Phosphorus deprivation responses and phosphonate utilization in a thermophilic Synechococcus sp. from microbial mats

1Phosphorus deprivation responses and phosphonate utilization in a thermophilic 2Synechococcus sp from microbial mats 4Melissa M Adamsa, b, #, María R Gómez-Garcíaa, Arthur R Grossmana, Devaki Bhayaa 6a Carnegie Institution for Science, 7Department of Plant Biology, 8Stanford, CA 94305 10b Department of Biology, 11Stanford University 12Stanford, CA 94305 13 14Running title: Pho regulon of a thermophilic Synechococcus sp 15Keywords: phosphate starvation, Pho regulon, phn genes, methylphosphonate 16 17#Corresponding author Carnegie Institution for Science, 18 260 Panama Street 19 Stanford, CA 94305 20 Telephone: (650) 325-1521 21 Fax: (650) 325-6857 22 E-mail: mmadams1@stanford.edu 1 23ABSTRACT 24 The genomes of two closely related thermophilic cyanobacterial isolates, 25designated Synechococcus OS-A and Synechococcus OS-B′ , from the microbial mats of 26Octopus Spring (Yellowstone National Park) have been sequenced An extensive suite of 27genes that are controlled by phosphate levels constitute the putative Pho regulon in these 28cyanobacteria We examined physiological responses of an axenic Synechococcus OS-B′ , 29as well as transcript abundances of Pho regulon genes as the cells acclimated to 30phosphorus-limiting conditions Upon imposition of phosphorus deprivation, 31Synechococcus OS-B′ stopped dividing after 3-4 doublings and absorbance spectra 32measurements indicated that the cells had lost most of their phycobiliproteins and 33chlorophyll a Alkaline phosphatase activity peaked and remained high after 48 h of 34phosphorus starvation and there was an accumulation of transcripts from putative Pho 35regulon genes Interestingly, the genome of Synechococcus OS-B′ harbors a cluster of phn 36genes that are not present in Synechococcus OS-A The proteins encoded by the phn genes 37function in the transport and metabolism of phosphonates, which could serve as an 38alternative phosphorus source when exogenous phosphate is low The phn genes were up39regulated within a day of eliminating the source of phosphate from the medium However, 40the ability of Synechococcus OS-B′ to utilize methylphosphonate as a sole phosphorus 41source occurred only after an extensive period of exposure to the substrate Once 42acclimated, the cells grew rapidly in fresh medium with methylphosphonate as the only 43source of phosphorus The possible implications of these results are discussed with respect 44to the ecophysiology of the microbial mats 2 45INTRODUCTION 46 Significant advances have been made in characterizing the diversity and 47ecophysiology of microorganisms in the alkaline hot spring microbial mats of Yellowstone 48National Park (4, 53) However, relatively little is known about specific physiological 49adaptations and the acclimation responses of microbes in the mats with respect to nutrient 50limitation (1, 40, 42, 43) A unicellular cyanobacterium Synechococcus sp is the 51dominant, primary producer in these hot spring microbial mats at temperatures above 50 oC 52and is found exclusively in the top green layer (comprising 1-2 mm of the ~1.5 cm thick 53mat) (53) Based on DGGE analysis and the subsequent 16S rRNA/ITS sequence 54determination, it appears that Synechococcus ecotypes are delineated along environmental 55gradients, including temperature and light (9, 10) For instance, the Synechococcus OS-A 56(hereafter Syn OS-A) isolate is abundant in the high temperature region of the mat (585765ºC) while the Synechococcus OS-B′ (hereafter Syn OS-B′ ) isolate is abundant in the 58lower temperature regions (50-60ºC) OS indicates that the organisms were