a novel role of the checkpoint kinase atr in leptin signaling

ARTICLE IN PRESS Molecular and Cellular Endocrinology ■■ (2015) ■■–■■ Contents lists available at ScienceDirect Molecular and Cellular Endocrinology j o u r n a l h o m e p a g e : w w w e l s e v i e r c o m / l o c a t e / m c e A novel role of the checkpoint kinase ATR in leptin signaling Elke Ericson *,1, Charlotte Wennberg Huldt, Maria Strömstedt, Peter Brodin Bioscience, Cardiovascular and Metabolic Diseases, AstraZeneca R&D, Pepparedsleden 1, 431 83 Mölndal, Sweden A R T I C L E I N F O Article history: Received 20 September 2013 Received in revised form 30 March 2015 Accepted 27 April 2015 Available online Keywords: Leptin Ataxia Telangiectasia and RAD3 related protein Signal Transducer and Activator of Transcription protein Suppressor of Cytokine Signaling A B S T R A C T In a world with increasing incidences of obesity, it becomes critical to understand the detailed regulation of appetite To identify novel regulators of the signaling mediated by one of the key hormones of energy homeostasis, leptin, we screened a set of compounds for their effect on the downstream Signal Transducer and Activator of Transcription (STAT3) signaling Interestingly, cells exposed to inhibitors of the Ataxia Telangiectasia and RAD3-related protein ATR increased their leptin dependent STAT3 activity This was due to failure of the cells to induce the negative feedback mediator Suppressor of Cytokine Signaling (SOCS3), suggesting that ATR has a previously unknown role in the negative feedback regulation of leptin signaling This is an important finding not only because it sheds light on additional genes involved in leptin signaling, but also because it brings forward a new potential therapeutic intervention point for increasing leptin signaling in obese individuals © 2015 The Authors Published by Elsevier Ireland Ltd This is an open access article under the CC BYNC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/) Introduction Signaling mediated by the hormone leptin plays a crucial role in regulating energy homeostasis in mammals Leptin was discovered as a key component of the physiological systems that regulate food intake, and the hormone is secreted by adipocytes in proportion to body fat mass (Zhang et al., 1994) The actions mediated through leptin receptors in brain neurons involved in regulating energy intake and expenditure are more well-studied than the actions mediated on peripheral leptin receptors (Morioka et al., 2007) Leptin inhibits appetite by various mechanisms, e.g by counteracting the effects of the feeding stimulant neuropeptide Y (Smith et al., 1998) and by promoting the synthesis of Proopiomelanocortin (POMC), a precursor for the anorectic alpha melanocyte stimulating hormone (Cowley et al., 2001) In contrast to the rapid inhibition of appetite caused by cholecystokinin, the appetite-inhibitory effects of leptin are long-term and help adjust the food intake over time (Harrold et al., 2012) The increased fat mass in obese individuals leads to a concomitant increase in serum leptin levels (Liu et al., 2011) Despite this, these individuals still fail to reduce food intake over time because of an apparent resistance to leptin (Frederich et al., 1995) The use Abbreviations: STAT3, signal transducer and activator of transcription 3; SOCS3, suppressor of cytokine signaling 3; ATR, ataxia and telangiectasia RAD3-related * Corresponding author Bioscience, Cardiovascular and Metabolic Diseases, AstraZeneca R&D, Pepparedsleden 1, 431 83 Mölndal, Sweden Tel.: +46 (0) 31 77 62471; fax: +46 (0) 31 77 637 92 E-mail address: Elke.Ericson@astrazeneca.com (E Ericson) Present address: Reagents and Assay Development, Discovery Sciences, AstraZeneca R&D, Pepparedsleden 1, 431 83 Mölndal, Sweden of leptin as a therapeutic agent has been explored with limited success due to this inability to respond to circulating levels of leptin Possible reasons for this include a defect in the transport of leptin across the blood–brain barrier (Banks, 2004), inhibition of the intracellular signaling from the leptin receptor mediated by increased expression of Suppressor of Cytokine signaling (SOCS3) (Bjorbaek et al., 1998; Howard et al., 2004; Liu et al., 2011; Mori et al., 2004) or other effects on cellular signaling pathways Leptin binding to its receptor stimulates Janus kinase (JAK2) to phosphorylate tyrosine residues on the receptor This phosphorylation provides docking sites for proteins containing Src homology domains, like Signal Transducer and Activator of Transcription (STAT3) (Ghilardi et al., 1996) Phosphorylated STAT3 dimerizes and translocates to the nucleus, where it binds the STAT3 response element and induces transcription of the appetite-suppressant POMC (Munzberg et al., 2003), the negative feedback regulator SOCS3 (Banks et al., 2000), and additional genes related to cell growth and apoptosis SOCS3 inhibits leptin signaling by interacting directly with the phosphorylated leptin receptor (Bjorbak et al., 2000) and with JAK2 (Sasaki et al., 2000) In an effort to identify unknown genes involved in regulating the leptin signaling pathway, we took advantage of the fact that leptininduced STAT3-response element driven luciferase production can serve as a proxy for leptin signaling We generated a HEK293 cell line expressing the leptin receptor and a STAT3-response element fused to a luciferase reporter This cell line was used in an automated assay where we screened a library of small molecules for their ability to induce leptin dependent STAT3 activity Here, we present evidence that the cell cycle checkpoint protein Ataxia Telangiectasia and RAD3 related (ATR) has a previously unknown role in the negative feedback regulation of leptin signaling http://dx.doi.org/10.1016/j.mce.2015.04.034 0303-7207/© 2015 The Authors Published by Elsevier Ireland Ltd This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/ by-nc-nd/4.0/) Please cite this article in press as: Elke Ericson, Charlotte Wennberg Huldt, Maria Strömstedt, Peter Brodin, A novel role of the checkpoint kinase ATR in leptin signaling, Molecular and Cellular Endocrinology (2015), doi: 10.1016/j.mce.2015.04.034 ARTICLE IN PRESS E Ericson et al./Molecular and Cellular Endocrinology ■■ (2015) ■■–■■ 2 Materials and methods 2.1 Cell culture The human embryonic kidney cell line HEK293 was obtained from the American Type Culture Collection (ATCC) and maintained in DMEM + Glutamax-medium with 4.5 g/l D-glucose and pyruvate (31966-021, Gibco) supplemented with 10% FBS (complete medium) at 37 °C and 5% CO2 The stable, monoclonal cell line x2e (as described in Section 2.2) was maintained under the same conditions, with the addition of μg/ml puromycin (ant-pr-1, InvivoGen) and 600 μg/ml geneticin (10131-019, Gibco) to the medium 2.2 Generation of the STAT3-luciferase reporter cell line Two constructs were used to generate a stable cell line expressing the human leptin receptor and the STAT3 response elementluciferase reporter To generate the reporter gene construct, three repeats of a STAT3 response element containing the core part of the m67 sequence (TT CCC GTA AAT) (Wagner et al., 1990) and a minimal promoter (MinP sequence from pGL4.23, Promega) were subcloned into the BglII and HindIII sites of pGL4.20 [luc2/puro]- vector (Promega) just upstream of the luc2 sequence The final construct was confirmed by DNA sequencing (with flanking vector sites in brackets, restriction sites underlined, core m67-sequence in bold, and minP-sequence in italics): [GGCCTAACTGGCCGGTACCTGAGCTCGCTAGCCTCGAGG ATATCA]AGATCTGGTTCCCGTAAATGCATCAGGTTCCCGTAAATGCA TCAGGTTCCCGTAAATGCATCAAAGCTTAGACACTAGAGGGTATATAATGGA AGCTCGACTTCCAGCTT[GGCAATCCGGTACTGTTGGTAAAGCCACC]ATG When designing the leptin-receptor expressing construct, the most common SNP variant of the human leptin receptor isoform (also called isoform b) was identified as the NCBI reference sequence NM_002303 with a Q223R substitution A sequenceverified construct where this variant of the leptin receptor had been subcloned into the pIRESneo3 (Clontech) vector was used (made by GeneArt, Life Technologies) To generate a stable cell line expressing the human leptin receptor and the STAT3 response element-luciferase reporter, equal amounts of the plasmids were co-transfected into HEK293 cells using Lipofectamine (Invitrogen) following instructions from the manufacturer To select for cells that had integrated both constructs in their genome, medium supplemented with μg/ml puromycin (antpr-1, InvivoGen) and 600 μg/ml geneticin (10131-019, Gibco) was used Silicon-grease (85 403-1EA, Sigma-Aldrich)-secured cloning cylinders (8 * mm polystyrene cylinders; C3983-50EA, SigmaAldrich) were placed on top of individual surviving clones After adding accutase (A6964, Sigma) to detach the cell clones, they were transferred to individual growth vessels and expanded The resulting cell lines were exposed to several tests aimed at validating the cell line as an appropriate model showing relevant physiological responses (see Section 3.1) Based on the outcome of these tests, cell line x2e was selected for subsequent work 2.3 Reporter gene assay The luciferase assay was performed using a BioMek FXp workstation (Beckman Coulter) contained within a sterile enclosure (BigNeat Robotics Enclosure) and equipped with a Cytomat 6000 Incubator, a Cytomat Microplate Hotel for ambient storage of microtiter plates, SAGIAN barcode readers, a Multidrop Combi (ThermoScientific) with a Custom Solvent Selection Valve, liquid handling pods (8-channel and 96-channel) and an EnVision plate reader (PerkinElmer) On day 1, 2.5 × 104 cells per well were seeded to a sterile 96-well microtiter plate (white, tissue-treated Culturplate, 6005680, PerkinElmer), in 90 μl assay medium ((0.5% (w/v) filtersterilized BSA (A2153, Sigma) in Opti-MEM without phenol red (11058-021, Gibco)) followed by incubation at 37 °C and 5% CO2 On day 2, 10 μl Tris–HCl vehicle (20 mM Trizma hydrochloride, pH 8, T3069, Sigma) or recombinant human leptin (398-LP, R&D Systems, dissolved in 20 mM Trizma hydrochloride, pH 8, T3069, Sigma) was added to a final leptin concentration of nM, and the plate was returned to the incubator Twenty-four hours after leptin/vehicle addition, the plates were first equilibrated to room temperature for 25 Next, 100 μl Steadylite Plus (6016759, PerkinElmer) was dispensed into the wells followed by vigorous shaking After 15 incubation at room temperature, the plates were read twice using an EnVision reader (PerkinElmer) equipped with the EnVision Optimized Luminescence Label containing the Luminescence Mirror Module (2100–4040, PerkinElmer) and Luminescence Filter (2100– 5180, PerkinElmer), to obtain the CPS (photon counts per second) The compound screen was performed as described earlier with the following modifications On day 1, the seeding volume was 80 μl On day 2, 10 μl compound (or vehicle) was added for a final concentration of μM compound, followed by the addition of 10 μl leptin (or vehicle) for a final concentration of nM leptin The final DMSO concentration was 0.5% (the x2e cell line tolerated up to 0.8% DMSO without losing viability as determined with the CellTiter 96 Aqueous One Solution Cell proliferation Assay, G3581, Promega) The STAT3 activity was measured 24 h after compound +/-leptin addition When performing the concentration–response experiments, leptin or compound was serially diluted to achieve the well concentrations indicated in the figures 2.4 Compounds The structures of the ATR-inhibitors compound and 12 are as follows: Compound 6: 4-{4-[(3R)-3-methylmorpholin-4-yl]-6-[1(methylsulfonyl)cyclopropyl]pyrimidin-2-yl}-1H-indole: O N O O S N NH N Compound 12: 4-{4-[1-(methylsulfonyl)cyclopropyl]-6-morpholin4-ylpyrimidin-2-yl}-1H-indole: O N O O S N NH N As shown, the compounds only differ by a 3-(R) methyl group They were synthesized as described (Foote et al., 2013) In the reporter gene assay, an internal library of small molecule compounds was used 2.5 Calculations and statistics; reporter gene assay When we tested the leptin-responsiveness of the x2e cell line (Fig 1), the fold STAT3 activation was calculated as the luminescence read counts per second (CPS) obtained at each of the tested leptin concentrations over the CPS obtained with vehicle Please cite this article in press as: Elke Ericson, Charlotte Wennberg Huldt, Maria Strömstedt, Peter Brodin, A novel role of the checkpoint kinase ATR in leptin signaling, Molecular and Cellular Endocrinology (2015), doi: 10.1016/j.mce.2015.04.034 ARTICLE IN PRESS E Ericson et al./Molecular and Cellular Endocrinology ■■ (2015) ■■–■■ Fold STAT3-activation -14 -12 -10 -8 -6 log10 M leptin Fig The stable monoclonal HEK293 cell line responds to leptin in a dosedependent manner The fold STAT3-activation at the indicated leptin dose as compared to vehicle, with 12 nM (log10 M of –7.9) as the highest tested