Báo cáo khoa học: Cooperation of two carotene desaturases in the production of lycopene in Myxococcus xanthus pot

Cooperation of two carotene desaturases in the production of lycopene in Myxococcus xanthus Antonio A. Iniesta 1,2 , Marı ´a Cervantes 1 and Francisco J. Murillo 1 1 Departamento de Gene ´ tica y Microbiologı ´ a, Facultad de Biologı ´ a, Universidad de Murcia, Spain 2 Department of Developmental Biology, Beckman Center, Stanford University School of Medicine, CA, USA Carotenoids constitute one of the most widely distri- buted and structurally diverse classes of natural pig- ments, with important functions in photosynthesis, nutrition, and protection against photooxidative dam- age. Carotenoids are ubiquitously found in bacteria, fungi, algae, and plants. Even though the end-products of carotenoid biosynthesis are extremely diverse, a gen- eral common pathway leading to the formation of lycopene (red carotene), and cyclic b-carotene (yellow) is observed in many organisms. However, the nature of the involved enzymes varies among different organ- isms [1]. Precursors for the synthesis of carotenoids are derived from the general isoprenoid biosynthetic path- way (along with a variety of other important natural substances) [2], and start with the precursor farnesyl diphosphate (Fig. 1). The condensation of two geranyl- geranyl diphosphate (GGPP) molecules produces phy- toene, mostly in the cis conformation. Generally, phytoene is dehydrogenated in four desaturation events, producing phytofluene, f-carotene, neurospo- rene, and lycopene, respectively, in that order (Fig. 1). On the basis of sequence homology, there are two unrelated groups of phytoene desaturases, CrtI-like and Pds-like. Noncyanobacterial bacteria and fungi use a single CrtI-type phytoene desaturase to carry out the four dehydrogenation steps producing lycopene. The Pds-type phytoene desaturase is found in plants, algae, and cyanobacteria, where it is known as CrtP. Both Pds and CrtP converts phytoene into f-carotene in two steps. The two remaining desaturation events Keywords carotenes; CrtI; dehydrogenation; isomerization; phytoene Correspondence A. A. Iniesta, Beckman Center B355, 279 Campus Drive, Stanford, CA 94305, USA Fax: +1 650 725 7739 Tel: +1 650 723 5685 E-mail: ainiesta@stanford.edu F. J. Murillo, Facultad de Biologı ´ a, Universidad de Murcia, Campus de Espinardo, Murcia 30071, Spain Fax: +34 957 355 039 Tel: +34 957 355 024 E-mail: francisco.murillo@juntadeandalucia.es (Received 10 May 2007, revised 26 June 2007, accepted 28 June 2007) doi:10.1111/j.1742-4658.2007.05960.x In Myxococcus xanthus, all known carotenogenic genes are grouped together in the gene cluster carB–carA, except for one, crtIb (previously named carC). We show here that the first three genes of the carB operon, crtE, crtIa, and crtB, encode a geranygeranyl synthase, a phytoene desatur- ase, and a phytoene synthase, respectively. We demonstrate also that CrtIa possesses cis-to-trans isomerase activity, and is able to dehydrogenate phytoene, producing phytofluene and f-carotene. Unlike the majority of CrtI-type phytoene desaturases, CrtIa is unable to perform the four dehy- drogenation events involved in converting phytoene to lycopene. CrtIb, on the other hand, is incapable of dehydrogenating phytoene and lacks cis-to- trans isomerase activity. However, the presence of both CrtIa and CrtIb allows the completion of the four desaturation steps that convert phytoene to lycopene. Therefore, we report a unique mechanism where two distinct CrtI-type desaturases cooperate to carry out the four desaturation steps required for lycopene formation. In addition, we show that there is a difference in substrate recognition between the two desaturases; CrtIa dehydrogenates carotenes in the cis conformation, whereas CrtIb dehydro- genates carotenes in the trans conformation. Abbreviations CTT, casitone ⁄ Tris; GGPP, geranylgeranyl diphosphate. 4306 FEBS Journal 274 (2007) 4306–4314 ª 2007 The Authors Journal compilation ª 2007 FEBS are carried out by other desaturases, Zds in plants and algae, and CrtQ in cyanobacteria, which are related to the Pds-type desaturases. In organisms with a CrtI- type desaturase, the cis-to-trans isomerization convert- ing cis-phytoene into trans-phytoene is also performed by CrtI. However, the Pds-type desaturases lack iso- merase activity, and a CrtI-like enzyme (CrtISO in plants and CrtH in cyanobacteria) is used for cis-to- trans isomerization, converting cis-lycopene into trans- lycopene [1]. A few exceptions to these generalizations about the dehydrogenation or the isomerization pro- cess have been reported [3–7]. Myxococcus xanthus is a Gram-negative bacterium that produces carotenoids in response to blue light [8,9] and the presence of copper [10]. M. xanthus accu- mulates mainly esterified carotenoids such as ester of myxobacton (final carotenoids), and all-trans-phytoene (Table 1) [11,12]. In M. xanthus, all known and pre- dicted carotenoid biosynthesis genes are grouped together in the carB–carA gene cluster [13], except for carC (hereafter renamed crtIb) (Fig. 2) [14]. The first six ORFs of carB–carA are located in the carB operon, and the rest are at the carA locus. We characterize here the first three genes