing HCV RNA and overcomes variation in the viral genotype Gene Ther 13: 883–892 27 Weinberg, MS, Ely, A, Barichievy, S, Crowther, C, Mufamadi, S, Carmona, S et al (2007) Specific inhibition of HBV replication in vitro and in vivo with expressed long hairpin RNA Mol Ther 15: 534–541 28 Wianny, F and Zernicka-Goetz, M (2000) Specific interference with gene function by double-stranded RNA in early mouse development Nat Cell Biol 2: 70–75 29 Billy, E, Brondani, V, Zhang, H, Muller, U and Filipowicz, W (2001) Specific interference with gene expression induced by long, double-stranded RNA in mouse embryonal teratocarcinoma cell lines Proc Natl Acad Sci USA 98: 14428–14433 30 Paddison, PJ, Caudy, AA and Hannon, GJ (2002) Stable suppression of gene expression by RNAi in mammalian cells Proc Natl Acad Sci USA 99: 1443–1448 31 Diallo, M, Arenz, C, Schmitz, K, Sandhoff, K and Schepers, U (2003) Long endogenous dsRNAs can induce complete gene silencing in mammalian cells and primary cultures Oligonucleotides 13: 381–392 32 Tran, N, Raponi, M, Dawes, IW and Arndt, GM (2004) Control of specific gene expression in mammalian cells by co-expression of long complementary RNAs FEBS Lett 573: 127–134 33 Strat, A, Gao, L, Utsuki, T, Cheng, B, Nuthalapaty, S, Mathis, JM et al (2006) Specific and nontoxic silencing in mammalian cells with expressed long dsRNAs Nucleic Acids Res 34: 3803–3810 34 Sliva, K and Schnierle, BS (2006) Stable integration of a functional shRNA expression cassette into the murine leukemia virus genome Virology 351: 218–225 35 Hornung, V, Ellegast, J, Kim, S, Brzozka, K, Jung, A, Kato, H et al (2006) 5′-Triphosphate RNA is the ligand for RIG-I Science 314: 994–997 36 Pichlmair, A, Schulz, O, Tan, CP, Naslund, TI, Liljestrom, P, Weber, F et al (2006) RIG-I-mediated antiviral responses to single-stranded RNA bearing 5′-phosphates Science 314: 997–1001 37 Kato, H, Takeuchi, O, Sato, S, Yoneyama, M, Yamamoto, M, Matsui, K et al (2006) Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses Nature 441: 101–105 38 Marques, JT, Devosse, T, Wang, D, Zamanian-Daryoush, M, Serbinowski, P, Hartmann, R et al (2006) A structural basis for discriminating between self and nonself double-stranded RNAs in mammalian cells Nat Biotechnol 24: 559–565 39 Nishitsuji, H, Kohara, M, Kannagi, M and Masuda, T (2006) Effective suppression of human immunodeficiency virus type through a combination of short- or long-hairpin RNAs targeting essential sequences for retroviral integration J Virol 80: 7658–7666 40 Khvorova, A, Reynolds, A and Jayasena, SD (2003) Functional siRNAs and miRNAs exhibit strand bias Cell 115: 209–216 41 Schwarz, DS, Hutvagner, G, Du, T, Xu, Z, Aronin, N and Zamore, PD (2003) Asymmetry in the assembly of the RNAi enzyme complex Cell 115: 199–208 42 Castanotto, D, Sakurai, K, Lingeman, R, Li, H, Shively, L, Aagaard, L et al (2007) Nucleic Acids Res (in press) 43 Miyagishi, M and Taira, K (2003) Strategies for generation of an siRNA expression library directed against the human genome Oligonucleotides 13: 325–333 44 Gasmi, M, Glynn, J, Jin, MJ, Jolly, DJ, Yee, JK and Chen, ST (1999) Requirements for efficient production and transduction of human immunodeficiency virus type 1-based vectors J Virol 73: 1828–1834 45 Li, MJ, Bauer, G, Michienzi, A, Yee, JK, Lee, NS, Kim, J et al (2003) Inhibition of HIV-1 infection by lentiviral vectors expressing Pol III-promoted anti-HIV RNAs Mol Ther 8: 196–206 46 Robbins, MA, Li, M, Leung, I, Li, H, Boyer, DV, Song, Y et al (2006) Stable expression of shRNAs in human CD34+ progenitor cells can avoid induction of interferon responses to siRNAs in vitro Nat Biotechnol 24: 566–571 177 ... (RLU) 10 10 5 10 4 10 3 10 10 14 Days post-infection Vector SI- 21 106 10 5 10 4 10 3 10 2 21 10 SI-53 Wt 10 Luminescence (RLU) 10 7 10 6 10 5 10 4 10 3 10 14 Days post-infection Vector SI- 21 21 SI-53 Figure... procedures and values are the same as in (b) 17 3 © The American Society of Gene Therapy Expression of Long Anti- HIV- 1 Hairpin RNAs a 10 9 10 9 10 8 10 7 10 7 10 6 Luminescence (RLU) Luminescence (RLU) 10 10 5... the lhRNAs.40, 41 Competition among the lhRNA produced siRNAs with each other and/ or the cellular micro RNAs will depend upon the sequences of the lhRNAs and how effectively they compete for the