1. Trang chủ
  2. » Ngoại Ngữ

Modular and selective biosynthesis of gasoline-range alkanes Supplementary Information

13 2 0

Đang tải... (xem toàn văn)

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Định dạng
Số trang 13
Dung lượng 3,74 MB

Nội dung

Modular and selective biosynthesis of gasoline-range alkanes: Supplementary Information Micah J Sheppard1, 2†, Aditya M Kunjapur1, 3†, Kristala L J Prather1, 3* Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139, USA Present Address: Provivi, Inc., 1701 Colorado Avenue, Santa Monica, CA 90404, USA Synthetic Biology Engineering Research Center (SynBERC), Massachusetts Institute of Technology, Cambridge, MA 02139, USA † These authors contributed equally to this work * Corresponding author: Department of Chemical Engineering 77 Massachusetts Avenue Room E17-504G Cambridge, MA 02139 Phone: 617.253.1950 Fax: 617.258.5042 Email: kljp@mit.edu SI Figures Figure S1 Increased soluble expression of FatB2 using truncated variants (A) Anti-His western blot showing expression resulting from four FatB2 variants Increased soluble expression is observed from FatB2m2 (B) Titers of C8 and C10 fatty acids observed in culture supernatant upon expression of FatB2 variants Figure S2 GC-FID traces of alkane standards and representative experiments (A) Overlay of GC traces of an AIRGAS one-point calibration standard mix, n-heptane, n-nonane, and octanal The commercial one-point calibration contained propane, n-butane, and n-pentane, as well as other compounds For compounds not included in the commercial one-point calibration mix, known volumes were added to a 1.127 L septum capped bottle at 4°C and was then warmed to room temperature After evaporation occurred (< min), ml of gas was sampled from the bottle using a gas-tight syringe and injected into the GC Linear regressions were completed using a (0, 0) intercept (B) Overlay of GC traces from representative experiments Figure S3 GC-FID traces focused on each alkane synthesized in biological triplicate (A) Production of heptane (B) Production of pentane (C) Production of butane (D) Production of propane Figure S4 Intermediate and byproduct profiles associated with propane synthesis (A) Relative butyraldehyde concentrations in the headspace of cultures containing Modules 2-BC and 4-SA An increased concentration of butyraldehyde was observed in the gas phase using RARE (B) Liquid-phase concentrations of butyraldehyde and butanol in cultures containing Modules 2-BC and 4-SA Increased levels of butyraldehyde and decreased levels of butanol were observed in the liquid phase using RARE Figure S5 GC-FID traces of isopentane synthesis in biological triplicate and isopentane commercial standard SI Tables Table S1 Performance and separation metrics for select gasoline alternatives and constituents Compound Enthalpy of Combustion (kJ/mol) Ethanol -1370 Butanol -2670 Propane -2220 Butane -2880 Pentane -3510 Heptane -4820 Nonane -6120 Ref (Burgess, 2009) (Burgess, 2009) (Burgess, 2009) (Burgess, 2009) (Burgess, 2009) (Burgess, 2009) (Burgess, 2009) Research Octane Number (RON) 109 96 113 62 -17 Ref (Hunwartzen , 1982) (Jin et al., 2011) (Morley, 1987) (Morley, 1987) (Morley, 1987) (Morley, 1987) Solubility at Room Temperature (mass %) Ref Henry's Law Constant kH (kPa m3 mol-1) Ref fully miscible - - - 10.4 < 0.001 7.2E-03 (1982) (Gevantman, 1996) (Gevantman, 1996) 4.1E-03 (1988a) 128 3.0E-04 (1988a) 230 1.7E-05 (1988b) 333 (1996) (Mackay and Shiu, 1981) (Mackay