from the M. xanthus carB operon, and show that their products, CrtE, CrtIa, and CrtB, possess GGPP synthase, phytoene desatur- ase and phytoene synthase activity, respectively. In addition, we show that M. xanthus uses two desaturas- es, CrtIa and CrtIb, to complete the four desaturation processes required to transform phytoene into lyco- pene. This is the first report of such unusual and unique collaboration between two CrtI-like desaturas- es, providing additional evidence for the wide plasticity of carotenoid biosynthesis. Finally, we also show here that CrtIa possesses cis-to-trans isomerase activity, and recognizes substrates in the cis conformation, whereas CrtIb has similar desaturase activity but recognizes substrates in the trans conformation. Results Phytoene isomerization In M. xanthus, a mutant with a transposon insertion in the coding region of crtIb accumulates all-trans-phy- toene (93%) and phytofluene (7%) [11]. Therefore, CrtIb is required for phytoene dehydrogenation steps producing lycopene, but is dispensable for the 15-cis- phytoene to all-trans phytoene isomerization. This sug- gests the existence of a second enzyme to carry out the phytoene isomerization and, possibly, the first phyto- ene dehydrogenation step leading to phytofluene. The product encoded by crtIa showed high similarity to the CrtI-type phytoene dehydrogenase from fungi and noncyanobacterial bacteria [13], including the previ- ously described CrtIb of M. xanthus [14]. An M. xan- thus mutant with a transposon insertion in crtIa is unable to produce carotenoids, indicating an early role in carotenogenesis. The crtIa insertion could have a polar effect on the expression of downstream genes [12]. To clarify the possible function of crtIa in the carotenoid synthesis pathway, we generated an Fig. 1. Schematic of the initial carotenoid biosynthesis pathway in M. xanthus. The addition of an isopentenyl diphosphate unit (IPP) to farnesyl diphosphate generates a GGPP molecule. The conden- sation of two GGPPs results in the synthesis of 15-cis-phytoene. After its isomerization to the all-trans conformation, the phytoene undergoes four dehydrogenation steps, producing phytofluene, f-carotene, neurosporene, and lycopene, respectively. Dashed circles represent the site where the desaturation events take place. A. A. Iniesta et al. Phytoene dehydrogenation to lycopene in M. xanthus FEBS Journal 274 (2007) 4306–4314 ª 2007 The Authors Journal compilation ª 2007 FEBS 4307 in-frame deletion of crtIa in M. xanthus strain MR151. This strain contains a mutation, carR3, which renders the expression of the carB operon independent of external stimulation [10,15]. Colonies of the MR151- derived strain with the crtIa deletion (MR841) com- pletely lose the red color typical of colonies from the parental strain, suggesting that the absence of CrtIa blocks the synthesis of colored carotenoids. The possi- ble accumulation of carotenoid precursors by MR841 was analyzed by carotene extraction and chromatogra- phy on an alumina column. Only the presence of phy- toene was detected (Fig. 3A and Table 1). The pattern of absorbance of this carotene is similar to that shown by 15-cis-phytoene and different from that shown by all-trans-phytoene (Fig. 3B). Therefore, CrtIa is required, at least, for the isomerization of 15-cis-phyto- ene to all-trans-phytoene. Two CrtI-type enzymes cooperate in phytoene dehydrogenization to lycopene In M. xanthus, a transposon insertion in crtE or in crtB of the carB operon prevents the accumulation of Table 1. Carotenoid content of several strains of M. xanthus and E. coli with plasmids bearing different carotenogenic genes. Mx, M. xanthus; Ec, E. coli; ND, not detected. Host Strain Genotype (Mx) Plasmids (Ec) Carotenoid content (lgÆg )1 of protein) a Phytoene Phytofluene f-carotene Neurosporene Lycopene Final carotenoids, esterified carotenoids Ref. Mx DK1050 b Wild-type 1260 100 40 40 90 1470 [11] Mx MR151 carR3 1260 170 30 100 240 3800 [11] Mx MR841 carR3, DcrtIa 9500 ND ND ND ND ND This study Mx MR728 carR3, DcrtIb 8000 250 5 ND ND ND This study Ec FD6 pFD6 800 260 40 ND ND ND This study Ec FD9 pFD9 ND ND ND ND 640 ND This study Ec FD100 pACCRT-EBP ND ND 5 ND ND ND This study Ec FD101 pACCRT-EBP pMAR183 ND 6 16 80 40 ND This study Ec FD102 pACCRT-EBP pFD39 ND ND 3 3 2 ND This study Ec MR2301 pACCRT-EBI ND ND ND 120 ND ND This study Ec FD103 pACCRT-EBI pMAR183 ND ND ND 250 ND ND This study Ec FD104 pACCRT-EBI pFD39 ND ND ND ND 130 ND This study a The average of three or more independent determinations is given. b In the presence of light. Fig. 2. carB–carA gene cluster and crtIb. The carB operon is transcribed by the light-inducible promoter P B and contains the first six genes of the carB–carA cluster. The carA operon includes the last five genes of the cluster, and its transcription is driven by a light-independent promoter, P A . Fig. 3. The absence of CrtIa blocks the cis-to-trans isomerization of phytoene. (A) Absorption spectra in hexane of carotenoids extracted from strain MR841 (DcrtIa and carR3), showing only the presence of cis-phytoene. (B) Absorption spectra in hexane of all- trans-phytoene produced by M. xanthus (continuous line) and of 15-cis-phytoene produced by the fungus P. blakesleeanus (dashed line), taken from Martinez-Laborda et al. [11]. All-trans-phytoene presents three well-defined peaks (276 nm, 286 nm, and 297 nm), unlike the spectrum of 15-cis-phytoene, which shows a maximum at 286 nm and two inflections at 276 nm and 297 nm [46]. Phytoene dehydrogenation to lycopene in M. xanthus A. A. Iniesta et al. 4308 FEBS Journal 274 (2007) 4306–4314 ª 2007 The Authors Journal compilation ª 2007 FEBS carotenoids or their C 40 precursors [11,12]. The amino acid sequences of CrtE and CrtB showed significant similarities, respectively, to the GGPP and phytoene synthase from bacteria, fungi, and plants [13]. To confirm the predicted enzyme activities of CrtE and CrtB, the corresponding M. xanthus genes were both expressed in Escherichia coli, which lacks carotenogenic genes. E. coli was transformed with a plasmid (pFD6) harboring crtE, crtIa and crtB from the carB operon, to generate strain FD6. In pFD6, the expres- sion of the crt genes was under the control of the arti- ficial constitutive promoter Part-1-2. Strain FD6 was grown in LB medium to stationary phase, and carote- noids were purified from the cell extract and analyzed. The absorption spectra of the extract showed the pres- ence of all-trans-phytoene, phytofluene and f-carotene, at decreasing concentrations (Table 1). Thus, CrtE, CrtB and CrtIa are sufficient to carry out the synthesis of phytoene, its isomerization, and the first two phyto- ene dehydrogenation steps up to f-carotene produc- tion. Similar results were obtained when crtIa was coexpressed in E. coli with the crtE and crtB genes from Rhodobacter (data not shown). This confirms that CrtE and CrtB have GGPP and phytoene synthase functions, respectively, and that CrtIa, besides its isomerase activity, is responsible for the double dehy- drogenation of phytoene up to f-carotene. CrtIa, how- ever, seems unable to drive the rest of the desaturation events that produce neurosporene and lycopene. As mentioned above, crtIb is somehow required for the dehydrogenation steps converting phytoene to lyco- pene. However, the expression of crtIb in the E. coli strain producing cis-phytoene, using the crtE and crtB genes from Rhodobacter, did not transform the initial cis-phytoene at all (data not shown). In order to deter- mine the specific function of CrtIb, we analyzed the carotenoids accumulated by an M. xanthus crtIb dele- tion mutant, which also carries the carR3 mutation (MR728) [16]. MR728 was shown to accumulate all- trans-phytoene, phytofluene, and f-carotene, in decreas- ing concentrations (Table 1). This pattern of carotene accumulation, notably similar to that resulting from the heterologous expression of crtIa in E. coli (strain FD6 in Table 1), indicates that CrtIb is acting at one or two of the last dehydrogenation steps in lycopene produc- tion, after the CrtIa isomerase and desaturase activities. The low ratio of f-carotene to phytofluene found in both the M. xanthus crtIb deletion mutant and the E. coli strain expressing crtIa indicates a low efficiency of desaturation by CrtIa in the absence of CrtIb. A high relative accumulation of all-trans-phytoene is not unusual, as it is also seen in an extract from an M. xan- thus wild-type strain, which, however, produces only traces of partially desaturated phytoene products (Table 1). Altogether, the accumulated evidence sug- gests novel cooperation between two CrtI-type desatu- rases in the dehydrogenation of phytoene to lycopene. In order to determine whether both CrtIa and CrtIb are necessary and sufficient for the complete dehydro- genation to lycopene, we generated E. coli strain FD9. This strain contains plasmid pFD9, which bears the M. xanthus genes crtE , crtIa, crtB and crtIb under the control of the Part-1-2 promoter. Colonies from strain FD9 developed a very strong red color on LB agar plates. Carotenoid analysis showed that FD9 accumu- lates high amounts of lycopene almost exclusively (Table 1). This is also seen in an M. xanthus mutant defective in lycopene cyclization, where lycopene is more abundant than other desaturated precursors [12]. Therefore, in M. xanthus, CrtIa and CrtIb are both required to complete the four phytoene dehydrogeniza- tion steps necessary for lycopene formation. Moreover, the exclusive accumulation of lycopene suggests some kind of cooperation between both CrtI-type dehydro- genases for the efficient processing of the partially dehydrogenated intermediate substrates. Different isomeric substrates for each dehydrogenase The requirement in M. xanthus for two CrtI-type pro- teins to carry out the four dehydrogenation steps involved in converting phytoene to lycopene is atypical in the biogenesis of carotenoids. The precise dehydro- genase activity of CrtIa and CrtIb could be due to dif- ferential substrate recognition, based on the substrate desaturation state, on its isomer conformation, or both. To discriminate between these possibilities, we expressed crtIa or crtIb in E. coli containing plasmid pACCRT-EBP. This plasmid harbors the crtE and crtB genes from Erwinia uredovora and the gene crtP from the cyanobacterium Synechococcus PCC7942. Carotene analysis of extract from E. coli with pACCRT-EBP (FD100) identified cis-f-carotene as a major carotene, and trace amounts of