concentration, diluting 3-fold The standard deviation obtained with three biological replicates (independent occasions) is indicated Curve fitting was done using GraphPad Prism, and the EC50 for leptin was 0.3 nM The dotted line indicates the selected leptin concentration for the compound screen (4 nM; log10 M of –8.4) cDNA was diluted 10-fold, and μl was used in a total qPCR reaction volume of 10 μl The following validated gene expression assays from Life Technologies were used to measure the mRNA expression level of the indicated genes: Hs00374280_m1 for STAT3, Hs00174497_m1 for LEPR, Hs00985639_m1 for IL-6, Hs00174103_m1 for IL-8, Hs01013996_m1 for STAT1, Hs00967506_m1 for CHK1, Hs01922614_s1 for S1PR1, and Hs00236877_m1 for IGFBP1 The following primers against the human genes were used: SOCS3 (NM_003955), forward 5′-GAC CAG CGC CAC TTC TTC AC-3′, reverse 5′-CTG GAT GCG CAG GTT CTTG, and RPLP0 (36B4, NM_001002.3, used as normalization control): forward 5′-CCA TTC TAT CAT CAA CGG GTA CAA-3′, reverse 5′-AGC AAG TGG GAA GGT GTA ATCC-3′ The SOCS3 FAM-labeled probe sequence was 5′-CTC AGC GTC AAG ACC CAG TCT GGGA-3′ The qPCR was performed in 384-well format using the Applied Biosystems 7900HT instrument or the Quantstudio Flex instrument (Life Technologies) and Power SYBR Green PCR Master mix (4367659, Life Technologies) for RPLP0, and TaqMan® Gene Expression Master Mix containing the FAM-dye reporter (Life Technologies, 4369542) for the remaining genes Data were analyzed using the software SDS 2.3 with the large ribosomal gene P0 (RPLP0) as the internal control For information on the number of replicates used, see the figure legends Results To identify compounds that increase STAT3 activation, the normalized CPS (nCPS) was obtained as follows in the presence or absence of nM leptin, respectively: 3.1 Generation and validation of a stable cell for compound screening nCPS = average CPS compound average CPS vehicle To identify potential novel genes influencing leptin-induced STAT3-activation, we generated stable, monoclonal human embryonic kidney (HEK293) cell lines expressing the leptin receptor as well as the luciferase enzyme under the control of a STAT3 response element (for details, see Section 2.2) The resulting cell lines were exposed to several tests with the aim to identify an appropriate cell model responding in a physiologically relevant way We required: Each compound was analyzed in three biological replicates (independent experimental occasions) with two luminescence measurements per replicate The log base of the nCPS was taken and compounds that significantly (p < 0.005; stringent cut-off used to pursue only the most significant findings) increased the STAT3 activity were identified in Student’s t-test comparing the log nCPS values obtained in the presence of compound to the log nCPS values obtained in the absence of compound 2.6 siRNA transfection siRNAs against the human versions of LEPR (s224011), STAT3 (s744), SOCS3 (s17190 and s17191), ATR (s536 and s56825) (Life Technologies), or negative (scrambled) control siRNA #1 (cat no 4390843, Life Technologies) were combined with 0.15 μl Lipofectamine RNAiMAX (Invitrogen 13778-150) in each well of a 96-well plate After a 15–20 pre-incubation of the transfection complexes, 2.5 × 104 cells were plated in 80 μl assay medium (Section 2.3) to a final siRNA concentration of 10 nM, and the plate was carefully mixed before incubation at 37 °C, 5% CO2 The effects of the knockdown were assessed 48 h after transfection, using the reporter gene assay (Section 2.3) or qPCR (Section 2.7) 2.7 Quantitative real-time PCR (qPCR) RNA was extracted in 96-well format using the ABI Prism 6100 Nucleic Acid PrepStation (Applied Biosystems) following the instructions from the supplier for the RNA cell method with DNase wash after first adding an additional 50 μl nucleic acid purification lysis solution to each well of the 96-well plate (4305895, Applied Biosystems, mixed 1:1 with PBS as described by the manufacturer) Total RNA (~600 ng) was transcribed using the High Capacity cDNA Reverse Transcription kit (4368813, Life Technologies) The (a) a low baseline signal in the reporter gene assay with limited LEPR expression change as compared to wildtype HEK293 cells (reducing the risk for any potential adverse effect on signaling pathways that overexpression may have), and (b) a sufficiently large leptin-induced reporter gene assay window, enabling the set-up of a robust assay, and (c) the expected response (as will be described later) in the reporter gene assay after knocking down leptin pathway components Based on the outcome of these tests, cell line x2e was selected for subsequent work When tested using an assay medium reduced for serum and thereby leptin (Section 2.3), this cell line had a low baseline signal in the reporter gene assay, accompanied by a 25fold increase in median LEPR mRNA expression over wildtype HEK293 cells (Supplementary Fig S1) Because the expression change introduced in clonal cell lines is often as high as 300- to 500-fold, the x2e LEPR overexpression can be considered small Importantly, the selected cell line responded in a dose-dependent manner to leptin with a 5-fold increase in STAT3-signaling (Fig 1) For further validation of the cell line, we performed knockdown experiments using siRNAs against transcripts for human genes with known roles in leptin signaling As expected, knockdown of the leptin receptor or of STAT3 decreased the STAT3-driven reporter gene signal relative to using a scrambled control siRNA, while knockdown of the negative feedback regulator SOCS3 increased STAT3 activation (Fig 2A) The changes in STAT3-activity were accompanied by a Please cite this article in press as: Elke Ericson, Charlotte Wennberg Huldt, Maria Strömstedt, Peter Brodin, A novel role of the checkpoint kinase ATR in leptin signaling, Molecular and Cellular Endocrinology (2015), doi: 10.1016/j.mce.2015.04.034 ARTICLE IN PRESS E Ericson et al./Molecular and Cellular Endocrinology ■■ (2015) ■■–■■ A B A A N R C SO SO C S3 S3 si si R si N R A N N R N iR on C S3 C SO t ro si ls R R si S3 C SO A N A N R si PR LE A A N A N R si AT ST 0.0 * PR * si * 0.5 * * A 1.0 * LE * 1.5 100 90 80 70 60 50 40 30 20 10 AT 2.0 Targeted mRNA (% of ctrl) * ST STAT3 activation (nCPS) 2.5 Fig siRNA-mediated knockdown of genes affected STAT3 activity in the expected way Knockdown of STAT3 or the leptin receptor (LEPR) reduced the STAT3 response, while knockdown