and Shiu, 1981) (Mackay et al., 1993) (Mackay and Shiu, 1981) (Mackay et al., 1993) 6.7E-03 71.6 95.9 Table S2 Strains and modules used in this study Table S3 Oligonucleotides used in this study SI Text: Codon optimized FATB2Ch gene sequence: ATGGTGGCTGCAGCCGCGTCTTCAGCCTTTTTCCCAGTCCCGGCTCCTGGTGCAAGCCCAAAACCGGGTAAATT TGGCAATTGGCCTAGCAGTCTGAGCCCTAGTTTTAAACCAAAATCTATTCCGAACGGTGGCTTCCAAGTTAAAGC CAATGATTCAGCGCATCCAAAAGCTAACGGTTCTGCAGTGTCATTGAAATCCGGCTCTCTGAACACACAAGAAG ATACGTCCTCTTCACCACCGCCTCGCACCTTTCTGCATCAGCTGCCGGATTGGTCACGTCTGTTAACAGCTATCAC CACTGTCTTCGTTAAATCCAAACGCCCGGATATGCACGATCGTAAATCTAAAAGACCTGATATGCTGGTTGATTCC TTTGGTTTAGAATCTACGGTGCAAGATGGCTTAGTCTTTCGCCAGTCATTCAGCATCCGTTCTTATGAAATTGGTA CAGATAGAACGGCAAGCATCGAAACACTGATGAACCATTTGCAAGAAACGAGTCTGAACCACTGTAAATCCACC GGCATCTTGCTGGATGGTTTTGGCAGAACCTTGGAAATGTGCAAACGCGATCTGATTTGGGTTGTGATCAAAATG CAGATTAAAGTCAATCGTTACCCGGCCTGGGGTGATACCGTTGAAATTAACACTAGATTCTCTCGCCTGGGCAAA ATCGGTATGGGCAGAGATTGGTTAATTAGCGATTGTAATACTGGTGAAATCTTGGTGCGCGCGACAAGTGCTTAT GCAATGATGAACCAAAAAACTCGTAGATTATCCAAATTGCCATACGAAGTTCATCAGGAAATTGTCCCTCTGTTT GTTGATTCTCCAGTGATCGAAGATTCAGATTTAAAGGTTCACAAGTTCAAGGTGAAGACGGGTGATTCTATTCAA AAAGGTTTAACCCCAGGCTGGAATGATTTGGATGTCAACCAGCATGTTAGTAACGTGAAGTACATCGGTTGGATT CTGGAATCCATGCCGACAGAAGTTTTAGAAACGCAGGAATTGTGTTCACTGGCTTTAGAATACCGCCGTGAATGC GGTCGTGATAGCGTCTTGGAAAGTGTTACAGCTATGGACCCAAGCAAAGTGGGCGTCCGTAGTCAATATCAGCA CTTATTGAGACTGGAAGATGGTACTGCCATTGTGAATGGCGCGACTGAATGGAGACCTAAAAATGCCGGTGCGA ACGGCGCTATCTCAACCGGTAAAACTAGCAATGGCAACAGTGTTTCCTAA Codon optimized ADPm gene sequence: (AD_A134FPm has TTT in place of underlined codon) ATGCCGACCCTGGAAATGCCGGTTGCAGCAGTTCTGGATAGCACCGTTGGTAGCAGCGAAGCACTGCCGGATTT TACCAGCGATCGTTATAAAGATGCATATAGCCGTATTAACGCCATTGTGATTGAAGGTGAACAAGAAGCACACGA TAACTATATTGCAATTGGCACCCTGCTGCCGGATCATGTTGAAGAACTGAAACGTCTGGCAAAAATGGAAATGCG CCATAAAAAAGGTTTTACCGCCTGTGGTAAAAATCTGGGTGTTGAAGCAGATATGGATTTTGCCCGTGAATTTTT TGCACCGCTGCGTGATAATTTTCAGACCGCACTGGGTCAGGGTAAAACCCCGACCTGTCTGCTGATTCAGGCAC TGCTGATTGAAGCATTTGCAATTAGCGCATATCATACCTATATTCCGGTTAGCGATCCGTTTGCACGTAAAATTACC 10 GAAGGTGTTGTGAAAGATGAATACACCCATCTGAATTATGGTGAAGCATGGCTGAAAGCAAATCTGGAAAGCTG TCGTGAGGAACTGCTGGAAGCCAATCGTGAAAATCTGCCGCTGATTCGTCGTATGCTGGATCAGGTTGCCGGTG ATGCAGCCGTGCTGCAGATGGATAAAGAAGATCTGATCGAAGATTTCCTGATCGCCTATCAAGAAAGCCTGACC GAAATTGGTTTTAACACCCGTGAAATTACCCGTATGGCAGCAGCAGCACTGGTTAGCTAA Codon optimized ADNp gene sequence: (AD_A122FNp has TTT in place of underlined codon) ATGCAGCAGCTGACCGATCAGAGCAAAGAACTGGATTTCAAAAGCGAAACCTATAAAGATGCCTATAGCCGCAT TAACGCCATTGTTATTGAAGGTGAACAAGAAGCCCACGAGAACTATATTACCCTGGCACAACTGCTGCCGGAAA GCCATGATGAACTGATTCGTCTGAGCAAAATGGAAAGCCGTCATAAAAAAGGTTTTGAAGCCTGTGGTCGTAAT CTGGCAGTTACACCGGATCTGCAGTTTGCAAAAGAATTTTTCAGCGGTCTGCATCAGAATTTTCAGACCGCAGC AGCAGAAGGTAAAGTTGTTACCTGCCTGCTGATTCAGAGCCTGATTATTGAATGTTTTGCCATTGCAGCCTACAA CATTTATATCCCGGTTGCAGATGATTTCGCACGCAAAATTACCGAAGGTGTTGTGAAAGAAGAGTATAGCCATCT GAATTTTGGTGAGGTTTGGCTGAAAGAACATTTTGCAGAAAGCAAAGCAGAACTGGAACTGGCAAATCGTCAG AATCTGCCGATTGTTTGGAAAATGCTGAATCAGGTGGAAGGTGATGCACATACCATGGCAATGGAAAAAGATGC ACTGGTGGAAGATTTCATGATTCAGTATGGTGAAGCCCTGAGCAATATTGGTTTTAGCACCCGTGATATTATGCGT CTGAGCGCCTATGGTCTGATTGGTGCATAA Alkane quantification Gas phase alkane titers were calculated as follows: The gas standard was used to find the gas phase concentration in ppm As described in methods, this concentration corresponded to a 2-fold dilution of the original culture head space Multiplication of the gas phase concentration by head-space volume (found by measuring the mass