isolated from 59Octopus Spring (9) 60 We have complete genome sequences for Syn OS-A and OS-B′ , which have 61enabled examination of the genetic potential of these organisms to respond to fluctuating 62environmental conditions such as nutrient levels, light intensities, and oxygen tension (3, 6342, 43) Recently, we generated an axenic culture of Syn OS-B' and investigated 64acclimation responses to light intensities that they would experience in the microbial mat 65(19) It was found that Syn OS-B′ cultures grew best at relatively low light intensities (25 66to 200 µmol photon m-2 s-1), despite the high irradiance levels experienced by the cells in 67the natural environment (43) In fact, relatively high light elicited several acclimation 3 68responses including chlorosis or cell bleaching, which reflects a reduction in the levels of 69chlorophyll (chl) a and phycobiliprotein (PBP) 70 We are studying the ways in which axenic cultures of thermophilic cyanobacteria 71respond to a variety of defined environmentally relevant conditions in the laboratory We 72have initiated such studies by defining the potential gene members of the Pho regulon and 73characterizing accumulation of transcripts from these genes in response to P deprivation 74The levels of Pi in the effluent channel of OS have been determined to be as low as 0.37 75µM (33) although much higher levels (17 µM) have also been reported (4) As a 76reference, P starvation responses of E coli are elicited when the extracellular Pi 77concentrations drops below µM (49, 51) The dominant P-source within the hot spring 78microbial mat is inorganic phosphate (Pi), as determined by 31P-NMR analysis of the total 79P content (M Adams and B Cade-Menun, unpublished data); other P compounds detected 80include phosphonates and polyphosphate Based on the 31P-NMR analysis, phosphonates 81could constitute up to 5% of the total P content in the microbial mat and levels may 82fluctuate within the microbial mat over the diel cycle However, the P composition of the 83aqueous environment surrounding the microbial mat (extracellular) was not investigated 84 Pi metabolism has been studied extensively in E coli (46, 49) The levels of over 8580 identified proteins increase in response to P starvation and many of these proteins are 86encoded by genes that are co-regulated as part of the Pho regulon (47, 49) The multi-gene 87transcriptional induction associated with the Pho regulon is accomplished by a mechanism 88in which the transcriptional regulator PhoB binds to the Pho box sequence, which is an 89upstream activation sequence that precedes each operon of the Pho regulon (25, 49) Many 90of the transcriptional units that are part of the Pho regulon represent multigenic operons, 4 91such as the multigenic transport operon that encodes the four subunits (PstS, PstC, PstA, 92and PstB) of the Pst high affinity Pi-transport systems (25, 49) The PstSCAB transporter 93operon in bacteria often includes the gene encoding PhoU, which is thought to function as 94a negative regulator of the PhoR-PhoB two-component system (31) Genes of the Pho 95regulon also encode phosphatases (e.g PhoA), which liberate Pi from organic sources in 96the environment, and the enzymes required for utilization of other P-sources, including 97ugp-glycerol phosphate (41) The Pho regulon in Pseudomonas fluorescens Pf0-1 lacks a 98PhoA homolog, but encodes a phosphatase, PhoX, which is predominantly responsible for 99extracellular phosphatase activity during P limitation (29) Secretion of PhoX by the twin100arginine transport (TAT) pathway is a feature that distinguishes this family of 101phosphatases from the PhoA family (17) 102 The enzymes polyphosphate kinase (PPK1) and exopolyphosphatase (PPX) have 103been shown to be members of the Pho regulon of E coli K-12 (Genbank accession 104numbers NP_416996 and NP_416997 for PPK1 and PPX, respectively) (18) and are also 105present in the model cyanobacterium Synechocystis PCC6803 (accession numbers 106NP_442590 (sll0290) and NP_442969 (sll1546) for PPK1 and PPX, respectively) (11) 107PPK1 is a highly conserved enzyme in prokaryotes, found in over 100 bacterial genomes 108to date, and is responsible for the reversible polymerization of ATP to make polyphosphate 109(poly P) (5) PPX and other enzymes with PPX activity, such as the periplasmic acid 110phosphatase SurE (36) or the guanosine pentaphosphate phosphohydrolase (GPP) (18), 111degrade poly P in prokaryotes under conditions of P starvation 112 Currently, the only well studied cyanobacterial Pho regulon is that of 113Synechocystis PCC 6803, which features a sensor histidine kinase (SphS) and response 5 114regulator (SphR) that are orthologs of the PhoR and PhoB, respectively, of E coli (13) 115Three operons have been identified that are activated by SphR in Synechocystis PCC 1166803, including two ABC type high-affinity Pi uptake systems (pstS1-C1-A1-B1-B1 and 117pstS2-C2-A2-B2) and phoA-nucH, encoding an alkaline phosphatase and extracellular 118nuclease (45) Recently, in silico predictions of Pho box elements upstream of 119cyanobacterial genes have been performed for 19 different cyanobacteria that have fully 120sequenced genomes, including Syn OS-A and OS-B′ (44) 121 Polypeptides involved in the uptake and assimilation of P from molecules containing 122a phosphonate (Phn) bond are also part of the Pho regulon of E coli (20, 27, 54) The 123proteins required for Phn utilization include transport components (PhnCDE) and a 124specific multi-subunit C-P lyase (PhnFGHIJKLMNOP) that is required for hydrolysis of 125the C-P bond (27) The C-P bond of Phns is recalcitrant to chemical hydrolysis, thermal 126denaturation, and photolysis, making these compounds markedly different from other P127sources (32) Although Phns are found in organisms across phylogenetic groupings, only 128prokaryotic microorganisms have, so far, been shown to have the capability to cleave the 129Phn bond Phns are ubiquitous and have been identified in eukaryotes, bacteria and 130archaea as antibiotics and phosphonolipids, although the exact role of the latter within the 131lipid bilayer is still not clear (54) The most common naturally occurring Phn is 132aminoethylphosphonate (AEPhn), which is present in phosphonolipid head groups as well 133as in polysaccharide and glycoprotein side groups (54) In the marine environment, Phns 134can comprise as much as 25% of the high molecular weight dissolved organic P and serve 135as a P-source for some bacteria (7) 136 Many Phns found in terrestrial and aquatic environments are anthropogenic in 6 137origin, found as components of flame-retardants, plasticizers, pharmaceuticals, and 138herbicides Methylphosphonate is a component of several synthetic compounds, such as 139the flame extinguisher Pyrol 67, which is composed of vinylphosphonate and 140methylphosphonate Glyphosate (N-(phosphonomethyl) glycine) is the active ingredient in 141the widely used agricultural herbicide Roundup ® (26) There are potential repercussions 142of the widespread use of Phns as herbicides, since some are potentially toxic and have 143long retention times in the environment (20) 144 In this study, we examined the physiological consequences of P deprivation on 145axenic isolates of the thermophilic cyanobacterium Syn OS-B' We used a number of 146different methods including assays for alkaline phosphatase activity, quantification