of the negative feedback regulator SOCS3 increased the response as measured by the reporter gene assay (A) The change in STAT3-expression was accompanied by a varying knockdown efficiency for the different genes as measured by quantitative PCR, resulting in 19–68% remaining mRNA-expression for the targeted genes (B) (A) Fold change in STAT3 activation (nCPS) days after transfecting HEK cells with siRNA s744 against STAT3, s224011 against LEPR, s17190 (siRNA1) or s17191 (siRNA2) against SOCS3 and non-targeting control siRNA (B) The remaining expression level of each of the targeted genes after knockdown with the indicated siRNAs at 48 h after transfecting the cells as compared to transfecting with scrambled control siRNA The standard deviation of 12 replicates (3 biological * technical) is shown, and the expression levels were normalized to those of RPLP0 before calculating the percent remaining mRNA *Statistically significant reduced (STAT3, LEPR) or increased (SOCS3) STAT3 activation (p < 0.05) in (A), and significantly reduced mRNA expression (p < 0.05) as compared to the expression seen in control cells transfected with scrambled siRNA (B) significant reduction in remaining mRNA-expression for the targeted genes as measured by quantitative PCR (Fig 2B) The knockdown efficiency was highest with siRNA against SOCS3 (19% remaining SOCS3 mRNA) and lowest with siRNA against the overexpressed LEPR (68% remaining LEPR mRNA) (Fig 2B) No STAT3 activation was seen in the absence of leptin with any of the siRNAs (data not shown) Taken together, these findings demonstrate that the x2e cell line responds in a physiologically relevant and expected way to perturbations in the leptin signaling pathway, and therefore qualifies as an appropriate model for this work 3.2 The reporter gene assay compound screen suggested a novel regulator of leptin signaling After confirming the amenability of using the reporter cell line to identify genes influencing leptin-mediated STAT3 signaling, we screened an internal library of proprietary small molecule compounds with the aim to identify proteins that when inhibited would increase STAT3-signaling The compound screen was run at μM with and without the addition of nM leptin Normalization and statistical calculations were performed as described in Section 2.5 Briefly, we calculated the normalized counts per second (nCPS) as the average luciferase signal obtained with treatment over that obtained with vehicle Data pertaining to the addition or omission of leptin were calculated separately Thus, the nCPS represents the compound-mediated fold increase in STAT3 activity over vehicle, either in the presence or absence of leptin Of the compounds that significantly (p < 0.005) influenced the STAT3-response in the presence of nM leptin, an antagonist to Ataxia Telangiectasia Rad3-related kinase (ATR) stood out because of its pronounced augmentation of leptin-induced STAT3 activation The structure of this compound has been disclosed (compound 12 in Foote et al (2013)) ATR is known as a master regulator of the DNA damage response together with the Ataxia Telangiectasia Mutated protein ATM (Cimprich and Cortez, 2008) It controls and co-ordinates DNA replication origin firing, replication fork stability, and cell cycle checkpoints ATR responds to a wide range of DNA damage and replication interference, including the occurrence of single-stranded DNA, cancer chemotherapies, and DNA cross links (Kim et al., 2011; Yang et al., 2012) When triggered, ATR phosphorylates several substrates including Chk1, which in turn triggers the activation of additional proteins involved in DNA damage responses and repair ATR has not been described in the context of leptin signaling before 3.3 Confirming a dose-dependent, ATR-specific compound response in the reporter gene assay In an effort to validate ATR as a top hit from the compound screen, we exposed the x2e cell line to an additional ATR inhibitor, compound (Foote et al., 2013) To obtain EC50-values for the STAT3induction as measured in the reporter gene assays, we performed dose–response experiments in the presence and absence of nM leptin A correlation between compound concentration and the level of STAT3-activation was observed after inhibiting ATR both with compound 12 (Fig 3A) and with compound (Fig 3B) In the presence of leptin, the STAT3-activation was increased (Fig 3) To further build confidence in engagement of the intended target, we exposed our cell line to an inhibitor of Checkpoint Kinase (CHK1) downstream of ATR; AZD7762 (Zabludoff et al., 2008) With AZD7762 we also observed a dose-dependent activation of STAT3, albeit lower than that seen with the ATR inhibitors (Supplementary Fig S2A) This suggests that Chk1 may be involved in the increased STAT3-activation observed following ATR inhibition Compound was more potent than compound 12 in phosphorylating Chk1 in colorectal adenocarcinoma cells (Foote et al., 2013) While treatment of the cells with compound caused a higher maximum STAT3-activation in the reporter gene assay (nCPS of 98 vs 60 in the presence of leptin, and nCPS of 30 vs 20 in the absence of leptin; Fig 3), the compound-mediated fold increase in signal was similar for the two compounds The EC50-values only indicated a small difference in potency, with compound being about twofold more potent than compound 12 in both the basal and stimulated conditions (Fig 3) Compounds and 12 were developed from an mTOR-assay screening hit in repeated SAR-studies, where the activity against mTOR was reduced by chemical substitutions (Foote et al., 2013) The synthesized compounds were extensively tested for their potential activity on other targets besides ATR When probed against a panel of 442 kinases, compound reduced the activity with >50% of only two other kinases besides ATR; mTOR and PI3Kα Compound was less potent against these kinases than compound 12 Please cite this article in press as: Elke Ericson, Charlotte Wennberg Huldt, Maria Strömstedt, Peter Brodin, A novel role of the checkpoint kinase ATR in leptin signaling, Molecular and Cellular Endocrinology (2015), doi: 10.1016/j.mce.2015.04.034 ARTICLE IN PRESS E Ericson et al./Molecular and Cellular Endocrinology ■■ (2015) ■■–■■ A B 80 100 nM leptin nM leptin STAT3 activation (nCPS) STAT 3activation (nCPS) 60 40 20 80 -5.8 -5.6 log10 M Compound 12 nM leptin 60 40 20 -6.0 nM leptin -6.4 -5.4 -6.2 -6.0 -5.8 log10 M Compound -5.6 Fig STAT3-activaton following 