Phân lập vi khuẩn khử sulphate (SRB) để ứng dụng trong xử lý nước thải axit từ hoạt động khai thác khoáng sản

Phân lập vi khuẩn khử sulphate (SRB) để ứng dụng xử lý nước thải axit từ hoạt động khai thác khoáng sản Nguyễn Thị Hải Trường Đại học Khoa học Tự nhiên Luận văn ThS chuyên ngành: Vi sinh vật học; Mã số: 60 42 40 Người hướng dẫn: TS Đinh Thúy Hằng Năm bảo vệ: 2012 Abstract: Nghiên cứu Acid Mine Drainage (AMD) vấn đề môi trường liên quan Xử lý AMD phương pháp hóa học, sinh học Đặc tính sinh học Sulfate reducing bacteria (SRB) Phân bố SRB tự nhiên Đa dạng di truyền SRB Đặc điểm sinh lý SRB Nhu cầu dinh dưỡng SRB Các yếu tố ảnh hưởng tới sinh trưởng SRB Cạnh tranh SRB với nhóm vi khuẩn khác mơi trường Nghiên cứu đặc điểm sinh học chủng SRB phân lập Thử nghiệm xử lý AMD mơ hình phịng thí nghiệm Keywords: Sinh vật học; Nước thải axit; Vi khuẩn; Xử lý nước thải; Phân lập vi khuẩn Content Chƣơng - TỔNG QUAN TÀI LIỆU 1.1 AMD (Acid Mine Drainage) vấn đề môi trƣờng liên quan 1.1.1 Sự hình thành AMD AMD (Acid Mine Drainage) hình thành khống sulfide (như pyrite, FeS 2) quặng tiếp xúc với oxy nước (Brown cs, 2002) Hình 1.1 AMD từ khu khai thác quặng kim loại Việt Nam Quá trình oxy hóa khống sulfide: FeS2 + 7/2O2 +H2O → Fe2+ + 2SO 42- + 2H+ Như AMD có hai điểm đặc trưng pH thấp hàm lượng ion kim loại nặng cao 1.1.2 Ảnh hƣởng AMD tới mơi trƣờng 1.1.2.1 Ơ nhiễm nguồn nƣớc AMD AMD có ảnh hưởng lâu dài nguồn nước sông, suối, sống sinh vật (động, thực vật người) liên quan đến nguồn nước Nước bị nhiễm AMD có pH thấp từ đến 4,5, gây độc với hầu hết dạng sinh vật sống nước (Hill, 1974) Ngồi cá, sinh vật khác trùng, tảo giảm rõ rệt số lượng loài số lượng cá thể pH môi trường giảm AMD (Warner, 1971) 1.1.2.2 Ô nhiễm đất AMD Hoạt động khai thác mỏ khai thác đá gây phá hủy nhiều vùng đất qua hàng trăm năm, nhiều vùng khơng có khả phục hồi (Duffield cs, 2000) 1.1.2.3 Tình trạng nhiễm AMD Việt Nam Theo báo cáo Đánh giá môi trường chiến lược Quy hoạch phát triển ngành than đến năm 2020, có xét đến năm 2030, mối nguy hại ô nhiễm nước thải từ mỏ than thuộc Tập đồn Cơng nghiệp than Khống sản đặt mức báo động Dựa số liệu kê khai nộp phí bảo vệ mơi trường nước thải công nghiệp đơn vị thuộc ngành than, tổng lượng nước thải từ mỏ năm 2009 38.914.075 m Tuy nhiên số chưa thể phản ánh đầy đủ thực trạng chưa thể tính lượng nước rửa trơi từ bãi thải mỏ 2011) 1.2 Xử lý AMD 1.2.1 Xử lý AMD phƣơng pháp hóa học Các chất hóa học thường sử dụng để xử lý AMD gồm CaCO 3, Ca(OH) 2, Na2CO3 , NaOH NH3 Tuy phương pháp hóa học sử dụng từ lâu có hiệu nhanh chóng tốn khơng an tồn, thường gây vấn đề ô nhiễm thứ cấp (Skousen cs, 1996) 1.2.2 Xử lý AMD phƣơng pháp sinh học 1.2.2.1 Cơ sở khoa học công nghệ Vi khuẩn khử sulfate (SRB) vi khuẩn sinh trưởng kỵ khí, sử dụng sulfate làm chất nhận điện tử cuối để oxy hóa hydro hay hợp chất hữu tận thu lượng cho mục đích sinh trưởng (phản ứng 1.10) 2CH2O + SO42 + H +  H2 S + 2HCO 