of 147transcripts of the Pho regulon, and monitoring of the cell doubling time to assess the 148ability of Syn OS-B' to grow on Phn as their sole source of P Under P deprivation 149conditions, the cells bleached and developed elevated levels of alkaline phosphatase 150(APase) activity Transcripts from the putative Pho regulon genes (including phoA, phoD, 151phoX, and pstS) accumulated in cells soon after they were transferred to medium devoid of 152P Furthermore, genes involved in the utilization of Phns were expressed in P-starved Syn 153OS- B' cells These results are discussed in the context of cyanobacterial ecophysiology in 154hot spring microbial mats 155 156MATERIALS AND METHODS 157Culture conditions: The original Synechococcus isolate from Octopus Spring was 158designated as JA-2-3B'a (2-13) (1) After generating an axenic culture of the strain, we 159designated the isolate as Synechococcus sp OS-B′ (CIW-10), which was grown and 7 160maintained at 55ºC in liquid D medium (6) supplemented with 10 mM HEPES (pH of 8.21618.3) and Va vitamins (2) This growth medium, termed DH10, contains Pi as sodium 162phosphate at a concentration of 0.77 mM For preparation of Pi-free medium, the sodium 163phosphate was replaced with an equimolar amount of sodium chloride Cultures were 164bubbled with a mixture of 3% CO2 in air, in a 55ºC incubator, and under continuous, 165relatively low light (~75 μmol photon m-2 s-1) The irradiance was measured with a Li-Cor 166LI-189 quantum meter using a Li-Cor LI-193SA spherical sensor 167Growth measurements: Growth rates and whole cell absorbance spectra for Syn OS- B′ 168were measured following growth in P-replete (+P) or P-free (-P) media Culture aliquots 169were collected at the same time every day; cell densities were estimated by counting cells 170using an Ultraplane Neubauer hemocytometer (Hausser Scientific, Pittsburgh, PA) and 171monitoring absorbance of the culture at 750 nm (OD 750) to generate a correlation between 172OD750 and cell number OD750 showed a linear correlation with cell number over the first 173200 h of growth in either +P or –P medium Despite the characteristic loss of 174photosynthetic pigments during growth of Syn OS-B' under P starvation conditions, the 175relationship between cell density and OD 750 remained relatively constant into stationary 176phase of the P-starved cells Syn OS-B' cultures were started at an OD 750 of 0.025 (~106 177cells/ml) and grown to late log phase (OD750 of 0.25-0.4 or ~107cells/ml) Cells were 178washed twice in DH10–P medium to remove traces of Pi and then resuspended in fresh 179medium (either +P or –P) to an OD 750 of 0.025 (~106 cells/ml) The growth of Syn OS-B′ 180was monitored into stationary phase and the experiment was terminated at 192 h All 181growth experiments were repeated at least three times 182Growth on Methylphosphonate (MePhn): The same methods were used to monitor 8 183growth of Syn OS-B' after they were transferred to +P or -P medium supplemented with 184MePhn, which was added to the medium by sterile filtration to a final concentration of 0.5 185mM This concentration of Phn was chosen because previous studies established that it 186supports optimal growth of E coli, Pseudomonas stutzeri, and Rhizobium meliloti (34, 18752) Other C-P compounds were also assessed as potential P sources, including 188ethylphosphonate (EthPhn), N-(phosphonomethyl) glycine, AEPhn, and phosphonomycin 189Of these, only EthPhn (like MePhn) could support the growth of Syn OS-B' as a sole 190source of P 191Cell viability: Cell viability was monitored with the LIVE/DEAD BacLight kit L-7012 192(Molecular Probes, Inc., Eugene, OR), as previously described (24) 193Alkaline phosphatase