Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống
1
/ 11 trang
THÔNG TIN TÀI LIỆU
Thông tin cơ bản
Định dạng
Số trang
11
Dung lượng
678,42 KB
Nội dung
Hansenulapolymorphapex11cellsareaffected in
peroxisome retention
Arjen M. Krikken
1
, Marten Veenhuis
1,2
and Ida J. van der Klei
1,2
1 Molecular Cell Biology, Groningen Biomolecular Sciences and Biotechnology Institute (GBB), University of Groningen, Haren,
The Netherlands
2 Kluyver Centre for Genomics of Industrial Fermentation, Delft, The Netherlands
Peroxisomes are single-membrane-bound, highly
dynamic organelles that have crucial functions in
eukaryotic cells [1]. Peroxisome loss or malfunction in
human leads to severe diseases that may lead to an
early death (e.g. Zellweger syndrome) [2].
For almost 20 years it was assumed that peroxi-
somes exclusively multiply by growth and division [3].
However, several groups unequivocally demonstrated
that peroxisomes may also arise from the endoplasmic
reticulum under specific conditions [4–7]. Subsequent
independent studies showed that peroxisomes in wild-
type Saccharomyces cerevisiae and Hansenula polymor-
pha cells multiply mainly by division [8,9].
Pex11p is the first peroxin to be implicated in per-
oxisome proliferation. Cells deleted for PEX11 have
reduced numbers of peroxisomes that are increased in
size relative to wild-type organelles [10], and this is
associated with a growth defect under conditions that
require peroxisome functions (e.g. oleate or methanol)
[10,11]. Overexpression of PEX11 resulted in prolifera-
tion and elongation of peroxisomes [11–14].
The molecular mechanisms of Pex11p function in
peroxisome proliferation are still largely unknown.
Goodman et al. [15] proposed that the oligomerization
state of the protein was discriminative in Pex11p func-
tion: Pex11p monomers promoted peroxisome prolifer-
ation, whereas the dimeric form resulted in
termination of organelle proliferation. A primary role
in medium-chain fatty acid oxidation has been
described for Pex11p in S. cerevisiae, suggesting a sec-
ondary role inperoxisome fission [16]. However, the
observation that Pex11p acts directly in peroxisome
division independently of peroxisome metabolism sug-
gests a distinct role in the peroxisome fission process
[9,17].
In this study, we characterized H. polymorpha
PEX11 and analyzed its role inperoxisome biology.
Consistent with other studies, in H. polymorpha
peroxisome abundance could be manipulated by vary-
ing Pex11p levels. However, we also found a novel
unexpected role for Pex11p in regulating peroxisome
retention ⁄ inheritance during vegetative reproduction
Keywords
inheritance; Inp1p; peroxisome; Pex11p;
yeast
Correspondence
I. J. van der Klei, P.O. Box 14,
9750AA Haren, The Netherlands
Fax: +31 50 363 8280
Tel: +31 50 363 2179
E-mail: i.j.van.der.klei@rug.nl
(Received 7 November 2008, revised 22
December 2008, accepted 30 December
2008)
doi:10.1111/j.1742-4658.2009.06883.x
We have cloned and characterized the HansenulapolymorphaPEX11 gene.
Our morphological data are consistent with previous observations that
peroxisome proliferation can be regulated by modulating Pex11p levels.
Surprisingly, pex11cells also showed a defect inperoxisomeretention in
mother cells during vegetative cell reproduction. Until now, Saccharo-
myces cerevisiae Inp1p has been the only peroxisomal protein that has been
shown to play a role in the organelle retention process. H. polymorpha inp1
cells are also affectedinperoxisome retention, like pex11 cells. We show by
time-lapse imaging that Inp1–green fluorescent protein localization varies
during the cell cycle and that the protein is normally recruited to peroxi-
somes inpex11 cells. Taken together, our data show that H. polymorpha
Pex11p is not only important for peroxisome proliferation but is also
required for proper peroxisome segregation during cell division.
Abbreviation
GFP, green fluorescent protein.
FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS 1429
of cells. Until now, only the peripheral membrane
protein Inp1 of S. cerevisiae has been implicated as
playing a direct role inperoxisomeretention ⁄ inheri-
tance [18].
Results
Identification and characterization of
H. polymorpha PEX11
A tblastn search using the primary sequence of
S. cerevisiae Pex11p as a query identified a single
H. polymorphaPEX11 candidate in the H. polymorpha
genome [19]. The H. polymorphaPEX11 gene product
consists of 259 amino acids with a calculated mass of
approximately 29 kDa that was similar to S. cerevisiae
Pex11p (32% identity). The nucleotide sequence of the
gene has been deposited in GenBank (accession num-
ber DQ645582). Cells of a constructed PEX11 deletion
strain (pex11) grew like the wild-type on glucose (not
shown), but displayed a minor but significant growth
defect when grown in the presence of methanol as sole
carbon and energy source (Fig. 1A). Electron micros-
copy revealed that methanol-grown pex11cells gener-
ally contained a single enlarged peroxisome (Fig. 1C).
Transformation of pex11cells with a plasmid contain-
ing PEX11 restored a normal wild-type phenotype,
confirming that authentic PEX11 was deleted in pex11
10
1
0.1
A
660
WT
0
10
20
Time (h)
30 40
pe×11
A B
C
D
Fig. 1. PEX11 controls peroxisome number in H. polymorpha. Growth experiments with H. polymorphapex11cells revealed that the dou-
bling time of cells under peroxisome-inducing condition are retarded relative to the wild-type (WT) (A). The graphs represent the average of
three independent experiments. The bars represent standard error. Ultrathin sections through methanol-grown, KMnO
4
-fixed wild-type
control cell (B) and a pex11 (C) cell demonstrating the presence of an enlarged peroxisomeinpex11cells relative to the normal multiple
organelles in wild-type controls. Overexpression of PEX11 results in massive peroxisome proliferation (D). The bars represent 0.5 lm.