3 H2S + Me2+  MeS + 2H+ (1.10) (1.11) 1.2.2.3 Các yếu tố ảnh hƣởng tới trình xử lý AMD SRB Là quy trình cơng nghệ dựa hoạt động vi sinh vật, trình xử lý AMD bị chi phối yếu tố ảnh hưởng đến tính chất sinh lý, sinh hóa SRB, cụ thể là:  Nguồn SRB  Cơ chất  pH  Thành phần hóa học AMD  Nhiệt độ 1.3 Đặc tính sinh học SRB SRB vi khuẩn hơ hấp kỵ khí, sử dụng sulfate làm chất nhận điện tử cuối để oxy hóa hợp chất hữu đơn giản hydro SRB phổ biến mơi trường kỵ khí, nơi chúng có vai trị quan trọng chu trình lưu huỳnh chu trình cacbon (hình 1.2) Hình 1.2 Vị trí SRB chu trình cacbon lưu huỳnh (Muyzer, Stams, 2008) 1.3.3 Đặc điểm sinh lý SRB 1.3.3.1 Nhu cầu dinh dƣỡng SRB Hầu hết SRB có nhu cầu dinh dưỡng đơn giản sinh trưởng tốt môi trường có nguồn cacbon/năng lượng ổn định (Postgate, 1984) Nguồn cacbon điện tử thích hợp SRB bao gồm axit hữu mạch ngắn acetate, lactate, pyruvate rượu (Hao cs, 1996 Phụ thuộc vào cách oxy hóa chất hữu mà SRB phân chia thành hai nhóm trao đổi chất sau (Widdel, 1988):  Nhóm oxy hóa khơng hồn tồn: oxy hóa hợp chất hữu đến acetate Thuộc nhóm chủ yếu loài thuộc chi Desulfovibrio spp  Nhóm oxy hóa hồn tồn: Oxy hóa hợp chất hữu (bao gồm acetate) hoàn toàn thành CO2 Trong nhóm có đa dạng lồi SRB khác nhau, Desulfobacter spp., Desulfobacterium spp., Desulfosarcina spp SRB thực trao đổi chất oxy hóa chất hữu sử dụng sulfate làm chất nhận điện tử cuối (Postgate, 1984) Sự khử sulfate thành sulfide tiêu thụ điện tử q trình sinh hóa thông qua nhiều bước trung gian với tham gia nhiều enzyme (hình 1.4) (Fauque cs, 199; Kremer, Hansen, 1988) Hình 1.4 Các bước khử sulfate SRB enzyme tham gia Phản ứng tóm tắt sau (Peck Lissolo, 1988): SO42 → SO32 → HSO 3 → HS → S2 (1.12) 1.3.3.2 Các yếu tố ảnh hƣởng tới sinh trƣởng SRB Nhiệt độ, pH, độ muối Nồng độ sulfide Chƣơng – NGUYÊN VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1 Nguyên vật liệu Các mẫu nƣớc thải  Mẫu nước thải để làm giàu SRB thu thập từ số hệ thống xử lý nước thải điều kiện kỵ khí Quảng Ngãi, Bình Dương, Bắc Ninh  Mẫu nước thải AMD để thử nghiệm xử lý mơ hình phịng thí nghiệm thu thập từ mỏ than Tràng Khê, Quảng Ninh 2.2 Phƣơng pháp nghiên cứu 2.2.1 Làm giàu phân lập SRB Làm giàu SRB SRB mẫu nước thải thu thập làm giàu cách cấy vào bình serum chứa mơi trường dịch thể kỵ khí nước cho vi khuẩn khử sulfate (bảng 2.1) với tỷ lệ 10%, nuôi tủ ấm 30oC Các lần cấy truyền tiến hành sau – ngày nuôi cấy theo tỷ lệ 10% thể tích Qua lần cấy truyền, số lượng SRB mẫu tăng lên Phân lập SRB Mẫu làm giàu lần dùng để phân lập SRB Việc phân lập tiến hành theo phương pháp pha loãng dãy ống thạch bán lỏng (1%) với mơi trường có thành phần tương tự mơi trường dùng làm giàu (Widdel, Bak, 1992) Ống thạch bán lỏng sau bổ sung nguồn vi sinh vật (10%) từ mẫu làm giàu sục khí N2 ủ tư đảo ngược 30oC bóng tối Khuẩn lạc đơn phát triển ống pha lỗng tách pipet Pasteur chuyển sang mơi trường dịch thể 2.2.2 Xác định điều kiện sinh trƣởng tối