24 h exposure to two ATR inhibitors in the presence and absence of leptin The concentration (log10 M) of the ATR- inhibitors compound 12 (A) and compound (B) plotted against the average STAT3 fold change (nCPS) with the standard deviation of three biological replicates (independent occasions) indicated The log10 M EC50-values obtained in the absence and presence of leptin were −5.57 and −5.60 respectively for compound 12 (A), and −5.92 and −5.97 for compound (B) Curve fitting including retrieval of EC50-values was done using GraphPad Prism (mTOR cell IC50 of 2.4 μM vs 0.18 μM for compound 12, and PI3Kα cell IC50 of >30 μM vs 0.94 μM for compound 12) (Foote et al., 2013) The observation that compound was not active on PI3Kα even at the highest tested concentration suggested that the increase in STAT3-activity observed with the ATR-inhibitors was not mediated by an off-target effect on PI3Kα In contrast, the low mTOR IC50value reported for both compounds and 12 necessitated further investigation We therefore examined the potential effect on STAT3 activation of the highly selective mTOR-inhibitor Ku-0063794 (Garcia-Martinez et al., 2009) Independent of whether leptin was present or not, a slight decrease rather than an increase in STAT3signaling was observed with Ku-0063794 (Supplementary Fig S2B) Thus, the increase in STAT3-signaling mediated by ATR-inhibitors compounds and 12 cannot be explained by an inhibitory offtarget effect of these compounds on mTOR 3.4 Using an siRNA-approach to confirm a role of ATR in leptin signaling To further investigate the specificity of the ATR inhibitors, we used siRNAs against the ATR transcript As expected, knockdown of ATR decreased ATR mRNA levels (Fig 4A) and significantly (p < 0.05) increased the STAT3 activation in the presence of nM leptin (Fig 4B) In the absence of leptin, knockdown of ATR did not affect STAT3-activation (data not shown) Thus, our data suggest that ATR is a novel negative regulator of leptin-mediated STAT3-signaling 3.5 The ATR-inhibitors stimulate leptin-dependent STAT3-signaling by preventing the expression of SOCS3 Having confirmed that ATR influences STAT3-activation in a leptin-dependent manner by using compounds and siRNAs directed against ATR, we next explored by what mechanism ATR causes this effect We hypothesized that ATR may stimulate the expression or prevent the degradation of the known negative feedback regulator SOCS3 If this was correct, we would expect inhibition of ATR to reduce SOCS3 levels in the presence of leptin To test this, we exposed the cells for 30 minutes to ATR inhibitors compounds and 12 in the presence or absence of leptin In agreement with our hypothesis, ATR was required for normal SOCS3-induction in response to leptin (Fig 5) Interestingly, the quantitative PCR data also suggested that ATR has a leptin-independent role in maintaining a baseline expression of SOCS3 (Fig 5) In an effort to explore the specificity of the SOCS3-expression change, we investigated whether additional STAT3-regulated genes besides SOCS3 change in expression following ATR inhibition Based on literature evidence, interleukin (IL-6), interleukin (IL-8), insulin growth factor binding protein (IGFBP1) and the spingosine1-phosphate receptor S1PR1 all have the ability to activate STAT3signaling (Dauer et al., 2005; Fu et al., 2015; Lee et al., 2010; Leu et al., 2001; Leung-Pineda et al., 2006), and were tested for any potential expression change following ATR inhibition In addition, we measured the expression of signal transducer and activator of B A 60 STAT3-activation (nCPS) ATR mRNA (% of ctrl) 2.0 50 40 30 20 10 * * 1.5 1.0 0.5 0.0 ATR-s536 ATR-s56825 ATR s536 ATR s56825 Control siRNA Fig Knockdown of ATR resulted in an increased STAT3 activity Knockdown of ATR reduced the ATR mRNA levels (A) and increased the luciferase response (B) (A) The expression of ATR (relative to the internal reference gene) 48 h after transfecting with the indicated siRNAs against ATR, shown as percent mRNA expression as compared to when transfecting with scrambled control siRNA The standard deviation of 12 replicates (3 biological * technical) is shown, and * indicates statistically significant STAT3 activation (p < 0.05) (B) The fold change in Signal Transducer and Activator of Transcription (STAT3) activation (nCPS) day after exposing the cells to nM leptin and days after transfecting the cells with two different siRNAs against ATR, or with scrambled control siRNA STAT3 was not activated in the absence of leptin with any of the siRNAs (data not shown) Please cite this article in press as: Elke Ericson, Charlotte Wennberg Huldt, Maria Strömstedt, Peter Brodin, A novel role of the checkpoint kinase ATR in leptin signaling, Molecular and Cellular Endocrinology (2015), doi: 10.1016/j.mce.2015.04.034 ARTICLE IN PRESS E Ericson et al./Molecular and Cellular Endocrinology ■■ (2015) ■■–■■ SOCS3 relative expression 0.0005 No leptin Leptin 0.0004 0.0003 0.0002 * ** 0.0001 * ** tro C on d C om po un d un om po C l 12 0.0000 Fig ATR inhibition prevents leptin-induced SOCS3-expression In the absence of compound, 30 exposure to leptin resulted in an increased SOCS3 expression (“Control”) A 30 treatment with ATR inhibitors compound 12 (3.4 μM ) or compound (1.2 μM) abolished the leptin-induced increase in SOCS3-mRNA expression seen in the absence of compound The average relative expression as compared to RPLP0 of 12 replicates (4 biological and technical) and the standard deviation is shown *Statistically significant repression in SOCS3 expression as compared to the control condition in the absence of leptin (p < 0.005), while ** indicates statistically significant repression in SOCS3 expression as compared to the control condition in the presence of leptin (p < 0.005) transcription (STAT1), which can be repressed by STAT3 (Dauer et al., 2005) In this case, we hypothesized that the increased STAT3-activity observed with the ATR-inhibitors may potentiate the repression of STAT1 The expression of each of the selected genes was measured using the same experimental set-up as in Fig All the tested genes were expressed at low or undetectable levels, and their expression was not affected when inhibiting ATR with compound (~Ct of 34 for IL6, 33 for IL8, 30 for STAT1, 33 for S1PR1, and undetectable for IGFBP1, with corresponding Ct’s of the housekeeping gene RPLP0 of 18) While the absence of effect in the tested genes suggests that the observed SOCS3 