P, peroxisome; M, mitochondrion; N, nucleus; V, vacuole.
A role of Pex11inperoxisomeretentionin yeast A. M. Krikken et al.
1430 FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS
cells (not shown). As observed for other organisms,
overexpression of PEX11in wild-type cells resulted in
massive peroxisome proliferation (Fig. 1D).
Deletion of PEX11 affects normal peroxisome
partitioning in budding cells
H. polymorpha cells, grown to the mid-exponential
growth phase on glucose, characteristically contain a
single peroxisome per cell [20]. During vegetative cell
reproduction, these organelles are typically positioned
in the neck region between mother cell and bud prior
to fission; one of the resulting organelles then migrates
into the developing daughter cell (bud) (Fig. 2A).
However, inpex11 cells, organelle positioning and
fission was not observed. Instead, the single organelle
present in the mother cells migrated into the buds,
leaving the mother cells devoid of peroxisomes at the
late stages of the budding process (Fig. 2B). In the few
exceptional cases of cells that contained two peroxi-
somes, these two organelles migrated to the bud
(Fig. 2B, inset). To substantiate the above observa-
tions, quantitative analyses were performed. To this
end, Z-stacks were acquired from randomly selected
cells using confocal microscopy, and peroxisome loca-
tion was determined. The data presented in Fig. 2C
show that in wild-type cells, essentially all mother and
daughter cells contain a peroxisome (Fig. 2C). How-
ever, inpex11 cells, a significant percentage of the bud-
ding cells lacked peroxisomes in the mother cells.
Electron microscopy confirmed that in budding pex11
cells, peroxisomal structures are not detectable in the
mother cell after migration of the organelles to the
buds (Fig. 2D).
100
80
60
40
Cell frequency (%)
20
0
Peroxisome
only in mother
Peroxisome
only in bud
Peroxisome
mother and bud
no
peroxisomes
pe×11
WT
A
B
C
D
Fig. 2. Budding of PEX11 deletion cells results in mother cells lacking peroxisomes. Analysis of Z-stacks of glucose-grown cells producing
GFP–SKL recorded by confocal laser scanning microscopy revealed that in wild-type (WT) cells, peroxisomes are evenly distributed over the
mother cell and developing bud (A). Inpex11 cells, peroxisomes are predominantly present in the daughter cell (B).Quantification of peroxi-
somes inpex11 and wild-type cells. For each sample, peroxisomes from 2 · 100 cells were counted from two independent experiments.
The bar represents the standard error of the mean. (C). Electron microscopy of glucose-grown cells revealed the presence of peroxisomes
in developing buds but not in the mother cell (D). The bar represents 2 lm in (A) and (B), and 0.5 lm in (D). P, peroxisome; M, mitochon-
drion; N, nucleus; V, vacuole.
A. M. Krikken et al. A role of Pex11inperoxisomeretentionin yeast
FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS 1431
The above observation, that the organelles are not
positioned in the neck region between mother cell and
bud prior to fission, lends support to the view that orga-
nelle retention is disturbed inpex11 cells. To study the
putative defect inperoxisomeretentionin more detail,
video microscopy of wild-type and pex11cells that
produce green fluorescent protein containing the
carboxyterminal tripeptide serine lysine leucine that
functions as peroxisomal targeting signal (GFP-SKL)
was performed. In wild-type control cells, peroxisomes
are normally distributed over mother and daughter cells
at an early stage of bud formation (Fig. 3A; Video S1).
As shown in Video S2, the peroxisomes inpex11 cells
migrate into the daughter cell at an early stage of bud
formation, leaving the mother cell devoid of these struc-
tures. Infrequently, a peroxisome moving from mother
to daughter and vice versa was observed, akin to previ-
ous observations in S. cerevisiae inp1 cells [18] (Fig. 3B).
Inp1p is localized to peroxisomes inpex11 cells
The observed peroxisome phenotype of H. polymorpha
pex11 cells shows a strong resemblance to the per-
oxisome inheritance phenotype of S. cerevisiae and
Yarrowia lipolytica inp1 cells [18,21]. This led us to
investigate the role of Inp1p in H. polymorpha. First, an
INP1 deletion (inp1) strain was constructed. A tblastn
search using the primary sequence of S. cerevisiae Inp1p
as a query identified a single H. polymorpha INP1
candidate in the H. polymorpha genome [19]. The
H. polymorpha INP1 gene product consists of 405
amino acids with a calculated mass of approximately
45 kDa that is similar to S. cerevisiae Inp1p (19% iden-
tity). The nucleotide sequence of this gene has been
deposited in GenBank (accession number FJ481644).
Analysis of GFP–SKL-producing inp1 cells grown on
glucose revealed that the organelles migrated into the
buds, leaving the mother cells devoid of peroxisomes at
late stages of the budding process, similarly to pex11
cells (Fig. 4A). Subsequently, peroxisome inheritance
was quantified as detailed for pex11 cells. The data pre-
sented in Fig. 4B show that in inp1 cells a significant
percentage of the budding cells lacked peroxisomes in
the mother cells under conditions in which wild-type
cells displayed normal distribution patterns. The
observed inheritance phenotype for pex11 and inp1 are
strikingly similar (compare Figs 2C and 4B).