all-trans-f-caro- tene and cis-phytoene [5]. The expression of crtIa in this strain resulted in the accumulation of the four de- hydrogenated phytoene derivatives phytofluene, f-caro- tene, neurosporene, and lycopene (FD101 in Table 1). On the other hand, the same strain expressing crtIb produced f-carotene, neurosporene and lycopene, all in low amounts, with no phytofluene being detected (FD102 in Table 1). These data seem to indicate that CrtIa is able to carry out two consecutive dehydro- genation events on carotenes in the cis conformation: the conversion of cis-phytoene into phytofluene and A. A. Iniesta et al. Phytoene dehydrogenation to lycopene in M. xanthus FEBS Journal 274 (2007) 4306–4314 ª 2007 The Authors Journal compilation ª 2007 FEBS 4309 f-carotene, and that of cis-f-carotene into neurospo- rene and lycopene. However, CrtIb appears to only transform the small amounts of trans-f-carotene into neurosporene and lycopene. To further confirm the hypothesis of the substrate isomer specificity of CrtIa and CrtIb, we expressed crtIa or crtIb in an E. coli strain producing trans-neu- rosporene [5]. This strain (MR2301) contains plasmid pACCRT-EBI bearing the crtE and crtB genes from Er. uredovora and crtI from Rhodobacter capsulatus, which encodes a dehydrogenase that is capable of transforming cis-phytoene into trans-neurosporene but is unable to catalyze efficiently the fourth desaturation step to produce lycopene. The expression of crtIa in the trans-neurosporene-producing strain did not change the dehydrogenation state of the accumulated carotenes (FD103 in Table 1). However, the expression of crtIb caused the almost complete transformation of trans-neurosporene into lycopene (FD104 in Table 1). All of these results suggest a scenario where CrtIa and CrtIb specific substrate recognition properties depend on the cis–trans conformation of the substrate, rather than on its desaturation state. Discussion A variety of isoprenoid compounds, such as choles- terol, dolichol, ubiquinone, coenzyme Q, isoprenoid quinines, sugar carrier lipids, and carotenoids, are syn- thesized by polyprenyl synthases in eukaryotic and prokaryotic organisms. Two distinct types of evolu- tionarily conserved prenyltransferases, CrtE and CrtB, catalyze the early reactions of carotenoid biosynthesis from farnesyl diphosphate to phytoene [2]. As pre- dicted from sequence alignments [13], we report here that the crtE and crtB genes from the M. xanthus carB operon encode enzymes with GGPP and phytoene syn- thase activity, respectively. After phytoene synthesis, this carotene undergoes several desaturation events (Fig. 4). In M. xanthus, an enzyme similar in sequence to the CrtI-type phytoene dehydrogenases, previously called CarC [11,14] and referred to here as CrtIb, was shown to be involved in carotenoid biosynthesis. The crtIb gene is not linked to the carotenogenic carB operon, which contains a gene predicted to encode a second phytoene dehydrogenase [13], referred here as CrtIa. Interestingly, CrtIa is unable to catalyze the four desaturations necessary for lycopene production in the absence of CrtIb, and instead it leads to the accumulation of the intermediates phytofluene and f-carotene in decreasing amounts. On the other hand, CrtIb is itself incapable of introducing any double bonds into phytoene. We have demonstrated that a unique collaboration between CrtIa and CrtIb is used to successfully introduce four double bonds into phy- toene. To our knowledge, this is the first case reported where two CrtI-type desaturases function together to generate lycopene. Although changes of CrtI-type enzymes producing loss or gain of dehydrogenation activities are not frequent, some cases have been reported. In the bacteria R. capsulatus and R. sphaeroides, CrtI introduces three double bonds into phytoene, producing neurosporene, but lacks the capacity to introduce the fourth double bond needed to produce lycopene [17,18]. A fifth dehydrogenation step is carried out by a CrtI-type desaturase from the fungus Neurospora crassa, produc- ing 3,4-dihydrolycopene [19]. Other variations in the lycopene biosynthesis pahtway have been reported in some cyanobacteria species. The cyanobacteria Anabaena PCC7120 converts the f-carotene produced by CrtP into lycopene using a CrtI-type desaturase instead of the typical cyanobacterial CrtQ [5]. Like M. xanthus CrtIb, the Anabaena CrtI-type desaturase is unable to introduce any double bonds into phytoene. In the cyanobacterium Gloebacter, a single CrtI-type desat- urase is responsible for the four dehydrogenation steps required for lycopene formation, and homologs of crtP and crtQ are not found in its genome [6,7]. It has been proposed that in the course of evolution, cyanobacteria acquired a gene encoding an unrelated CrtI-type desat- urase, which was duplicated, resulting in crtP and crtQ. These two genes would be the ancestors of pds and zds from algae and plants [1]. The lack of CrtP and CrtQ in Gloebacter may be related to its evolutionary distance from other groups of cyanobacteria [20]. This organism Fig. 4. General representation of the pathway for synthesis of trans-lycopene from cis-phytoene and the enzymes involved in dif- ferent organisms, including M. xanthus. Phytoene