expression change is not accompanied by a general expression change in genes known to influence STAT3-signaling, a more comprehensive genome-wide expression study would be needed to gain a deeper understanding of all potential transcriptional effects caused by ATR inhibition Finally, we performed a qPCR analysis to confirm that the ATR target Chk1 was not abnormally expressed in the x2e cell line Indeed, the expression level was low and not affected by inhibition of ATR (data not shown) The absence of effect on CHK1 mRNA levels following ATR inhibition was expected, since ATR regulates CHK1 on a post-translational level (Leung-Pineda et al., 2006) Taken together, the reduced expression level of the negative feedback regulator SOCS3 resulting from ATR inhibition likely explains the increase in STAT3 activation observed in the reporter gene assay Discussion Because of the central role for leptin in energy homeostasis and body weight control, a detailed understanding of leptin signaling and its regulation is important Previous studies have focused on further exploring the roles of proteins already known to influence this pathway, for example by showing that SOCS3 acts as a negative feedback regulator not only in the hypothalamus, but also in skeletal muscle (Yang et al., 2012) Other studies have examined the effect of a specific agent on leptin signaling, for example by revealing that an extract from tea, teasaponin, enhances the anorexigenic effect of central leptin administration (Yu et al., 2013) Instead, we took a “black box approach” and looked for novel modulators of leptin signaling Toward this aim, we constructed a human embryonic kidney (HEK293) cell line that reports changes in STAT3 activation downstream of leptin, and screened an internal library of small molecules HEK cells have previously proved useful as a model cell line within neurological research, for example in a study of K+ channels in neurological disease, where all required cellular regulatory pathways were present (Moha ou Maati et al., 2011) Similarly, the HEK293 cells used here expressed the leptin receptor endogenously (Supplementary Fig S1), and responded in the expected way when components of the leptin signaling pathway were knocked down (Fig 2A) The neuronal features observed in HEK293 cells are thought to be a result of the preferential transformation by human adenovirus of cells with neuronal origin over those with kidney origin when the HEK293 cells were derived (Shaw et al., 2002) To the best of our knowledge, these data are the first to demonstrate that ATR influences signaling mediated by leptin ATR has previously mainly been studied in the context of regulating the cellular responses to cell cycle perturbation and DNA damage (Cimprich and Cortez, 2008) ATR signaling can lead to G2/M arrest, allowing time for DNA repair When ATR is inhibited in cancer cells, cell cycle arrest is compromised, and accumulation of faulty DNA eventually causes cancer cells to go through apoptosis ATR has a crucial role also in the absence of DNA damage, and the fact that it is essential for survival suggests that replication stress (such as the stress experienced by replication forks traveling through DNA-sequences with lesions) may be the most common signal to trigger ATR activity (Nam and Cortez, 2011) In our experiments, no reduction in cell viability was seen after ATR inhibition (data not shown) Apparently, the remaining amount of ATR activity was sufficient to support normal growth at least for the duration of our assay Taken together, the inhibitory effects of ATR on leptin signaling described in this paper are not readily explained by any of the known roles of ATR In addition, none of the described functions of ATR have been reported as leptin dependent When we confirmed the effect of the ATR inhibitors with siRNA, knockdown resulted in a much smaller STAT3-activation than when small molecule inhibitors were used (compare the nCPS values in Fig 4B with those in Fig 3) Possible explanations for this include the incomplete silencing mediated by the siRNAs (Fig 2B) or an insufficient rate of ATR protein turnover, perhaps in combination with a time-dependency of the effect To explore the impact of the time factor, we performed additional quantitative PCR experiments The inhibitory effect on SOCS3-induction seen after 30 (Fig 5) was no longer observed after 24 h, likely explaining why SOCS3 expression changes could not be detected following 48 h knockdown with siRNA against ATR (data not shown) This suggests that the ATRmediated prevention of SOCS3-induction is rapid and transient We believe that the STAT-3 activation following ATR inhibition in the 24 h reporter gene assay is still reflective of this transient and drastic reduction in the negative feedback protein SOCS3 The large amount of activated STAT3 boosts the expression levels of the luc2 luciferase reporter, which is a stabilized protein fully functional as an enzyme when the luciferase reaction is started following 24 h exposure to compound Our data suggest that a drastic compound-induced inhibition of ATR causes the large effects on SOCS3-expression levels (Fig 5), driving the hugely increased STAT3-activation observed with compound (Fig 3) as opposed to the smaller STAT3-activation seen with siRNA (Fig 2) These rapid expression changes need to be further investigated and if necessary taken into account when exploring different therapeutic strategies As shown in Fig 3, the ATR-inhibitors also slightly increased the basal leptin-independent STAT3-signaling in a dose dependent way, Please cite this article in press as: Elke Ericson, Charlotte Wennberg Huldt, Maria Strömstedt, Peter Brodin, A novel role of the checkpoint kinase ATR in leptin signaling, Molecular and Cellular Endocrinology (2015), doi: 10.1016/j.mce.2015.04.034 ARTICLE IN PRESS E Ericson et al./Molecular and Cellular Endocrinology ■■ (2015) ■■–■■ with a similar EC50 as when leptin was present A likely reason for this is that ATR is involved in a mechanism that maintains a basal level of SOCS3 If so, we would expect the SOCS3 mRNA expression levels to decrease also in the non-stimulated condition upon exposure to an ATR inhibitor This is exactly what we found (Fig 5), which is in agreement with the small effect on STAT3-signaling revealed in the absence of leptin in the reporter gene assay (Fig 3) Importantly however, much more pronounced effects on STAT3signaling and SOCS3-expression