To investigate whether the H. polymorphapex11 phe-
notype is related to improper association of Inp1p with
peroxisomes, we constructed a pex11 strain producing
Inp1–GFP from the homologous INP1 promoter in
conjunction with DsRed–SKL to mark peroxisomes.
Fluorescence microscopy revealed that Inp1–GFP colo-
calizes with peroxisomes both inpex11 and in wild-type
control cells (Fig. 4C) under conditions in which the
protein is present at wild-type levels (Fig. 4D). This
indicates that Pex11p is not essential to recruit Inp1p
to the peroxisomal membrane.
We also studied Inp1–GFP distribution in vivo in
pex11 cells by time-lapse imaging, using wild-type cells
as control. These studies indicated that in the wild-type
control cells, Inp1–GFP fluorescence is often below the
A
B
Fig. 3. Peroxisomeretention is disturbed in pex11. Selected images were taken from time-lapse series of budding cells, using GFP–SKL to
mark peroxisomes. In wild-type cells, the organelle divides prior to budding (20 min) and the newly formed smaller peroxisome migrates into
the bud (22 min) (A) (Video S1). Inpex11 cells, peroxisomes migrate into the daughter cell at an early stage of bud formation, leaving the
mother cell devoid of these structures (B) (Video S2). The bar represents 2 lm.
A role of Pex11inperoxisomeretentionin yeast A. M. Krikken et al.
1432 FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS
A
C
B
D
Fig. 4. The phenotype of H. polymorpha inp1 and the localization of Inp1–GFP in wild-type (WT) and pex11 cells. Cells producing GFP–SKL
to mark peroxisomes were grown on glucose. Analysis of Z-stacks recorded by confocal laser scanning microscopy revealed that in inp1
cells, peroxisomes are predominantly present in the daughter cells (A). Quantification of Z-stacks for the presence or absence of peroxi-
somes in the mother and daughter cell was carried out in budding cells. For each sample, peroxisomes were counted from 2 · 100 cells
from two independent experiments. The bar represents the standard error of the mean (B). Fluorescence microscopy showed that in bud-
ding wild-type cells, Inp1–GFP colocalized with DsRed–SKL peroxisomes (C, upper panel). Inpex11 cells, Inp1–GFP is still present in peroxi-
somes (C, lower panel). The bar in (A) represents 5 lm, and that in (C) 2 lm. (D) shows a western blot, prepared from crude extracts of
glucose-grown pex11 and wild-type control cells, producing Inp1–GFP. The blots, decorated with antibodies against GFP, show that the
Inp1–GFP levels inpex11cells and wild-type cellsare comparable. Equal amounts of protein are loaded per lane.
A
B
Fig. 5. Inp1p localization changes during cell budding. Selected images were taken of time-lapse series of wild-type cells producing
Inp1–GFP from the endogenous INP1 promoter. In wild-type cells (A), the levels of peroxisome-associated Inp1–GFP fluorescence intensity
vary. At several stages, the levels of Inp1–GFP fluorescence are below the level of detection (0 and 60 min). At the initial stages of budding,
fluorescence is markedly increased on the peroxisome to be retained in the mother cell (42 and 120 min). In early budding pex11 cells
(B), Inp1–GFP is also localized to peroxisomes (105 min), but the Inp1–GFP-containing organelle is not retained in the mother cell but moves
into the young bud (114 min). The bar represents 2 lm.
A. M. Krikken et al. A role of Pex11inperoxisomeretentionin yeast
FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS 1433
limit of detection in nonbudding cells (Fig. 5A;
Video S3). As the western blots revealed that the level
of Inp–GFP inpex11cells is somewhat reduced
relative to wild-type levels (Fig. 4D), these data are
consistent with the view that, as in baker’s yeast [18],
increased amounts of Inp1p may be present at certain
stages of the cell cycle. Upon initiation of bud forma-
tion, Inp1–GFP fluorescence is evident on the
peroxisomes that are retained in the mother cells. In
pex11 cells, Inp1–GFP is localized to peroxisomes
independently of whether they are transported into the
bud. In wild-type cells, Inp1–GFP-containing peroxi-
somes have never been observed to be transported into
the bud; however, at later stages of bud development,
Inp1–GFP is again recruited to the organelles (Fig. 5B;
Video S4).
Discussion
Here we report the characterization of the H. polymor-
pha PEX11 deletion strain.
Pex11p has been identified before in various organ-
isms, including yeast, humans, plants and trypano-
somes. Pex11p is the first peroxin to be implicated in
peroxisome proliferation. Our findings, that peroxi-
some abundance in H. polymorpha can be regulated
through manipulation of Pex11p levels, are consistent
with findings in the other organisms [10–12]. Various
functions have been suggested for Pex11p, including a
role in deforming membranes, recruiting Fis1p to the
peroxisomal membrane, and regulating lipid composi-
tion or transport of lipids ⁄ fatty acids [12,14–16,22]. In
the current study, we found a novel, unexpected func-
tion of Pex11p in organelle retention. This was evident
from the finding that inpex11cells the normal orga-
nelle fission process was disturbed. This phenomenon
was not observed in H. polymorpha dnm1 or mpp1
cells, which also typically contain single organelles
[9,23].
A defect inretention is not unique for H. poly-
morpha pex11. S. cerevisiae inp1 cells also have
reduced peroxisome numbers and show the same
inheritance defect as observed in H. polymorpha pex11
cells. An attractive hypothesis is that peroxisome
anchoring is required for peroxisome fission and distri-
bution [24]. The S. cerevisiae anchoring protein Inp1p
shows interactions with Pex25p, Pex30p and Vps1p.