ƣu Nhiệt độ pH Độ muối Chất cho điện tử Chất nhận điện tử 2.2.3 Tách DNA tổng số từ mẫu môi trƣờng chủng khiết DNA tổng số mẫu làm giàu mẫu thí nghiệm xử lý AMD mơ hình tách chiết theo phương pháp Zhou cộng (1996) 2.2.4 Phƣơng pháp điện di biến tính DGGE Hình 2.1 Vị trí đoạn gen 16S rDNA sử dụng phân tích DGGE Lactobacillus plantarum (Lopez cs, 2003) 2.2.5 Giải trình tự gen 16S rDNA dựng phân loại Gen 16S rDNA (1500 bp) chủng SRB khiết khuếch đại phản ứng PCR sử dụng cặp mồi 27F (AGAGTTTGATCCTGGCTCAG) 1492R (GGTTACCTTGTTACGACT T) ( Weisburg cs, 1991) 2.2.6 Phân tích hóa học 2.2.6.1 Định lƣợng Fe(II) thuốc thử phenanthrolin (DIN 38406 E1-1, 1983) Nguyên lý: O-phenanthrolin phản ứng với Fe(II) tạo phức có màu tím đỏ khoảng pH  9, đo bước sóng 510 nm Nồng độ Fe(II) cho phép đo 0,01  mg/l Kết phép đo bị ảnh hưởng ion Mn Cu 2.2.6.2 Định lƣợng sulfate (Dinh cs, 2004) Nguyên lý: SO42- kết hợp với Ba2+ tạo kết tủa BaSO4 theo phương trình: Ba2+ + SO42- → BaSO4 kết tủa trắng Hàm lượng sulfate xác định thông qua hàm lượng chất kết tủa BaSO4 tạo thành 2.2.6.3 Xác định nồng độ sulfide (Cord-Ruwisch, 1985) Nguyên lý: Ion S2 phản ứng với ion Cu2+ tạo CuS có màu nâu đen dạng huyền phù, đo nhanh bước sóng 480 nm 2.2.7 Thiết kế mơ hình xử lý AMD Nguồn AMD: Nguồn AMD thu thập từ mỏ than Tràng Khê Quảng Ninh có đặc điểm lý hóa sau: pH = Nồng độ sắt = 200 mg/l (tương đương 3,57 mM) Nồng độ sulfate = 1320 mg/l (tương đương 13,75 mM) Giá thể: Phoi bào lót lớp đáy bể xử lý Nguồn vi sinh vật: Dịch làm giàu SRB sau lần cấy truyền thứ (E1-4) Chu trình xử lý: Hình 2.2 Mơ hình xử lý AMD phịng thí nghiệm 1) Bể điều hịa chứa AMD đầu vào; 2) Bể xử lý AMD SRB; 3) Bể lắng chứa nước thải đầu Mơ hình xử lý AMD hoạt động với nguồn chất cho SRB sinh trưởng bổ sung từ bên methanol nước thải có hàm lượng hữu cao Chƣơng - KẾT QUẢ VÀ THẢO LUẬN 3.1 Làm giàu phân lập vi khuẩn khử sulfate (SRB) từ mẫu nƣớc thải Nồng độ sulfide (mM) 12 10 E1-4 E2-4 E3-4 Hình 3.1 Hàm lượng sulfide mẫu làm giàu lần cấy truyền thứ Trên sở đó, E1-4 sử dụng để tiến hành phân lập chủng SRB khiết (a) (b) Hình 3.2 Làm giàu phân lập vi khuẩn khử sulfate từ mẫu nước thải (a) – Mẫu làm giàu vi khuẩn SRB E1-4; (b) – Khuẩn lạc SRB hình thành ống thạch bán lỏng Ba chủng SRB phân lập từ ống pha loãng 108 dựa hình thái khác khuẩn lạc (bảng 3.1) Bảng 3.1 SRB phân lập đƣợc từ dịch làm giàu với mẫu nƣớc thải E1-4 Tên chủng SR2 SR3 SR4 SR2 Đặc điểm hình Hình dạng tế bào thái khuẩn lạc Hình múi khế Hình que, có độ dài khác tùy cạnh, màu đen thuộc thời gian điều kiện ni cấy, kích thước tế bào nhỏ 1×3,5 μm (hình 3.3) Hình múi khế Hình ovan đơn xếp chuỗi, kích cạnh, màu đen thước 1×1,5-2 μm (hình 3.3) Hình đĩa lồi Hình phẩy khuẩn, kích thước 1×2-3 mặt, màu đen μm (hình 3.3) SR3 Đặc điểm chuyển động tế bào Không chuyển động Chuyển động chậm Chuyển nhanh động SR4 Hình 3.3 Hình thái tế bào ba chủng SRB khiết phân lập từ mẫu dịch làm giàu với nước thải 3.2 