were mediated in the presence of leptin To conclude, we identified a novel role of the checkpoint kinase ATR in leptin signaling Cells exposed to ATR inhibitors showed reduced basal levels of the negative feedback mediator SOCS3, and failed to induce SOCS3 in response to leptin, leading to an increased STAT3-signaling Obese individuals usually not respond to increased circulating levels of leptin (Frederich et al., 1995), perhaps due to increased expression of SOCS3 (Bjorbaek et al., 1998; Howard et al., 2004; Liu et al., 2011; Mori et al., 2004) Therefore our finding that inhibition of ATR leads to decreased SOCS3 expression may prove useful in development of new treatments within obesity While additional experiments are required to understand the details of how ATR and SOCS3 interact, our observation opens up possibilities to explore the potential use of ATR inhibitors in antiobesity treatment Acknowledgements This study was funded by AstraZeneca Research & Development Thanks to Anudharan Balendran for contributing to starting up this project, Barbro Basta for performing cloning work and designing primers for the qPCR experiments, Karin Nelander for input on the statistics, Elisabeth Nyman for identifying the most common sequence of the human leptin receptor isoform 1, Paul Wan, Arjan Snijder, Niklas Larsson and other colleagues for providing valuable input to the manuscript, and Kevin Foote for helpful information regarding the development of the ATR inhibitors Appendix The most common sequence of the human leptin receptor isoform 1, used in this work, was as follows: NheI – BamHI human LEPR (223R) gene sequence in pIRES Neo3: gctagcGCCACCATGATTTGTCAAAAATTCTGTGTGGTTTTGTTACATTGGG AATTTATTTATGTGATAACTGCGTTTAACTTGTCATATCCAATTACTCCTTG GAGATTTAAGTTGTCTTGCATGCCACCAAATTCAACCTATGACTACTTCCTT TTGCCTGCTGGACTCTCAAAGAATACTTCAAATTCGAATGGACATTATGAG ACAGCTGTTGAACCTAAGTTTAATTCAAGTGGTACTCACTTTTCTAACTTAT CCAAAACAACTTTCCACTGTTGCTTTCGGAGTGAGCAAGATAGAAACTGC TCCTTATGTGCAGACAACATTGAAGGAAAGACATTTGTTTCAACAGTAAA TTCTTTAGTTTTTCAACAAATAGATGCAAACTGGAACATACAGTGCTGGCT AAAAGGAGACTTAAAATTATTCATCTGTTATGTGGAGTCATTATTTAAGAA TCTATTCAGGAATTATAACTATAAGGTCCATCTTTTATATGTTCTGCCTGAA GTGTTAGAAGATTCACCTCTGGTTCCCCAAAAAGGCAGTTTTCAGATGGTT CACTGCAATTGCAGTGTTCATGAATGTTGTGAATGTCTTGTGCCTGTGCCA ACAGCCAAACTCAACGACACTCTCCTTATGTGTTTGAAAATCACATCTGGT GGAGTAATTTTCCGGTCACCTCTAATGTCAGTTCAGCCCATAAATATGGTG AAGCCTGATCCACCATTAGGTTTGCATATGGAAATCACAGATGATGGTAA TTTAAAGATTTCTTGGTCCAGCCCACCATTGGTACCATTTCCACTTCAATAT CAAGTGAAATATTCAGAGAATTCTACAACAGTTATCAGAGAAGCTGACAA GATTGTCTCAGCTACATCCCTGCTAGTAGACAGTATACTTCCTGGGTCTTC GTATGAGGTTCAGGTGAGGGGCAAGAGACTGGATGGCCCAGGAATCTGG AGTGACTGGAGTACTCCTCGTGTCTTTACCACACAAGATGTCATATACTTTC CACCTAAAATTCTGACAAGTGTTGGGTCTAATGTTTCTTTTCACTGCATCTA TAAGAAGGAAAACAAGATTGTTCCCTCAAAAGAGATTGTTTGGTGGATGA ATTTAGCTGAGAAAATTCCTCAAAGCCAGTATGATGTTGTGAGTGATCATG TTAGCAAAGTTACTTTTTTCAATCTGAATGAAACCAAACCTCGAGGAAAG TTTACCTATGATGCAGTGTACTGCTGCAATGAACATGAATGCCATCATCGC TATGCTGAATTATATGTGATTGATGTCAATATCAATATCTCATGTGAAACTG ATGGGTACTTAACTAAAATGACTTGCAGATGGTCAACCAGTACAATCCAGT CACTTGCGGAAAGCACTTTGCAATTGAGGTATCATAGGAGCAGCCTTTACT GTTCTGATATTCCATCTATTCATCCCATATCTGAGCCCAAAGATTGCTATTTG CAGAGTGATGGTTTTTATGAATGCATTTTCCAGCCAATCTTCCTATTATCTG GCTACACAATGTGGATTAGGATCAATCACTCTCTAGGTTCACTTGACTCTCC ACCAACATGTGTCCTTCCTGATTCTGTGGTGAAGCCACTGCCTCCATCCAG TGTGAAAGCAGAAATTACTATAAACATTGGATTATTGAAAATATCTTGGG AAAAGCCAGTCTTTCCAGAGAATAACCTTCAATTCCAGATTCGCTATGGTTT AAGTGGAAAAGAAGTACAATGGAAGATGTATGAGGTTTATGATGCAAAAT CAAAATCTGTCAGTCTCCCAGTTCCAGACTTGTGTGCAGTCTATGCTGTTCA GGTGCGCTGTAAGAGGCTAGATGGACTGGGATATTGGAGTAATTGGAGC AATCCAGCCTACACAGTTGTCATGGATATAAAAGTTCCTATGAGAGGACCT GAATTTTGGAGAATAATTAATGGAGATACTATGAAAAAGGAGAAAAATGT CACTTTACTTTGGAAGCCCCTGATGAAAAATGACTCATTGTGCAGTGTTCA GAGATATGTGATAAACCATCATACTTCCTGCAATGGAACATGGTCAGAAG ATGTGGGAAATCACACGAAATTCACTTTCCTGTGGACAGAGCAAGCACAT ACTGTTACGGTTCTGGCCATCAATTCAATTGGTGCTTCTGTTGCAAATTTTA ATTTAACCTTTTCATGGCCTATGAGCAAAGTAAATATCGTGCAGTCACTCA GTGCTTATCCTTTAAACAGCAGTTGTGTGATTGTTTCCTGGATACTATCACC CAGTGATTACAAGCTAATGTATTTTATTATTGAGTGGAAAAATCTTAATGAA GATGGTGAAATAAAATGGCTTAGAATCTCTTCATCTGTTAAGAAGTATTAT ATCCATGATCATTTTATCCCCATTGAGAAGTACCAGTTCAGTCTTTACCCAA TATTTATGGAAGGAGTGGGAAAACCAAAGATAATTAATAGTTTCACTCAA GATGATATTGAAAAACACCAGAGTGATGCAGGTTTATATGTAATTGTGCCA GTAATTATTTCCTCTTCCATCTTATTGCTTGGAACATTATTAATATCACACCA AAGAATGAAAAAGCTATTTTGGGAAGATGTTCCGAACCCCAAGAATTGTT CCTGGGCACAAGGACTTAATTTTCAGAAGCCAGAAACGTTTGAGCATCTTT TTATCAAGCATACAGCATCAGTGACATGTGGTCCTCTTCTTTTGGAGCCTG AAACAATTTCAGAAGATATCAGTGTTGATACATCATGGAAAAATAAAGAT GAGATGATGCCAACAACTGTGGTCTCTCTACTTTCAACAACAGATCTTGAA AAGGGTTCTGTTTGTATTAGTGACCAGTTCAACAGTGTTAACTTCTCTGAGG CTGAGGGTACTGAGGTAACCTATGAGGACGAAAGCCAGAGACAACCCTTT GTTAAATACGCCACGCTGATCAGCAACTCTAAACCAAGTGAAACTGGTGAA GAACAAGGGCTTATAAATAGTTCAGTCACCAAGTGCTTCTCTAGCAAAAA TTCTCCGTTGAAGGATTCTTTCTCTAATAGCTCATGGGAGATAGAGGCCCA GGCATTTTTTATATTATCAGATCAGCATCCCAACATAATTTCACCACACCTC ACATTCTCAGAAGGATTGGATGAACTTTTGAAATTGGAGGGAAATTTCCCT GAAGAAAATAATGATAAAAAGTCTATCTATTATTTAGGGGTCACCTCAATC AAAAAGAGAGAGAGTGGTGTGCTTTTGACTGACAAGTCAAGGGTATCGTG CCCATTCCCAGCCCCCTGTTTATTCACGGACATCAGAGTTCTCCAGGACAG TTGCTCACACTTTGTAGAAAATAATATCAACTTAGGAACTTCTAGTAAGAA GACTTTTGCATCTTACATGCCTCAATTCCAAACTTGTTCTACTCAGACTCAT AAGATCATGGAAAACAAGATGTGTGACCTAACTGTGTAAggatcc Appendix: Supplementary material Supplementary data to this article can be found online at doi:10.1016/j.mce.2015.04.034 References Banks, A.S., Davis, S.M., Bates, S.H., Myers, M.G., Jr., 2000 Activation of downstream signals by the long form of the leptin receptor J Biol Chem 275 (19), 14563– 14572 Banks, W.A., 2004 The many lives of leptin Peptides 25 (3), 331–338 Bjorbaek, C., Elmquist, J.K., Frantz, J.D., Shoelson, S.E., Flier, J.S., 1998 Identification of SOCS-3 as a potential mediator of central leptin resistance Mol Cell (4), 619–625 Bjorbak, C., Lavery, H.J., Bates, S.H., Olson, R.K., Davis, S.M., Flier, J.S., et al., 2000 SOCS3 mediates feedback inhibition of the leptin receptor via Tyr985 J Biol Chem 275 (51), 40649–40657 Cimprich, K.A., Cortez, D., 2008 ATR: an essential regulator of genome integrity Nat Rev Mol Cell Biol (8), 616–627 Cowley, M.A., Smart, J.L., Rubinstein, M., Cerdan, M.G., Diano, S., Horvath, T.L., et al., 2001 Leptin activates anorexigenic POMC neurons through a neural network in the arcuate nucleus Nature 411 (6836), 480–484 Please cite this article in press as: Elke Ericson, Charlotte Wennberg Huldt, Maria Strömstedt, Peter Brodin, A novel role of the checkpoint kinase ATR in leptin signaling, Molecular