All of these proteins have been shown to play a role in
peroxisome fission.
Also in H. polymorpha inp1 cells, peroxisome reten-
tion is disturbed, which is similar to observations in
S. cerevisiae and Y. lipolytica [18,21]. Interestingly, in
budding H. polymorphapex11 cells, Inp1–GFP is
normally sorted to peroxisomes. Therefore, Inp1p
targeting to H. polymorpha peroxisomes is not depen-
dent on Pex11p. The failure inretention may be
explained by the fact that the pulling force exerted by
the molecular motor Myo2p is stronger than the reten-
tion force in the absence of Pex11p. However, the
principles of Inp1p dysfunction in the absence of
Pex11p are still unknown and require further investiga-
tion. Our data also showed that Inp1–GFP localization
varied during the cell cycle. This modulation might be
important in regulating peroxisome anchoring. Our
data are consistent with the view that Inp1p function
(but not location) might be dependent on Pex11p.
The identification of the cortical anchor to which
peroxisomes attach will provide further clues about the
molecular mechanism of peroxisome inheritance and
fission.
Experimental procedures
Organisms and growth
The H. polymorpha strains used in this study are
NCYC495 derivatives (Table 1). The cells were cultivated
in batch cultures at 37 °C on YPD (1% yeast extract, 1%
peptone and 1% glucose), selective minimal medium con-
taining 0.67% Yeast Nitrogen Base without amino acids
(DIFCO), or minimal medium [25] using 0.5% glucose or
0.5% methanol as respective carbon sources in the pres-
ence of 0.25% ammonium sulfate or 0.25% methylamine
as the nitrogen source. When required, amino acids or
uracil were added to a final concentration of 30 lgÆmL
)1
.
For growth on agar plates, the media were supplemented
with 2% agar. For selection of zeocin-resistant trans-
formants, YPD plates containing 100 lgÆmL
)1
zeocin
(Invitrogen) were used.
For cloning purposes, Escherichia coli DH5a was used.
Cells were grown at 37 °C in LB supplemented with kana-
mycin (100 lgÆmL
)1
) or ampicillin (100 lgÆmL
)1
).
Molecular techniques
The plasmids and oligonucleotide primers used in this study
are listed in Tables 2 and 3, respectively. Standard recombi-
nant techniques were carried out essentially according to
Sambrook et al. [26]. Transformation of H. polymorpha
cells and site-specific integration were performed as previ-
ously described [27]. DNA-modifying enzymes were used as
recommended by the suppliers (Roche, Almere, the Nether-
lands; Fermentas, St Leon-Rot, Germany). Preparative
PCR was performed using pwo polymerase according to the
instructions of the supplier (Roche, Almere, the Nether-
lands). Oligonucleotides were synthesized by Biolegio
(Nijmegen, the Netherlands). DNA sequencing reactions
A role of Pex11inperoxisomeretentionin yeast A. M. Krikken et al.
1434 FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS
were performed at ServiceXS (Leiden, the Netherlands).
For DNA sequence analysis, the clone manager 5 pro-
gram (Scientific and Educational Software, Durham, USA)
was used. blast algorithms [28] were used to screen data-
bases at the National Center for Biotechnology Information
(Bethesda, MD, USA). The clustal_x program was used
to align protein sequences [29].
Construction of an H. polymorphaPEX11 null
mutant
A PEX11 deletion strain was constructed by replacing the
region of PEX11 comprising nucleotides +375 to +749
with an auxotrophic marker. To this end, a deletion con-
struct was made using Gateway Technology (Invitrogen,
Breda, the Netherlands). Two DNA fragments comprising
the regions )13 to +374 and +750 to +1480 of the
PEX11 genomic region were obtained by PCR with the
primers PEX11-attB4-fw + PEX11-attB1-rev and PEX11-
attB2-fw + PEX11-attB3-rev, respectively, using genomic
H. polymorpha DNA as a template. The PCR fragments
were cloned in the vectors pDONR P4-1R and
pDONR P2-P3, respectively. Subsequently, BP recombina-
tion resulted in entry vectors pKVK106 and pKVK107.
Additionally, a DNA fragment comprising the region )512
to +1042 of the H. polymorpha URA3 gene was obtained
Table 2. Plasmids used in this study. GFP, green fluorescent protein; Sc, Saccharomyces cerevisiae.
Plasmid Description Reference
pDONR P4-1R Gateway vector Invitrogen
pDONR P2-P3 Gateway vector Invitrogen
pKVK106 pDONR4 P4-1R containing 5¢-region of PEX11 This study
pKVK107 pDONR P2-P3 containing 3¢-region of PEX11 This study
pBSK URA3 pBluescript II containing H. polymorpha URA3, amp
R
[23]
pDONR221 Gateway vector Invitrogen
pENTR221 ⁄ URA3 Gateway vector containing URA3 This study
pDEST R4-R1 Gateway destination vector Invitrogen
pKVK108 pDEST R4-R3 containing PEX11 deletion cassette This study
pFEM35 pHIPX7 containing GFP–SKL; kan
R
, Sc-Leu2 This study
pANL29 pHIPZ4 containing P
AOX
GFP–SKL; amp
R
, zeo
R
[23]
pHIPZ4 DsRed–SKL Plasmid containing P
AOX
DsRed–SKL; amp
R
, zeo
R
[34]
pHIPZ4 PEX11 Plasmid containing P
AOX
PEX11; amp
R
, zeo
R
This study
pHS6A E. coli. ⁄ H. polymorpha shuttle vector; amp
R
, Sc-Leu2, HARS1 [23]
pHS6A PEX11 Plasmid containing PEX11 complementing fragment This study
pANL31 Plasmid containing GFP without start codon; zeo
R
, amp
R
[23]
pAMK6 pANL31 containing the 3¢-end of the INP1 gene fused in-frame to GFP; zeo
R
, amp
R
This study
pAMK15 pHIPX7 containing DsRed–SKL; kan
R
, Sc-Leu2 This study
pHIPX7 Plasmid containing H. polymorpha TEF1 promoter [31]
pHIPX7 PEX3 Plasmid containing PEX3 gene; kan
R
, Sc-Leu2 [31]
pBSK URA3 pBluescript SK
+
containing H. polymorpha URA3 fragment; Amp
R
[23]
pAMK18 pBluescript containing the cassette for the deletion of the INP1 gene This study
Table 1. H. polymorpha strains used in this study. GFP, green fluorescent protein.