dehydrogenation to lycopene in M. xanthus A. A. Iniesta et al. 4310 FEBS Journal 274 (2007) 4306–4314 ª 2007 The Authors Journal compilation ª 2007 FEBS is thought to retain traces of the ancestral properties of cyanobacteria [4]. The formation of b-carotene is one of the most com- mon steps in the synthesis of carotenoids. It requires the cyclization of lycopene to ionone end-groups. Lycopene in the cis conformation cannot be cyclized, due to its steric arrangement, and therefore it must be synthesized in the all-trans configuration, or be converted to that form [1,21]. In organisms that use Pds ⁄ CrtP-type and Zds ⁄ CrtQ-type desaturases, where the dehydrogenation steps are performed on carotenes in the cis confor- mation, the final isomerization from cis-lycopene to all-trans-lycopene is performed by a CrtI-type enzyme called CrtISO in algae and plants, and CrtH in cyano- bacteria [21–24] (Fig. 4). cis-to-trans isomerization can be also enhanced by light [5,25,26]. However, in all organisms that use a CrtI-type desturase, the cis-to- trans isomerization is associated with the desaturation processes producing trans-phytoene [6,27,28] (Fig. 4). In the case of Anabaena, the cis-to-trans isomerization is carried out on f-carotene, instead of on phytoene, by its CrtI-type f-carotene dehydrogenase [5]. It is not clear why two different biosynthetic pathways for lycopene exist in nature. The discovery of the biosynthetic enzymes CrtP, CrtQ and CrtH in the green sulfur bacte- rium Clorobium tepidum, an obligate photoautotroph, suggests that these enzymes originated from a common ancestor of modern-day green sulfur bacteria and cyanobacteria [3]. The fact that organisms with CrtP ⁄ CrtQ ⁄ CrtH also contain type I photosynthetic reaction centers, and that cis carotenoids appear to perform important functions in these reaction centers, suggests a link between photosynthesis and the presence of cis carotenoids [3,29]. We show here that in M. xanthus, the cis-to-trans isomerization is catalyzed by CrtIa. CrtIa recognizes phytoene and also f-carotene in the cis conformation. In addition, CrtIa is unable to dehydrogenate trans-neurosporene, indicating its preference for carotenes in the cis conformation. However, CrtIb seems unable to recognize substrates in the cis conformation, but can transform trans- neurosporene into lycopene. Therefore, we propose that, in M. xanthus, the whole biosynthetic process from cis-phytoene to trans-lycopene is carried out by the cooperation of two CrtI-type desaturases, CrtIa and CrtIb. They may form a protein complex, where CrtIa recognizes cis-phytoene, isomerizes it to trans-phytoene, and dehydrogenates it twice to produce trans- f-caro- tene. This last carotene would be then transferred directly from CrtIa to CrtIb, and this desaturase would introduce two new double bonds, forming trans- lycopene. The high water insolubility of carotenoids, and the improvement of the desaturase efficiency of CrtIa in the presence of CrtIb, suggest a mechanism for the direct transfer of substrates from CrtIa to CrtIb. In the absence of CrtIb, CrtIa would be blocked when bound to f-carotene. The idea of a linear assembly chain for carotenoid synthesis was proposed years ago, on the basis of work with the fungus Phycomyces blakesleeanus [30,31]. Why M. xanthus uses two CrtI-type desaturases for the dehydrogenation of phytoene to lycopene is cer- tainly an unanswered question. One possibility is that having two unlinked desaturase genes provides more regulatory options. The crtIa gene is inserted in the carB operon, which is driven by a light-activated pro- moter [15]. The expression of crtIb is also activated by light, but through a tight mechanism that operates only when the cells have reached the stationary phase or are starved of a carbon source [14]. This may have advantages if carotenoids are synthesized only when needed, in stationary phase but not before, leaving the isoprenoid components for metabolic uses in the growth phase. In the presence of light, the carotenoid biosynthetic machinery would be present but blocked, waiting for the last enzymatic element, CtrIb, which reaches a very high level soon after the cell’s entrance into the stationary phase [14]. This scenario would be possible if, in the course of the evolution, CrtIa lost its capacity to perform the two final desaturation steps of the four catalyzed by a typical CrtI-type enzyme, and these activities were taken over by a second desaturase, CrtIb. An obvious idea is that the crtIb gene arose by duplication of the original, single M. xanthus crtI gene. However, the CrtIb protein is more closely related (46% identity) to the f-carotene desaturase from Anabaena PCC7120 [5]. Therefore, a possible horizon- tal gene transfer event from a cyanobacterium to myxobacteria cannot be ruled out. Experimental procedures Bacterial strains, media, and transducing phages E. coli DH5a [32] was used for cloning and carotenoid pro- duction, and E. coli MC1061 [33] for transducing plasmids into M. xanthus with the coliphage P1clr100Cm (hereafter called P1) [34]. M. xanthus strains, derived from MR151 [35], were grown in casitone ⁄ Tris (CTT) rich medium [36], and E. coli was grown in LB rich medium [37]. When nec- essary, 40 lgÆmL )1 