and Cellular Endocrinology (2015), doi: 10.1016/j.mce.2015.04.034 ARTICLE IN PRESS E Ericson et al./Molecular and Cellular Endocrinology ■■ (2015) ■■–■■ Dauer, D.J., Ferraro, B., Song, L., Yu, B., Mora, L., Buettner, R., et al., 2005 Stat3 regulates genes common to both wound healing and cancer Oncogene 24 (21), 3397–3408 Foote, K.M., Blades, K., Cronin, A., Fillery, S., Guichard, S.S., Hassall, L., et al., 2013 Discovery of 4-{4-[(3R)-3-Methylmorpholin-4-yl]-6-[1-(methylsulfonyl) cyclopropyl]pyrimidin-2-y l}-1H-indole (AZ20): a potent and selective inhibitor of ATR protein kinase with monotherapy in vivo antitumor activity J Med Chem 56 (5), 2125–2138 Frederich, R.C., Hamann, A., Anderson, S., Lollmann, B., Lowell, B.B., Flier, J.S., 1995 Leptin levels reflect body lipid content in mice: evidence for diet-induced resistance to leptin action Nat Med (12), 1311–1314 Fu, X.T., Dai, Z., Song, K., Zhang, Z.J., Zhou, Z.J., Zhou, S.L., et al., 2015 Macrophagesecreted IL-8 induces epithelial-mesenchymal transition in hepatocellular carcinoma cells by activating the JAK2/STAT3/Snail pathway Int J Oncol 46 (2), 587–596 Garcia-Martinez, J.M., Moran, J., Clarke, R.G., Gray, A., Cosulich, S.C., Chresta, C.M., et al., 2009 Ku-0063794 is a specific inhibitor of the mammalian target of rapamycin (mTOR) Biochem J 421 (1), 29–42 Ghilardi, N., Ziegler, S., Wiestner, A., Stoffel, R., Heim, M.H., Skoda, R.C., 1996 Defective STAT signaling by the leptin receptor in diabetic mice Proc Natl Acad Sci U.S.A 93 (13), 6231–6235 Harrold, J.A., Dovey, T.M., Blundell, J.E., Halford, J.C., 2012 CNS regulation of appetite Neuropharmacology 63 (1), 3–17 Howard, J.K., Cave, B.J., Oksanen, L.J., Tzameli, I., Bjorbaek, C., Flier, J.S., 2004 Enhanced leptin sensitivity and attenuation of diet-induced obesity in mice with haploinsufficiency of Socs3 Nat Med 10 (7), 734–738 Kim, Y.M., Lee, Y.M., Park, S.Y., Pyo, H., 2011 Ataxia telangiectasia and Rad3-related overexpressing cancer cells induce prolonged G arrest and develop resistance to ionizing radiation DNA Cell Biol 30 (4), 219–227 Lee, H., Deng, J., Kujawski, M., Yang, C., Liu, Y., Herrmann, A., et al., 2010 STAT3induced S1PR1 expression is crucial for persistent STAT3 activation in tumors Nat Med 16 (12), 1421–1428 Leu, J.I., Crissey, M.A., Leu, J.P., Ciliberto, G., Taub, R., 2001 Interleukin-6-induced STAT3 and AP-1 amplify hepatocyte nuclear factor 1-mediated transactivation of hepatic genes, an adaptive response to liver injury Mol Cell Biol 21 (2), 414–424 Leung-Pineda, V., Ryan, C.E., Piwnica-Worms, H., 2006 Phosphorylation of Chk1 by ATR is antagonized by a Chk1-regulated protein phosphatase 2A circuit Mol Cell Biol 26 (20), 7529–7538 Liu, Z.J., Bian, J., Zhao, Y.L., Zhang, X., Zou, N., Li, D., 2011 Lentiviral vector-mediated knockdown of SOCS3 in the hypothalamus protects against the development of diet-induced obesity in rats Diabetes Obes Metab 13 (10), 885–892 Moha ou Maati, H., Peyronnet, R., Devader, C., Veyssiere, J., Labbal, F., Gandin, C., et al., 2011 A human TREK-1/HEK cell line: a highly efficient screening tool for drug development in neurological diseases PLoS ONE (10), e25602 Mori, H., Hanada, R., Hanada, T., Aki, D., Mashima, R., Nishinakamura, H., et al., 2004 Socs3 deficiency in the brain elevates leptin sensitivity and confers resistance to diet-induced obesity Nat Med 10 (7), 739–743 Morioka, T., Asilmaz, E., Hu, J., Dishinger, J.F., Kurpad, A.J., Elias, C.F., et al., 2007 Disruption of leptin receptor expression in the pancreas directly affects beta cell growth and function in mice J Clin Invest 117 (10), 2860–2868 Munzberg, H., Huo, L., Nillni, E.A., Hollenberg, A.N., Bjorbaek, C., 2003 Role of signal transducer and activator of transcription in regulation of hypothalamic proopiomelanocortin gene expression by leptin Endocrinology 144 (5), 2121– 2131 Nam, E.A., Cortez, D., 2011 ATR signalling: more than meeting at the fork Biochem J 436 (3), 527–536 Sasaki, A., Yasukawa, H., Shouda, T., Kitamura, T., Dikic, I., Yoshimura, A., 2000 CIS3/SOCS-3 suppresses erythropoietin (EPO) signaling by binding the EPO receptor and JAK2 J Biol Chem 275 (38), 29338–29347 Shaw, G., Morse, S., Ararat, M., Graham, F.L., 2002 Preferential transformation of human neuronal cells by human adenoviruses and the origin of HEK 293 cells FASEB J 16 (8), 869–871 Smith, F.J., Campfield, L.A., Moschera, J.A., Bailon, P.S., Burn, P., 1998 Brain administration of OB protein (leptin) inhibits neuropeptide-Y-induced feeding in ob/ob mice Regul Pept 75–76, 433–439 Wagner, B.J., Hayes, T.E., Hoban, C.J., Cochran, B.H., 1990 The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter EMBO J (13), 4477– 4484 Yang, Z., Hulver, M., McMillan, R.P., Cai, L., Kershaw, E.E., Yu, L., et al., 2012 Regulation of insulin and leptin signaling by muscle suppressor of cytokine signaling (SOCS3) PLoS ONE (10), e47493 Yu, Y., Wu, Y., Szabo, A., Wu, Z., Wang, H., Li, D., et al., 2013 Teasaponin reduces inflammation and central leptin resistance in diet-induced obese male mice Endocrinology 154 (9), 3130–3140 Zabludoff, S.D., Deng, C., Grondine, M.R., Sheehy, A.M., Ashwell, S., Caleb, B.L., et al., 2008 AZD7762, a novel checkpoint kinase inhibitor, drives checkpoint abrogation and potentiates DNA-targeted therapies Mol Cancer Ther (9), 2955– 2966 Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., Friedman, J.M., 1994 Positional cloning of the mouse obese gene and its human homologue Nature 372 (6505), 425–432 Please cite this article in press as: Elke Ericson, Charlotte Wennberg Huldt, Maria Strömstedt, Peter Brodin, A novel role of the checkpoint kinase ATR in leptin signaling, Molecular and Cellular Endocrinology (2015), doi: 10.1016/j.mce.2015.04.034 ... GGTGCGCTGTAAGAGGCTAGATGGACTGGGATATTGGAGTAATTGGAGC AATCCAGCCTACACAGTTGTCATGGATATAAAAGTTCCTATGAGAGGACCT GAATTTTGGAGAATAATTAATGGAGATACTATGAAAAAGGAGAAAAATGT CACTTTACTTTGGAAGCCCCTGATGAAAAATGACTCATTGTGCAGTGTTCA GAGATATGTGATAAACCATCATACTTCCTGCAATGGAACATGGTCAGAAG... ATCCATGATCATTTTATCCCCATTGAGAAGTACCAGTTCAGTCTTTACCCAA TATTTATGGAAGGAGTGGGAAAACCAAAGATAATTAATAGTTTCACTCAA GATGATATTGAAAAACACCAGAGTGATGCAGGTTTATATGTAATTGTGCCA GTAATTATTTCCTCTTCCATCTTATTGCTTGGAACATTATTAATATCACACCA AAGAATGAAAAAGCTATTTTGGGAAGATGTTCCGAACCCCAAGAATTGTT... TTGCCTGCTGGACTCTCAAAGAATACTTCAAATTCGAATGGACATTATGAG ACAGCTGTTGAACCTAAGTTTAATTCAAGTGGTACTCACTTTTCTAACTTAT CCAAAACAACTTTCCACTGTTGCTTTCGGAGTGAGCAAGATAGAAACTGC TCCTTATGTGCAGACAACATTGAAGGAAAGACATTTGTTTCAACAGTAAA