Strain Description Reference
WT leu1.1 ura3 NCYC495, leu1.1 ura3 [33]
WT leu1.1 NCYC495, leu1.1 [33]
WT::P
TEF1
GFP–SKL Wild type with integration of plasmid pHIPX7 GFP–SKL This study
WT::P
AOX
PEX11 Wild type with one copy integration of plasmid pSUS0048 This study
WT::P
INP1
INP1–GFP Wild type with integration of plasmid pAMK6 This study
WT::P
INP1
INP1–GFP::P
TEF1
DsRed–SKL Wild type with integration of plasmids pAMK6 and pHIPX7 DsRed–SKL This study
pex11::URA3 PEX11 deletion strain, leu1.1 This study
pex11::P
TEF1
GFP–SKL pex11 with integration of plasmid pHIPX7 GFP–SKL This study
pex11:: P
INP1
INP1–GFP pex11 with integration of plasmid pAMK6 This study
pex11:: P
INP1
INP1–GFP::P
TEF1
DsRed–SKL pex11 with integration of plasmids pAMK6 and pHIPX7 DsRed–SKL This study
pex11:: pHS6A–PEX11 pHS6A with the entire H. polymorphaPEX11 gene This study
inp1::URA3 INP1 deletion strain, leu1.1 This study
inp1::P
TEF1
GFP–SKL inp1 with integration of plasmid pHIPX7 GFP–SKL This study
A. M. Krikken et al. A role of Pex11inperoxisomeretentionin yeast
FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS 1435
by PCR with the primers Entr221_URA_F and
Entr221_URA_R, using plasmid pBSKURA3 [23] as
template, and recombined into vector pDONR221, resulting
in entry vector pENTR221 ⁄ URA3. Subsequently, LR
recombination of plasmids pKVK106, pENTR221 ⁄ URA3
and pKVK107 with the destination vector pDEST R4-R1
resulted in the deletion vector, which was designated
pKVK108. Finally, a 2.6 kb PEX11 deletion cassette was
obtained by PCR with the primers PEX11-del3.1 +
PEX11-del3.2, using pKVK108 as template; this was used
to transform H. polymorpha wild-type leu1.1 ura3 cells.
Uracil prototrophic transformants were selected. Correct
integration was confirmed by PCR with primers PEX11-4.1
and PEX11-4.2, as well as by Southern blot analysis (data
not shown). The resulting strain was designated pex11.
To enable visualization of peroxisomes inpex11 cells
grown on glucose media by fluorescence microscopy, we
cloned the GFP–SKL gene behind the constitutive H. poly-
morpha TEF1 promoter. For this, a 0.8 kb BamHI–SalI
fragment containing GFP–SKL [30] was inserted between
the BamHI and SalI sites of vector pHIPX7 [31]. The
resulting plasmid, designated pFEM35, was linearized with
StuI in the TEF1 region and was used to transform wild-
type and pex11 cells.
A plasmid containing the entire PEX11 gene (region
)614 to +272) was isolated by PCR using primers PEX11
comp-fw and PEX11 comp-rev, with wild-type genomic
H. polymorpha DNA as template. The resulting product
was digested with BamHI and SphI and cloned between
the BamHI and SphI sites of vector pHS6A, resulting in
plasmid pHS6A PEX11.
Construction of an H. polymorpha
Pex11p-overproducing strain
For overproduction of Pex11p in wild-type H. polymor-
pha, we cloned PEX11 behind the strong inducible
promoter of the H. polymorpha AOX gene. A DNA
fragment containing the complete PEX11 gene was
obtained by PCR using primers PEX11-fw and PEX11-
rev. The PCR product was digested with HindIII and
SalI, and subsequently ligated in pHIPZ4 DsRed-SKL
digested with HindIII and SalI, thereby replacing the
DsRed-SKL gene. The resulting plasmid was designated
pHIPZ4 PEX11.
Subsequently, pHIPZ4 PEX11 was linearized with SphI
and was used to transform H. polymorpha wild-type cells.
Proper integration was tested by PCR using primers AOX-
detect-F and PEX11-rev and by southern blotting (data not
shown). A strain containing a single copy of the expression
cassette was selected for further studies.
Table 3. Primers used in this study.