of water used to fill the vial and subtracting the mL culture volume) results in the total mass of alkane in the head-space Division of the total mass of alkane by the culture volume gives the reported titer 11 1106 mol of product mol of gas L of gas g product 1000 mg of product   MW  product  mol of gas 25.45 L 1000 ml of gas mol product g of product  MWproduct 106   mg of product   25.45  ml of gas 1 ppm of product  MW product 106   ml of gas mg of product 1000 ml of culture 2 (dilution factor)  =   25.45 ml of gas  ppm of product ml of culture L culture   MWproduct 103   mg of product   2.83  L of culture  ppm of product  MW 103   x ppm of product standard mg of product FID area of product   product    y FID area of product standard 2.83  L of culture  ppm of product   mg of product  product titer    L of culture  Heptane standard concentration calculation The exact volume of liter glass bottle with septum cap was found by weighing with water The intended gas phase concentration was then calculated as follows:  mmol  ml  mg  vol heptane ( l)   heptane     mmol heptane   1000  l  ml  MWheptane  mg  1.1273 L 1 atm mmol  mmol of gas in bottle L atm mol 0.0821 277.15 K mol K mmol heptane 106 conc of heptane  ppm  mmol bottle 12 Supplementary References: 1982 Solubility Data Series, International Union of Pure and Applied Chemistry Pergamon Press, Oxford 1988a Solubility Data Series, International Union of Pure and Applied Chemistry Pergamon Press, Oxford 1988b Solubility Data Series, International Union of Pure and Applied Chemistry Pergamon Press, Oxford 1996 Soil Screening Guidance, US Environmental Protection Agency In: Agency, U E P., (Ed.) Office of Solid Waste and Emergency Response, Washington, DC Burgess, D R., 2009 Thermochemical Data NIST Chemistry WebBook, NIST Standard Reference Database Number 69, Eds P.J Linstrom and W.G Mallard National Institute of Standards and Technology, Gaithersburg, MD Gevantman, L., 1996 CRC Handbook of Chemistry and Physics CRC Press, Boca Raton, FL Hunwartzen, I., 1982 Modification of CFR Test Engine Unit to Determine Octane Numbers of Pure Alcohols and Gasoline-Alcohol Blends SAE Technical Paper 820002 Jin, C., Yao, M., Liu, H., Lee, C.-f F., Ji, J., 2011 Progress in the production and application of n-butanol as a biofuel Renewable and Sustainable Energy Reviews 15, 4080-4106 Mackay, D., Shiu, W Y., 1981 A Critical Review of Henry's Law Constants for Chemicals of Environmental Interest J Phys Chem Ref Data 10, 1175-1199 Mackay, D., Shiu, W Y., Ma, K C., 1993 Illustrated Handbook of Physical-Chemical Properties and Environmental Fate for Organic Chemicals Lewis Publishers/CRC Press, Boca Raton, FL Morley, C., 1987 A Fundamentally Based Correlation Between Alkane Structure and Octane Number Combustion Science and Technology 55, 115-123 13 ... mg of product   2.83  L of culture  ppm of product  MW 103   x ppm of product standard mg of product FID area of product   product    y FID area of product standard 2.83  L of. .. mol of product mol of gas L of gas g product 1000 mg of product   MW  product  mol of gas 25.45 L 1000 ml of gas mol product g of product  MWproduct 106   mg of product   25.45  ml of. .. expression of FatB2 variants Figure S2 GC-FID traces of alkane standards and representative experiments (A) Overlay of GC traces of an AIRGAS one-point calibration standard mix, n-heptane, n-nonane, and

Ngày đăng: 18/10/2022, 17:04

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN

w