activity: APase activity was measured at 24 h intervals over the 194course of an experiment using a colorimetric assay modified from Ray et al (39) Briefly, 195extracellular APase activity was assayed over the course of 15 500 µl of harvested 196cells at each respective time point were added to an equal amount of the colorimetric 197reagent, p-nitrophenyl phosphate (pNPP) in Tris buffer, generating a reaction mix with 3.6 198mM pNPP with 200 mM Tris HCl, pH 7.0 to 9.0 Cells were removed by centrifugation 199and the absorption of the supernatant was measured at 410 nm APase activity was 200calculated as µg pNPP hydrolyzed/h per 1X106 cells 201Spectral data: For each time point in the growth analyses, whole-cell absorbance spectra 202from 350-800 nm were measured to determine relative chl a and PBP content (8) The 203spectra were normalized to OD750 of the culture, which allowed comparisons of spectral 204features across different cell densities, since OD 750 could be used as a proxy for cell 205number under all growth conditions 9 206RNA extraction: For analysis of transcript levels from putative Pho regulon genes over 207the time course of growth and under different P conditions (+P, -P, +P+MePhn, and 208-P+MePhn), cells were harvested at 24 h time intervals throughout logarithmic phase 209growth (24, 48, 72, and 96 h) For experiments in which Pi was added to cultures 210following 72 h of growth in +P or -P medium, the Pi was filter sterilized and added to a 211concentration of 0.77 mM (if the concentration in the culture after the initial growth period 212is not considered) RNA was extracted from cells as previously described (42) Isolated 213RNA was subjected to DNase digestion (Turbo DNase; Ambion, Austin, TX), precipitated 214with ethanol, and tested by PCR for residual DNA contamination Once the RNA was 215shown to be DNA free, it was either stored at -80°C or immediately used for reverse 216transcriptase (RT) qPCR (see below) 217Reverse transcription and RT qPCR: Superscript III RT from Invitrogen (Carlsbad, CA) 218was used to reverse transcribe µg of DNA-free RNA for each sample analyzed The 219reaction contained µg of RNA, 200 ng random primer hexamers, and buffer supplied by 220Invitrogen in a final reaction volume of 20 µl The RT reaction was performed in a PTC 221thermocycler (MJ Research Inc., St Paul, MN) The RNA was denatured at 65 oC for 222min, the reaction mixture assembled, and the reaction allowed to proceed for 44 at 22355oC before being terminated by a 70oC incubation for 15 (to inactivate the RT) The 224single-stranded cDNA product of the reaction was diluted 1:10 in nuclease-free water 225(final volume of 200 µl) and µl was used in a 20 µl qPCR reaction, as previously 226described (19) The specificity of the qPCR was evaluated by performing a temperature 227melt curve analysis; a single sharp peak on the melt curve indicates the synthesis of a 228single specific product The relative level of each specific transcript was quantified by 10 10 891Magasanik, W S Reznikoff, M Riley, M Schaechter and H E Umbarger (ed.), 892Escherichia coli and Salmonella: cellular and molecular biology ASM Press, Washington, 893D.C 89450 Wanner, B L 1994 Molecular genetics of carbon-phosphorous bond cleavage in 895bacteria Biodegradation 5:175-184 89651 Wanner, B L 1993 Gene regulation by phosphate in enteric bacteria J Cell 897Biochem 51:47-54 89852 Wanner, B L and W W Metcalf 1992 Molecular genetic studies of a 10.9-kb 899operon in Escherichia coli for phosphonate uptake and biodegradation FEMS Microbiol 900Lett 100:133-140 90153 Ward, D M., T Papke, U Nubel, and M C McKitrick 2002 Natural history of 902microorganisms inhabiting hot spring microbial