Primer Sequence (5¢-to3¢)
PEX11-attB4-fw GGGGACAACTTTGTATAGAAAAGTTGCAGACAGTTATCCAAGGTTTGCGACACG
PEX11-attB1-rev GGGGACTGCTTTTTTGTACAAACTTGCGCAGCAATCCTAGCAACTTG
PEX11-attB2-fw GGGGACAGCTTTCTTGTACAAAGTGGCACTAGCACGACCGAGTCTTC
PEX11-attB3-rev GGGGACAACTTTGTATAATAAAGTTGGGTCGGTAGTCTAGTGGTATG
Entr221_URA_F GGGGACAAGTTTGTACAAAAAAGCAGGCTGAGCTTCAACTGATGTTCAGC
Entr221_URA_R GGGGACCACTTTGTACAAGAAAGCTGGGTCGAAGCACATCAACTGGATCG
PEX11-del3.1 CAGACAGTTATCCAAGGTTTGCG
PEX11-del3.2 GGTCGGTAGTCTAGTGGTATG
PEX11–4.1 GTCCAATCCGCGTTCTCCTC
PEX11–4.2 GCGACTGATTCGGCAAGATG
INP1GFP fw CCCAAGCTTGGGCTATGTGAGGTATTGGGC
INP1GFP rev GGAAGATCTCCACCCAAACACTCGCGTGC
EMK2 GTGCAGATGAACTTCAGGGTCAGCTTG
INP1GFP int GTACCCACACAAACAATAACG
PEX11-fw ATACTGAAGCTTATGGTTTGCGACACGATAAC
PEX11-rev ACATTGGTCGACTCATAGCACAGAAGACTCGG
AOX-detect-F CACCAGCGGATCTTCCTGG
PEX11 comp-fw CGGGATCCCGTTGAACCCGATCGACAGG
PEX11 comp-rev GTACATGCATGCCGATGTGCTCATTATGAGCG
Inp1-1 CCGCTCGAGGGTAAGCCATCCGAGTTTGG
Inp1–2 CCAATGCATTGGTTCTGCAGCGACCGTCGCACTATGTCC
Inp1–3 AGATCTTCCACGAGGAGGACAAAGACGAC
Inp1–4 TTTTCCTTTTGCGGCCGCCCATGTTGCGTAGTTCTTCC
Inp1 del forward GTGTCTGGTAGCTCATTCTGG
Inp1 del reverse GCGTGCCTCGTTGTTGAGCC
Ura3 forward ACGCCGATCCAGTTGATGTG
Inp1 reverse CCATGTTGCGTAGTTCTTCC
A role of Pex11inperoxisomeretentionin yeast A. M. Krikken et al.
1436 FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS
Construction of an H. polymorpha INP1 null
mutant
An INP1 deletion strain (inp1) was made by replacing the
genomic region of INP1 by the auxotrophic marker URA3.
To this end, a deletion cassette was constructed as follows.
First, two DNA fragments comprising the regions )344 to
+197 and +910 to +1515 of the INP1 genomic region
were obtained by PCR, using primers Inp1-1 + Inp1-2 and
Inp1-3 + Inp1-4, respectively. After digestion with
XhoI+PstI and NotI+BglII, respectively, the resulting
fragments were inserted upstream and downstream of the
H. polymorpha URA3 gene in pBSKURA3. From the
resulting plasmid, named pAMK18, a deletion fragment
was obtained by PCR using primers Inp1 del for-
ward + Inp1 del reverse and transformed to H. polymor-
pha NCYC495 leu1.1 ura3. Uracil prototrophic
transformants were selected. Correct integration was con-
firmed by PCR with primers Ura3 forward and Inp1
reverse as well as by Southern blot analysis (data not
shown). The resulting strain was designated inp1. To visual-
ize peroxisomes in glucose-grown inp1 cells, SphI-linearized
pFEM35 was transformed and leucine-resistant colonies
were selected for further analysis.
Construction of an H. polymorpha strain
expressing Inp1–GFP
To enable Inp1p localization in H. polymorpha wild-type and
pex11 cells, an in-frame fusion was constructed of the C-ter-
minus of the INP1 gene with the GFP gene, under the control
of its homologous INP1 promoter. The INP1 gene was
amplified using primers Inp1GFP fw and Inp1GFP rev,
resulting in a product lacking the stop codon. This PCR
product was then digested with BglII and HindIII and ligated
in pANL31 [23], resulting in plasmid pAMK6. Plasmid
pAMK6 was linearized with NruI and integrated into
H. polymorpha wild-type and pex11 cells. Proper integration
was tested by PCR using primers EMK2 and Inp1GFP int
and by Southern blotting (data not shown).
To identify peroxisomes in glucose-grown cells, the plas-
mid pHIPZ4 DsRed–SKL was digested with BamHI and
SalI. The obtained DsRed–SKL fragment was subsequently
ligated in pHIPX7 PEX3 [31] digested with BamHI and
SalI, resulting in plasmid pAMK15. Plasmid pAMK15 was
linearized with DraI and integrated into pex11::P
INP1
INP1–
GFP and WT::P
INP1
INP1–GFP.
Biochemical methods
SDS ⁄ PAGE and western blotting were performed by estab-
lished methods. Equal amounts of protein were loaded per
lane. Blots were decorated using monoclonal GFP anti-
bodies (B-2; Santa Cruz Biotechnology, Inc., Santa Cruz,
CA, USA), using the BM chemiluminescence western blot-
ting kit (Roche Diagnostics GmbH, Mannheim, Germany).
Microscopy
Wide-field fluorescence imaging was performed using a
Zeiss Axioskop50 fluorescence microscope (Carl Zeiss,
Oberkochen, Germany). Images were taken with a Prince-
ton Instruments 1300Y digital camera.
GFP signal was visualized with a 470 ⁄ 40 nm bandpass exci-
tation filter, a 495 nm dichromatic mirror, and a 525 ⁄ 50 nm
bandpass emission filter. DsRed fluorescence was visualized
with a 546 ⁄ 12 nm bandpass excitation filter, a 560 nm dichro-
matic mirror, and a 575–640 nm bandpass emission filter.