kanamycin was added to CTT medium. Plasmid and strain construction Standard protocols were followed for DNA manipulation [37]. PCR-derived clones were generated using Pfu DNA A. A. Iniesta et al. Phytoene dehydrogenation to lycopene in M. xanthus FEBS Journal 274 (2007) 4306–4314 ª 2007 The Authors Journal compilation ª 2007 FEBS 4311 polymerase, and sequenced to verify the absence of PCR- generated mutations. To generate an M. xanthus crtIa deletion mutant, we digested plasmid pMAR161 with MluI, and the biggest fragment was autoligated, resulting in plasmid pMAR162. Plasmid pMAR161 is a pUC9 vector [38] that contains a 4.3 kb fragment including the first three genes of the carB operon (Fig. 2) and a part of the fourth gene. Plasmid pMAR162 is similar to pMAR161 but with deletion of a fragment encoding 160 amino acids of the coding region of crtIa. The M. xanthus DNA fragment from pMAR162 was cloned into plasmid pDAH160 [39], which carries a kana- mycin resistance gene and the incompatibility region of P1 for transferring the plasmid from E. coli to M. xanthus by P1-specialized transduction. The resulting plasmid, pMAR164, was transduced into M. xanthus MR151, where it integrated by homologous recombination to generate a kanamycin-resistant merodiploid. We grew this merodiploid in CTT without kanamycin to allow a second recombina- tion event that causes the loss of the kanamycin resistance marker, generating kanamycin-sensitive colonies, either with a wild-type crtIa or with the crtIa deletion. The presence of this deletion was confirmed by Southern blot analysis using as a template a 4.3 kb RcaI-digested fragment from pMAR161, and M. xanthus genomic DNA digested with NcoI. The strain with the crtIa deletion was named MR841. To make plasmid pFD3, a DNA fragment bearing crtE, crtIa, and crtB, which also includes the ribosomal-binding site upstream of crtE, was PCR-amplified using pMAR161 as template and the oligonucleotides ORF1-3 (5¢-GGT TCTTCGGAGGAAAGACATATGGCACTCACGCTTCC C-3¢) and ORF3-2 (5¢-CCGAAGCTCCGTCTAGATTCC CTCGCCACGC-3¢) as primers. The fragment was digested by NdeI and XbaI, and cloned into the expression vector pUC19 [40]. An artificial constitutive-expression promoter, Part-1-2, was inserted just before crtE in plasmid pFD3, generating plasmid pFD6 and strain FD6. This promoter was generated by hybridization of two complementary oli- gonucleotides, Part-1 (5¢-AGCTTGACAGGCCGGAATAT TTCCCTATAATGCGCTGCA-3¢) and Part-2 (5¢-GCG CATTATAGGGAAATATTCCGGCCTGTCA-3¢), which contain the E. coli RNA polymerase r 70 consensus binding site, TTGACA, in position ) 35 and TATAAT in position ) 10 [41], and was cloned in vectors digested with HindIII and PstI. The sequence between the ) 35 and ) 10 positions was based on the highly expressed promoter 1 of Es. coli rrnA, which encodes ribosomal RNA [42]. A DNA fragment containing the crtIb coding region plus 12 and 26 additional bp upstream and downstream, respec- tively, was PCR-amplified using pMAR202 as a template [14], and CRTI-1a (5¢-GTGGGATTCCGTTCATCTAGAT ACCGGAGGGCCTTGGC-3¢) and CRTI-2 (5¢-GAGCGC GCCACTGGATCCCGCGGCGCTCACC-3¢) as primers. The fragment obtained was cloned, after digestion with XbaI and BamHI, into vector pUC19, resulting in plasmid pFD1. To generate plasmid pFD9 (present in E. coli strain FD9), plasmid pFD1 was digested with XbaI and BamHI, and the crtIb fragment was cloned into pFD6. To generate plasmid pMAR183, a DNA fragment was amplified by PCR using pMR161 as a template, and ORF2-1 (5¢-ACCGCGCCGCCTGCAGATCCCATGAGT GCATCG-3¢) and ORF2-2 (5¢-ACCAGCGCCTTGTCGA CAGGCGGGC-3¢) as primers. This fragment was digested with PstI and SalI to generate a product containing the crtIa coding region plus 2 and 14 bp upstream and downstream, respectively; this was then cloned into vector pUC9. To generate plasmid pFD39, the same crtIb fragment used for pFD9 was PCR-amplified using pMAR202 as a template, and CRTI-3 (5¢-GTGGGATTCCGTTCATCGA TATACCGGAGGGCC-3¢) and CRTI-2 as primers. After digestion by ClaI and BamHI, this fragment was cloned into vector pACYC184 [43], to create plasmid pFD24. An artificial constitutive-expression promoter, Par-5-6, was inserted just before crtIb in plasmid pFD24, generating plasmid pFD26. The Part-5-6 promoter was generated by hybridization of two complementary oligonucleotides, Part-5 (5¢-CTAGATTGACAGGCCGGAATATTTCCCTA TAATGCGCAT-3¢) and Part-6 (5¢-CGATGCGCATTAT AGGGAAATATTCCGGCCTGTCAAT-3¢), which con- tain, like the Part-1-2 promoter, the E. coli RNA polymer- ase r 70 consensus binding site, and was cloned in vectors digested with XbaI and BamHI. Plasmid pFD26 was digested by XbaI and BamHI, and the Part-5-6-crtIb frag- ment was cloned into vector pBJ114 [44], resulting in plas- mid pFD39. Carotenoid extraction and analysis E. coli was grown in LB medium to stationary phase, and 1 mL of this culture was inoculated into 100 mL of LB medium and incubated at 37 °C for 12 h. FD100, FD101 and FD102 E. coli strains were supplemented with isopro- pyl thio-b-d-galactoside (0.5 mm) to increase expression of crtP, and incubated at 28 °C for 48 h [5]. In the case of M. xanthus, 100 mL of CTT was inoculated with 1 mL of culture in stationary phase, and incubated at 33 °C until this culture reached stationary phase. Additional