mat communities: clues to the origin of 903microbial diversity and implications for microbiology and macrobiology, p 25-49 In R 904Mitchell (ed.), Biodiversity of Microbial Life Wiley-Liss, New York 90554 White, A K and M W Metcalf 2007 Microbial metabolism of reduced phosphorus 906compounds Annu Rev Microbiol 61:379-400 90755 White, A K and W W Metcalf 2004 Two C-P lyase operons in Pseudomonas 908stutzeri and their roles in oxidation of phosphonates, phosphite, and hypophosphite J 909Bacteriol 186:4730-4739 91056 Zalatan, J G., T D Fenn, A T Brunger, and D Herschlag 2006 Structural and 911functional comparisons of nucleotide pyrophosphatase/phosphodiesterase and alkaline 912phosphatase: implications for mechanism and evolution 45: 9788-9803 913 914 915 916 917 918 919 920FIGURE LEGENDS 921 922Figure 1: Genomic organization of phn genes and comparison of the regions flanking 38 38 923the phn gene clusters in Syn OS-B' and Syn OS-A (A) The top row of genes shows the 924main phn gene cluster of Syn OS-B' with the ABC phosphonate (Phn) transporter (phn C9251, phn D-1 and phn E-1) and the C-P lyase (phnG-phnM) genes The bottom row shows 926the second (phnD, phn D-2, phn D-3 phn C-2 and phn E-3) and third phn cluster (phnE-4, 927phnD-4, and phnC-3) See Table for accession numbers The Phn transporter genes 928include the ATPase component (phnC, red), the substrate-binding protein (phnD gene, 929yellow) and the membrane permease component (phnE, green) A putative Pho box is 930located upstream of phnC-1, phnD, and phnC Asterisks indicate genes that overlap with 931the next contiguous gene Inset: Logo representation of profile of top 10 ranked Pho boxes 932of Syn OS-B', as predicted by phylogenetic footprinting (40) The logo was generated by 933the Weblogo server [http://weblogo.berkeley.edu/logo.cgi] (B) Organization of flanking 934regions around the main phn gene cluster (gray arrows) in Syn OS-B' compared to the 935analogous region in Syn OS-A (C) Organization of flanking regions around the second 936phn cluster (phnD, phnD-2, phnD-3, phnC-2, phnE-2, and phnE-3) in Syn OS-B' 937compared to the analogous region in Syn OS-A (D) Organization of flanking regions 938around the third phn cluster (phnE-4, phnD-4, and phnC-3) in Syn OS-B' compared to the 939analogous region in Syn OS-A Gray arrows represent the phn genes, solid colored arrows 940(but not black) indicate syntenic sequences in Syn OS-A relative to Syn OS-B', while the 941broken arrows indicate genes where there is a break in synteny between the two genomes 942Black arrows in the Syn OS-B' genome represent genes not present in Syn OS-A The scale 943is indicated 944 945Figure 2: Growth response, APase activity, and absorbance spectra of Syn OS-B' 39 39 946under various P conditions: (A) Late logarithmic phase cells grown in +P medium were 947transferred to four different conditions (i) +P (ii) -P (iii) +P medium with 0.5 mM MePhn 948(+P+MePhn) and (iv) -P medium with 0.5 mM MePhn (-P+MePhn) Growth of all 949cultures was monitored for ~192 h Note the log scale on the Y-axis for cells per ml (B) 950APase activity and growth measurements were quantified in cell cultures once every 24 h 951The APase activity was measured as μg p-nitrophenyl phosphate (pNPP) hydrolyzed per h 952per 1X 106 cells (C) Whole cell absorption spectra of each culture between the 953wavelengths of 400 and 800 nm, normalized to absorption at OD 750, at 96 h following cell 954transfer Results for growth and APase activity show the mean and S.D (error bars) from 955measurements taken from biological triplicates 956 957Figure 3: Quantification of relative Pho regulon transcript accumulation following Pi 958starvation Specific Pho