Confocal imaging was performed on a Zeiss LSM510 con-
focal microscope, using Hamamatsu photomultiplier tubes.
GFP signal was visualized by excitation with a 488 nm argon
laser (Lasos), and emission was detected using a 500–550 nm
bandpass emission filter. The DsRed signal was visualized by
excitation with a 543 nm helium neon laser (Lasos), and
emission was detected using a 565–615 nm bandpass emis-
sion filter. For live cell imaging, the temperature of the objec-
tive and the object slide was kept at 37 °C. Six Z-axis planes
were acquired for each time interval to ensure that no fluores-
cent structures were missed. Image analysis was carried out
using imagej (http://rsb.info.nih.gov/nih-image/) and ⁄ or
Zeiss lsm image browser.
Whole cells were fixed and prepared for electron micros-
copy as described previously [32].
Quantification of peroxisomes
For quantification, cells were grown until A
663
= 1.0 on
mineral media containing glucose, and subsequently fixed
using 1% formaldehyde in 10 mm potassium phosphate
buffer (pH 7.5) for 1 h. To quantify peroxisome inheri-
tance, random pictures of budding cells were taken as a
stack in both bright field and fluorescence mode. Z-stacks
were made containing 17 optical slices of 0.9 lm thickness
to cover the entire cell. The Z-axis spacing was 0.5 lm, to
ensure that no fluorescent signals were missed.
Using the Zeiss lsm image browser software, the cross-
sectional area of the mother and bud cell was determined.
Assuming yeast cells to be spherical, the bud volume was
determined as percentage of that of the mother cell, tenta-
tively set to 100%. Only cells for which the bud volume
was < 25% of the mother cell volume were counted.
Quantification experiments were performed using two inde-
pendent cell cultures (100 cells per culture).
Acknowledgements
We thank Rhein Biotech GmbH, Du
¨
sseldorf, Germany,
for access to the H. polymorpha genome database. We
A. M. Krikken et al. A role of Pex11inperoxisomeretentionin yeast
FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS 1437
thank S. Fekken and K. Kuravi for assistance in pre-
paring plasmids and strains. R. Booij is acknowledged
for excellent electron microscopy support.
References
1 van der Klei IJ & Veenhuis M (2006) Yeast and fila-
mentous fungi as model organisms in microbody
research. Biochim Biophys Acta 1763, 1364–1373.
2 Wanders RJ & Waterham HR (2005) Peroxisomal
disorders I: biochemistry and genetics of peroxisome
biogenesis disorders. Clin Genet 67, 107–133.
3 Lazarow PB & Fujiki Y (1985) Biogenesis of peroxi-
somes. Annu Rev Cell Biol 1, 489–530.
4 Hoepfner D, Schildknegt D, Braakman I, Philippsen P
& Tabak HF (2005) Contribution of the endoplasmic
reticulum to peroxisome formation. Cell 122, 85–95.
5 Kragt A, Voorn-Brouwer T, van den Berg M & Distel
B (2005) Endoplasmic reticulum-directed Pex3p routes
to peroxisomes and restores peroxisome formation in a
Saccharomyces cerevisiae pex3Delta strain. J Biol Chem
280, 34350–34357.
6 Tam YY, Fagarasanu A, Fagarasanu M & Rachubinski
RA (2005) Pex3p initiates the formation of a preperox-
isomal compartment from a subdomain of the endo-
plasmic reticulum in Saccharomyces cerevisiae. J Biol
Chem 280, 34933–34939.
7 Haan GJ, Baerends RJ, Krikken AM, Otzen M,
Veenhuis M & van der Klei IJ (2006) Reassembly of
peroxisomes inHansenulapolymorpha pex3 cells on
reintroduction of Pex3p involves the nuclear envelope.
FEMS Yeast Res 6, 186–194.
8 Motley AM & Hettema EH (2007) Yeast peroxisomes
multiply by growth and division. J Cell Biol 178 , 399–
410.
9 Nagotu S, Saraya R, Otzen M, Veenhuis M & van der
Klei IJ (2008) Peroxisome proliferation in Hansenula
polymorpha requires Dnm1p which mediates fission but
not de novo formation. Biochim Biophys Acta 1783,
760–769.
10 Erdmann R & Blobel G (1995) Giant peroxisomes in
oleic acid-induced Saccharomyces cerevisiae lacking the
peroxisomal membrane protein Pmp27p. J Cell Biol
128, 509–523.
11 Marshall PA, Krimkevich YI, Lark RH, Dyer JM,
Veenhuis M & Goodman JM (1995) Pmp27 promotes
peroxisomal proliferation. J Cell Biol 129, 345–355.
12 Sakai Y, Marshall PA, Saiganji A, Takabe K, Saiki H,
Kato N & Goodman JM (1995) The Candida boidinii
peroxisomal membrane protein Pmp30 has a role in
peroxisomal proliferation and is functionally homolo-
gous to Pmp27 from Saccharomyces cerevisiae. J Bacte-
riol 177, 6773–6781.
13 Kiel JA, van der Klei IJ, van den Berg MA, Bovenberg
RA & Veenhuis M (2005) Overproduction of a single
protein, Pc-Pex11p, results in 2-fold enhanced penicillin
production by Penicillium chrysogenum. Fungal Genet
Biol 42, 154–164.