experi- mental procedures were identical for all cultures. A 1.5 mL aliquot was taken for protein assay [15], and the remaining volume was centrifuged at 15 700 g using an Eppendorf 5415D 24-place rotor for 1.5–2.0 ml tubes (Eppendorf AG, Hamburg, Germany) to pellet the cells. The pellet was stored at ) 20 °C until analysis. The pellet was resuspended in 20 mL of methanol by vigorous shaking for 15 min, and then centrifuged at 27 200 g using a Beckman J2-21 centrifuge and JA-20 rotor (GMI Inc., Albertville, MN, USA) and re-extracted until the sample was totally colorless. An equal volume of Phytoene dehydrogenation to lycopene in M. xanthus A. A. Iniesta et al. 4312 FEBS Journal 274 (2007) 4306–4314 ª 2007 The Authors Journal compilation ª 2007 FEBS light petroleum (40–60 °C) was added to the methanol extract. The two-phase sample was vigorously shaken for 5 min, and the upper, light petroleum phase was removed. Three further extractions with light petroleum were per- formed, and the fractions were pooled and concentrated under vacuum. Carotenes were resuspended in 1–10 mL of hexane, and identified by their absorption spectra and quantified by their extinction coefficient [45]. In some cases, the concentrated extract was resuspended in 1 mL of light petroleum and chromatographed on a Brockman grade III deactivated alumina column [45], which was developed using light petroleum with increasing quantities of acetone. When chromatographed in activated alumina, the cis-phytoene accumulated by M. xanthus strain MR841 (Fig. 3A) behaves like 15-cis-phytoene extracted from the fungus P. blakesleeanus, as described in detail in Martinez–Laborda et al. [11]. The separated carotenes were collected, concentrated and resuspended in hexane for their analysis. All manipulations of carotenoids were carried out in the dark at 4 °C. The same carotenes were always detected in various independent analyses of the same strain, although some quantitative differences were observed, particularly in the heterologous expression experiments. Acknowledgements We thank Jose ´ A. Madrid for technical assistance, and Dr Gerhard Sandmann and Dr Agustı ´ n Vioque for providing plasmids and strains. This work was supported by the Spanish Ministerio de Educacio ´ n y Cultura (grant PB96-1096 and fellowship to M. Cervantes), Ministerio de Ciencia y Tecnologı ´ a (grant BMC2000-1006), and Fundacio ´ nSe ´ neca (fellow- ship to M. Cervantes). References 1 Sandmann G (2002) Molecular evolution of carotenoid biosynthesis from bacteria to plants. Physiol Plant 116, 431–440. 2 Armstrong GA (1994) Eubacteria show their true col- ors: genetics of carotenoid pigment biosynthesis from microbes to plants. J Bacteriol 176, 4795–4802. 3 Frigaard NU, Maresca JA, Yunker CE, Jones AD & Bryant DA (2004) Genetic manipulation of carotenoid biosynthesis in the green sulfur bacterium Chlorobium tepidum. J Bacteriol 186, 5210–5220. 4 Liang C, Zhao F, Wei W, Wen Z & Qin S (2006) Carotenoid biosynthesis in cyanobacteria: structural and evolutionary scenarios based on comparative genomics. Int J Biol Sci 2, 197–207. 5 Linden H, Vioque A & Sandmann G (1993) Isolation of a carotenoid biosynthesis gene coding for f-carotene desaturase from Anabaena PCC 7120 by heterologous complementation. FEMS Microbiol Lett 106, 99–103. 6 Steiger S, Jackisch Y & Sandmann G (2005) Caroten- oid biosynthesis in Gloeobacter violaceus PCC4721 involves a single CrtI-type phytoene desaturase instead of typical cyanobacterial enzymes. Arch Microbiol 184, 207–214. 7 Tsuchiya T, Takaichi S, Misawa N, Maoka T, Miyashita H & Mimuro M (2005) The cyanobacterium Gloeobacter violaceus PCC 7421 uses bacterial-type phytoene desaturase in carotenoid biosynthesis. FEBS Lett 579, 2125–2129. 8 Burchard RP & Dworkin M (1966) Light-induced lysis and carotenogenesis in Myxococcus xanthus. J Bacteriol 91, 535–545. 9 Burchard RP & Hendricks SB (1969) Action spectrum for carotenogenesis in Myxococcus xanthus. J Bacteriol 97, 1165–1168. 10 Moraleda-Munoz A, Perez J, Fontes M, Murillo FJ & Munoz-Dorado J (2005) Copper induction of carotenoid synthesis in the bacterium Myxococcus xanthus. Mol Microbiol 56, 1159–1168. 11 Martinez-Laborda A, Balsalobre JM, Fontes M & Murillo FJ (1990) Accumulation of carotenoids in struc- tural and regulatory mutants of the bacterium Myxococ- cus xanthus. Mol Gen Genet 223, 205–210. 12 Ruiz-Vazquez R, Fontes M & Murillo FJ (1993) Clustering and co-ordinated activation of carotenoid genes in Myxo- coccus xanthus by blue light. Mol Microbiol 10, 25–34. 13 Botella JA, Murillo FJ & Ruiz-Vazquez R (1995) A cluster of structural and regulatory genes for light- induced carotenogenesis in Myxococcus xanthus. Eur J Biochem 233, 238–248. 14 Fontes M, Ruiz-Vazquez R & Murillo FJ (1993) Growth phase dependence of the activation of a bacte- rial gene for carotenoid synthesis by blue light. EMBO J 12, 1265–1275. 15 Balsalobre JM, Ruiz-Vazquez RM & Murillo FJ (1987) Light induction of gene expression in Myxococcus xanthus. Proc Natl Acad Sci USA 84, 2359–2362. 16 Martinez-Argudo I, Ruiz-Vazquez RM & Murillo FJ (1998) The structure of an ECF-sigma-dependent, light- inducible promoter from the bacterium Myxococcus xanthus. Mol Microbiol 30 , 883–893. 