regulon transcripts, including those of the phn gene cluster, were 959measured over 24 h intervals under various P conditions The top panel represents 960transcripts for genes encoding phosphatases, the middle panel is transcripts for genes 961associated with transport systems, and the bottom panel is transcripts for genes involved in 962Phn transport and metabolism For each gene, relative transcript levels, presented as a 963ratio of –P to +P conditions, were determined at 24 (light gray columns), 48 (gray 964columns), and 72 h (black columns) following the transfer of cells to the new growth 965medium In the presence of MePhn,, relative transcript levels representing -P+MePhn 966compared to +P+MePhn are shown at 24 h (dashed dark gray columns), 48 h (dashed light 967gray columns), and 72 h (dashed white columns) The qPCR results show the mean and 968S.D (error bars) for data from three technical replicates 40 40 969 970Figure 4: Quantification of Pho regulon transcript accumulation after Pi addition to 971P-starved cultures Pi was added back to the growth medium after 72 h of starvation and 972transcript levels were measured (as described in Figure 4) at 96 h (i.e 24 h after the ‘add 973back’ of Pi) Relative transcript levels comparing –P to +P after Pi addition (white 974columns at 96 h) and the control, i.e –P compared to +P prior to Pi addition but no Pi 975added back (black columns at 72 h and gray columns at 96 h), are shown The qPCR 976results show the mean and S.D (error bars) for data from three technical replicates 977 978Figure 5: Growth of cultures in MePhn Growth responses of MePhn-acclimated 979(triangles) and non-acclimated (squares) Syn OS-B' cells to +P, -P, and –P+MePhn 980conditions The graph shows the mean and S.D (error bars) from measurements taken 981from biological triplicates Starting cultures were initially grown to logarithmic phase in 982either +P or -P+MePhn medium for 20 days (Note: log scale used for cells per ml.) 983 984 985 986 41 41 987Table 1: Primers used to quantify putative Pho regulon transcripts of Syn OS-B′ 988Included in the table are locus tags, size of the gene in nucleotides (NA) and amino acids 989(AA) and both the forward and reverse primer sequences that were used Gene Locus tag Size (NA) Size (AA) Forward primer Reverse primer phoA CYB_1198 1349 449 TGGTGCAAACGGGATCCATCATTG AATCTCCTCATAGTCGCTGCGCTT phoD CYB_0684 1727 575 GCCGCGGCGATATCGATTTCATTT CAACAAAGGAAGTCCGGCCAAACA phoX CYB_1988 2048 682 ACGATGCCCGCTTTGAGTACATCT CTTGGCCACATACAAGGTGCCATT pstS-1 CYB_1077 1076 358 CACAGGTGACTTTCCCGAAT ATTCCACGTAGCCAATCGAG pstS-2 CYB_1915 1061 353 ATGCGAACCCTGCTTTCTGCTTTC GAGATTTGCACGGTTTGGGCTTGA phnC-1 CYB_0159 791 263 AAACAAGGTTGCCCTAAGGGAGGT TGGCCTTCATGGAGAGGAAGAGAA phnD-1 CYB_0160 896 298 GCTCCCATTGAAGCGTTCGTGAAA TTGCCCTTGGCGTCTTCTAGAGTT phnC-2 CYB_1467 809 269 TGGCTCAATGGAATCGACCTCACT TAGCCCAACTGACCCGAAAGAACA phnI CYB_0164 696 231 TGCTGGATTTGGAAATGGATCGCC AGTGGCTCATCCAGTTGCTGAGAA phnJ CYB_0165 866 288 GTAGCATATGAAACCCAAGCATAG AACTCGAGAGGACCGCTCGTTT 991 992 993 994 995 996 997 998 999 1000 42 42 1001Table 2: Putative Pho regulon genes of the Syn OS-B' genome Gene names, locus tags, 1002predicted products, and % AAID to the closest bacterial homolog in all available 1003sequenced organisms (excluding Syn OS-A) are given Genes associated with putative 1004operons are grouped in the list Genes shown in bold are preceded by a high-ranking 1005predicted Pho box (44) Gene (s) name Locus tag Putative encoded protein Closest homolog AAID % phoR CYB_0858 Sensor histidine kinase Nostoc PCC 7120 41 phoB CYB_2856 Response regulator Gloeobacter violaceus PCC 7421 75 phoA CYB_1198 Alkaline phosphatase Chlorobium chlorochromatii