14 Lorenz P, Maier AG, Baumgart E, Erdmann R & Clay-
ton C (1998) Elongation and clustering of glycosomes
in Trypanosoma brucei overexpressing the glycosomal
Pex11p. EMBO J 17, 3542–3555.
15 Marshall PA, Dyer JM, Quick ME & Goodman JM
(1996) Redox-sensitive homodimerization of Pex11p: a
proposed mechanism to regulate peroxisomal division.
J Cell Biol 135
, 123–137.
16 van Roermund CW, Tabak HF, van Den Berg M,
Wanders RJ & Hettema EH (2000) Pex11p plays a pri-
mary role in medium-chain fatty acid oxidation, a pro-
cess that affects peroxisome number and size in
Saccharomyces cerevisiae. J Cell Biol 150, 489–498.
17 Li X & Gould SJ (2002) PEX11 promotes peroxisome
division independently of peroxisome metabolism.
J Cell Biol 156, 643–651.
18 Fagarasanu M, Fagarasanu A, Tam YY, Aitchison JD
& Rachubinski RA (2005) Inp1p is a peroxisomal mem-
brane protein required for peroxisome inheritance in
Saccharomyces cerevisiae. J Cell Biol 169, 765–775.
19 Ramezani-Rad M, Hollenberg CP, Lauber J, Wedler H,
Griess E, Wagner C, Albermann K, Hani J, Piontek M,
Dahlems U et al. (2003) The Hansenula polymorpha
(strain CBS4732) genome sequencing and analysis.
FEMS Yeast Res 4, 207–215.
20 Veenhuis M, Keizer I & Harder W (1979) Characteriza-
tion of peroxisomes in glucose-grown Hansenula poly-
morpha and their development after the transfer of cells
into methanol-containing media. Arch Microbiol 120,
167–175.
21 Chang J, Fagarasanu A & Rachubinski RA (2007) Per-
oxisomal peripheral membrane protein YlInp1p is
required for peroxisome inheritance and influences the
dimorphic transition in the yeast Yarrowia lipolytica.
Eukaryot Cell 6, 1528–1537.
22 Kobayashi S, Tanaka A & Fujiki Y (2007) Fis1, DLP1,
and Pex11p coordinately regulate peroxisome morpho-
genesis. Exp Cell Res 313, 1675–1686.
23 Leao-Helder AN, Krikken AM, van der Klei IJ, Kiel
JA & Veenhuis M (2003) Transcriptional down-regula-
tion of peroxisome numbers affects selective peroxisome
degradation inHansenula polymorpha. J Biol Chem 278,
40749–40756.
24 Fagarasanu M, Fagarasanu A & Rachubinski RA
(2006) Sharing the wealth: peroxisome inheritance
in budding yeast. Biochim Biophys Acta 1763, 1669–
1677.
25 van Dijken JP, Otto R & Harder W (1976) Growth of
Hansenula polymorphain a methanol-limited chemostat.
Physiological responses due to the involvement of meth-
anol oxidase as a key enzyme in methanol metabolism.
Arch Microbiol 111, 137–144.
A role of Pex11inperoxisomeretentionin yeast A. M. Krikken et al.
1438 FEBS Journal 276 (2009) 1429–1439 ª 2009 The Authors Journal compilation ª 2009 FEBS
[...]... 92–100 Supporting information The following supplementary material is available: Video S1 Time-lapse imaging of peroxisomes in H polymorpha wild-type cells growing in the presence of glucose Video S2 Time-lapse imaging of peroxisomes in H polymorphapex11cells growing in the presence of glucose Video S3 Time-lapse imaging of peroxisomes in H polymorpha wild-type cells producing Inp1–GFP growing in the presence... carboxy- and amino-terminal targeting signals J Cell Biol 127, 737–749 A role of Pex11inperoxisomeretentionin yeast 33 Gleeson MA & Sudbery PE (1988) Genetic analysis in the methylotropic yeast Hansenulapolymorpha Yeast 4, 293–303 34 Monastyrska I, Kiel JA, Krikken AM, Komduur JA, Veenhuis M & van der Klei IJ (2005) The Hansenulapolymorpha ATG25 gene encodes a novel coiled-coil protein that is required... affect normal peroxisome formation inHansenula polymorpha: a sharp increase of the protein level induces the proliferation of numerous, small protein-import competent peroxisomes Yeast 13, 1449–1463 32 Waterham HR, Titorenko VI, Haima P, Cregg JM, Harder W & Veenhuis M (1994) The Hansenulapolymorpha PER1 gene is essential for peroxisome biogenesis and encodes a peroxisomal matrix protein with both... Time-lapse imaging of H polymorphapex11cells producing Inp1–GFP growing in the presence of glucose This supplementary material can be found in the online version of this article Please note: Wiley-Blackwell is not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author... 25, 3389–3402 29 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F & Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 25, 4876–4882 30 Ozimek P, Lahtchev K, Kiel JA, Veenhuis M & van der Klei IJ (2004) Hansenulapolymorpha Swi1p and Snf2p are essential for methanol utilisation FEMS Yeast Res 4, 673–682... Molecular Cloning: A Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 27 Faber KN, Haima P, Harder W, Veenhuis M & Ab G (1994) Highly-efficient electrotransformation of the yeast Hansenulapolymorpha Curr Genet 25, 305– 310 28 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database . wild-type cells producing Inp1–GFP
growing in the presence of glucose.
Video S4. Time-lapse imaging of H. polymorpha pex11
cells producing Inp1–GFP growing in. Time-lapse imaging of peroxisomes in
H. polymorpha pex11 cells growing in the presence of
glucose.
Video S3. Time-lapse imaging of peroxisomes in
H. polymorpha