17 Armstrong GA (1997) Genetics of eubacterial caroten- oid biosynthesis: a colorful tale. Annu Rev Microbiol 51, 629–659. 18 Wang CW & Liao JC (2001) Alteration of product spec- ificity of Rhodobacter sphaeroides phytoene desaturase by directed evolution. J Biol Chem 276, 41161–41164. 19 Hausmann A & Sandmann G (2000) A single five-step desaturase is involved in the carotenoid biosynthesis pathway to beta-carotene and torulene in Neurospora crassa. Fungal Genet Biol 30, 147–153. A. A. Iniesta et al. Phytoene dehydrogenation to lycopene in M. xanthus FEBS Journal 274 (2007) 4306–4314 ª 2007 The Authors Journal compilation ª 2007 FEBS 4313 20 Honda D, Yokota A & Sugiyama J (1999) Detection of seven major evolutionary lineages in cyanobacteria based on the 16S rRNA gene sequence analysis with new sequences of five marine Synechococcus strains. J Mol Evol 48, 723–739. 21 Isaacson T, Ronen G, Zamir D & Hirschberg J (2002) Cloning of tangerine from tomato reveals a carotenoid isomerase essential for the production of beta-carotene and xanthophylls in plants. Plant Cell 14, 333–342. 22 Breitenbach J, Vioque A & Sandmann G (2001) Gene sll0033 from Synechocystis 6803 encodes a carotene isomerase involved in the biosynthesis of all-E lycopene. Z Naturforsch [C] 56, 915–917. 23 Masamoto K, Wada H, Kaneko T & Takaichi S (2001) Identification of a gene required for cis-to-trans carotene isomerization in carotenogenesis of the cyanobacterium Synechocystis sp. PCC 6803. Plant Cell Physiol 42, 1398–1402. 24 Park H, Kreunen SS, Cuttriss AJ, DellaPenna D & Pogson BJ (2002) Identification of the carotenoid isomerase provides insight into carotenoid biosynthesis, prolamellar body formation, and photomorphogenesis. Plant Cell 14, 321–332. 25 Breitenbach J & Sandmann G (2005) zeta-carotene cis isomers as products and substrates in the plant poly-cis carotenoid biosynthetic pathway to lycopene. Planta 220, 785–793. 26 Giuliano G, Giliberto L & Rosati C (2002) Carotenoid isomerase: a tale of light and isomers. Trends Plant Sci 7, 427–429. 27 Breitenbach J, Braun G, Steiger S & Sandmann G (2001) Chromatographic performance on a C30-bonded stationary phase of monohydroxycarotenoids with variable chain length or degree of desaturation and of lycopene isomers synthesized by various carotene desaturases. J Chromatogr A 936, 59–69. 28 Sandmann G (2001) Carotenoid biosynthesis and biotechnological application. Arch Biochem Biophys 385, 4–12. 29 Heathcote P (2001) Type I photosynthetic reaction centres. Biochim Biophys Acta 1507, 1–2. 30 Aragon CM, Murillo FJ, de la Guardia MD & Cerda-Olmedo E (1976) An enzyme complex for the dehydrogenation of phytoene in Phycomyces. Eur J Biochem 63, 71–75. 31 De la Guardia MD, Aragon CM, Murillo FJ & Cerda- Olmedo E (1971) A carotenogenic enzyme aggregate in Phycomyces: evidence from quantitive complementation. Proc Natl Acad Sci USA 68, 2012–2015. 32 Hanahan D (1983) Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166, 557–580. 33 Casadaban MJ & Cohen SN (1980) Analysis of gene control signals by DNA fusion and cloning in Escherichia coli. J Mol Biol 138, 179–207. 34 Gill RE, Cull MG & Fly S (1988) Genetic identification and cloning of a gene required for developmental cell interactions in Myxococcus xanthus. J Bacteriol 170, 5279–5288. 35 Martinez-Laborda A, Elias M, Ruiz-Vazquez R & Murillo FJ (1986) Insertions of Tn5 linked to mutations affecting carotenoid synthesis in Myxococcus xanthus. Mol Gen Genet 205, 107–114. 36 Bretscher AP & Kaiser D (1978) Nutrition of Myxococ- cus xanthus, a fruiting myxobacterium. J Bacteriol 133, 763–768. 37 Sambrook J & Russel DW (2000) Molecular Cloning: a Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 38 Vieira J & Messing J (1982) The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19, 259–268. 39 Hodgson DA (1993) Light-induced carotenogenesis in Myxococcus xanthus: genetic analysis of the carR region. Mol Microbiol 7, 471–488. 40 Yanisch-Perron C, Vieira J & Messing J (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103–119. 41 Hawley DK & McClure WR (1983) Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res 11, 2237–2255. 42 Glaser G, Sarmientos P & Cashel M (1983) Functional interrelationship between two tandem E. coli ribosomal RNA promoters. Nature 302, 74–76. 43 Chang AC & Cohen SN (1978) Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol 134, 1141–1156. 44 Julien B, Kaiser AD & Garza A (2000) Spatial control of cell differentiation in Myxococcus xanthus. Proc Natl Acad Sci USA 97, 9098–9103. 45 Davies BH (1976) Carotenoids. In Chemistry and Biochemistry of Plant Pigments, 2nd edn (Goodwin TW, ed.), pp. 38–165. Academic Press, London. 46 Herber R, Maudinas B, Villoutreix J & Granger P (1972) The formation of all-trans-phytoene in Mucor hiemalis. Biochim Biophys Acta 280, 194–202. Phytoene dehydrogenation to lycopene in M. xanthus A. A. Iniesta et al. 4314 FEBS Journal 274 (2007) 4306–4314 ª 2007 The Authors Journal compilation ª 2007 FEBS . Cooperation of two carotene desaturases in the production of lycopene in Myxococcus xanthus Antonio A. Iniesta 1,2 , Marı ´a Cervantes 1 and. the accumulation of the intermediates phytofluene and f -carotene in decreasing amounts. On the other hand, CrtIb is itself incapable of introducing any double bonds into