CaD3 45 phoX CYB_1988 Alkaline phosphatase Hahella chejuensis KCTC 2396 54 phoD CYB_0684 Phosphodiesterase Bacillus subtilis 28 surE-1 CYB_0884 Acid phosphatase Thermosynechococcus elongatus BP-1 60 surE-2 CYB_1427 Acid phosphatase Lyngbya PCC 8106 51 phoH CYB_2320 PhoH family protein Thermosynechococcus elongatus BP-1 61 npp CYB_0274 5'-nucleotidase phosphatase Cyanothece PCC 7424 53 nucH CYB_2765 Putative secreted nuclease Roseiflexus castenholzii DSM 13941 46 ppx CYB_1493 Exopolyphosphatase Anabaena variabilis ATCC 29413 58 ppk CYB_2082 Polyphosphate kinase Cyanothece PCC 8801 62 pstS-1, pstC-1, pstA-1, pstB-1 CYB_1077-74 High affnity ABC-type Pi transporter Cyanothece CCY 0110* 50, 51, 53, 70 pstS-2, pstC-2, pstA-2, pstB-2 CYB_1915-12 High affnity ABC-type Pi transporter Cyanothece ATCC 51142* 45, 50, 70, 70 phoU CYB_2526 Regulatory protein Nostoc PCC 7120 61 phnC-1, phnD-1, phnE-1 CYB_0159-61 Phn ABC-transporter proteins Cyanothece PCC 8801* 44, 31, 45 phnG-phnM CYB_0162-68 C-P lyase Roseiflexus RS-1* 48, 32, 38, 59, 45, 41, 39 phnD**, phnD-2, phnD-3 phnC-2, phnE-2, phnE-3 CYB_1464-69 Phn ABC-transporter proteins Dinoroseobacter shibae DFL 12* 69, 51, 53, 72, 54, 56 phnE-4, phnD-4, phnC-3 CYB_0012-11, 09 Phn ABC-transporter proteins Cyanothece PCC 7424* 36, 27, 69 ugpB, ugpA CYB_2477-78 Glycerol-3-phosphate transporter Deinococcus geothermalis DMS 11300* 39, 46 *For gene clusters, we show AAID % to the respective homologs from a single organism **PhnD had the highest AAID to theSinorhizobium meliloti 1021 homologue 1007 1008 1009 1010 43 43 1011Table 3: Effect of MePhn on transcript accumulation Comparison of relative transcript 1012levels from cells grown in -P conditions relative to –P+MePhn conditions after 72 h of 1013starvation Transcripts were quantified for all investigated genes of the Syn OS-B′ Pho 1014regulon as in Figures and Gene Relative Transcript Levels (72 h) phoX phnJ pstS-2 phnC-1 phoA pstS-1 phnC-2 phnD-1 phoD 18 14 11 8 5 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 44 44 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 45 Figure 45 1038 1039 1040 1041 1042 1043 1044 1045 46 Figure 46 1046 1047 1048 1049 1050 1051 1052 47 Figure 47 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 48 Figure 48 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 49 Figure 49 1080Supplementary Material 1081Table S1: Comparison of the Pho regulon genes The homologs of Pho regulon genes in 1082Syn OS-B' and Syn OS-A are compared to each other at the nucleotide (NAID) and amino 1083acid (AAID) levels Gene (s) name Syn OS-B′ locus tag Syn OS-A locus tag phoR CYB_0858 CYA_2352 phoB CYB_2856 CYA_1033 phoA CYB_1198 CYA_0781 phoX CYB_1988 CYA_1696 phoD CYB_0684 CYA_2506 surE-1 CYB_0884 CYA_0967 surE-2 CYB_1427 CYA_0017 phoH CYB_2320 CYA_1201 npp CYB_0274 CYA_1059 nucH CYB_2765 CYA_0117 ppx CYB_1493 CYA_2432 ppk CYB_2082 CYA_2477 pstS-1, pstC-1, pstA-1, pstB-1 CYB_1077-74 CYA_1558-55 pstS-2, pstC-2, pstA-2, pstB-2 CYB_1915-12 CYA_1735-32 phoU CYB_2526 CYA_0182 phnC-1, phnD-1, phnE-1 CYB_0159-61 None phnG-phnM CYB_0162-68 None phnD, phnD-2, phnD-3 CYB_1464-69 None phnC-2, phnE-2, phnE-3 phnE-4, phnD-4, phnC-3 CYB_0011-12, 09 None ugpB upgA CYB_2477-78 CYA_2785-86 NAID AAID 84% 89% 92% 91% 89% 88% 85% 89% 88% 83% 90% 89% 81-84% 96-98% 94% 87% 92% 94% 93% 95% 95% 92% 93% 91% 88% 91% 94% 86-89% 97-99% 95% 87-91% 94-95% 1085 1086 1087 1088 1089 50 50 1090 1091 1092Table S2: Amino-acid level identity of Phn transporter components from the Syn OS-B' 1093genome phnC-1 CYB_0159 phnC-2 CYB_1467 33% phnC-3 CYB_009 21% phnC-2 CYB_1467 phnD CYB_1464 phnD-1 CYB_0160 phnD-2 CYB_1465 phnD-3 CYB_1466 phnE-1 CYB_0161 phnE-2 CYB_1468 21% phnD-1 CYB_0161