Vị trí phân loại ba chủng SRB dựa trình tự gen 16S rDNA Hình 3.6 Cây phân loại neibourgh joining dựa trình tự gen 16S rDNA gần đủ chủng SRB phân lập so sánh với lồi SRB có quan hệ gần gũi Escherichia coli (Proteobacteria) chọn làm outgroup 3.3 Nghiên cứu đặc điểm sinh học chủng SRB phân lập 3.3.1 Ảnh hƣởng nồng độ muối môi trƣờng 0.2 0.1 0 10 15 20 25 0.3 0.2 0.1 0 Nồng độ muối (g/l) 10 15 20 25 0.3 0.2 0.1 0 10 15 20 25 Nồng độ muối (g/l) Nồng độ muối (g/l) Nồng độ sulfide 0.4 OD600 OD600 0.4 Nồng độ sulfide(mM) 0.3 Nồng độ sulfide(mM) OD600 0.4 OD600 Nồng độ sulfide(mM) SR4 SR3 SR2 Hình 3.7 Ảnh hưởng nồng độ muối môi trường tới mức tăng sinh hoạt tính khử sulfate chủng SRB phân lập 3.3.2 Ảnh hƣởng pH môi trƣờng SR2 SR3 0.2 0.1 0.2 0.1 0 4 0.2 0.1 0 0.3 OD600 0.3 OD600 Nồng độ sulfide (mM) Nồng độ sulfide (mM) 0.3 OD600 Nồng độ sulfide (mM) SR4 Nồng độ sulfide pH pH pH OD600 Hình 3.8 Ảnh hưởng pH tới mức tăng sinh hoạt tính khử sulfate chủng SRB phân lập Nhằm mục đích lựa chọn nguồn SRB phù hợp cho xử lý AMD, tiến hành nghiên cứu ảnh hưởng pH tới hỗn hợp ba chủng SRB phân lập so với mẫu dịch làm giàu gốc ba chủng (hình 3.9) E1-4 Hỗn hợp chủng SR2, SR3, SR4 0.4 0.3 0.2 0.1 0.3 0.2 0.1 1 0 0 pH pH Nồng độ sulfide OD600 Hình 3.9 Ảnh hưởng pH hỗn hợp chủng SRB mẫu làm giàu gốc (E1-4) 3.3.3 Ảnh hƣởng nhiệt độ nuôi cấy OD600 Nồng độ sulfide (mM) 0.4 OD600 Nồng độ sulfide (mM) 0.2 0.1 0 20 25 30 37 0.4 0.3 0.2 0.1 0 15 20 25 30 Nồng độ sulfide 0.4 0.3 0.2 0.1 0 15 37 20 25 30 37 Nhiệt độ (oC) Nhiệt độ (oC) Nhiệt độ (oC) Nồng độ sulfide (mM) 0.3 Nồng độ sulfide (mM) OD600 0.4 OD600 Nồng độ sulfide (mM) 15 SR4 SR3 OD600 SR2 OD 600 Hình 3.10 Ảnh hưởng nhiệt độ tới mức tăng sinh hoạt tính khử sulfate thành sulfide chủng SRB phân lập 3.3.4 Chất cho điện tử chất nhận điện tử Bảng 3.2 Sinh trƣởng SRB với chất cho nhận điện tử khác Đặc điểm SR2 SR3 Chất cho điện tử Lacte +++ +++ (để khử sulfate) Acetate + + Methanol + + Chất nhận điện tử (để Sulfate +++ +++ oxy hóa lactate) Nitrate +++  Fe (III)   Chú thích: +++ sinh trưởng tốt; ++ sinh trưởng trung bình; + sinh trưởng kém;  trưởng SR4 +++  ++ +++ +++ ++ không sinh 3.4 Thử nghiệm xử lý AMD mơ hình phịng thí nghiệm Bảng 3.3 Tóm tắt thí nghiệm xử lý AMD mơ hình phịng thí nghiệm Tên mơ Thành phần AMD hình pH = MH [Fe] = 200 mg/l (3,57 mM) MH2 [SO42-] = 1320 mg/l (13,75 mM) Nguồn chất bổ sung Methanol (10 mM) COD = 320 mg O2 /l N tổng = 26,4 mg/l Nguồn Ghi SRB Dịch làm Nồng độ giàu E1-4 chất MH2 nồng độ thực bể xử lý AMD Dưới hình ảnh mơ hình xử lý phịng thí nghiệm với chế độ xử lý theo mẻ, quy mô – lít (hình 3.11) Hình 3.11 Mơ hình xử lý AMD phịng thí nghiệm 3.4.1 Xử lý AMD điều kiện bổ sung methanol (10mM) làm chất Mơ hình 10 12 pH Nồng độ sulfate (mM) 16 4 0 Thời gian (ngày) Nồng độ sulfate pH Hình 3.12 Mơ hình xử lý AMD với chất bổ sung methanol (10 mM) 3.4.2 Xử lý AMD điều kiện bổ sung nƣớc thải giàu hữu làm chất Mơ hình 10 12 4 0 Thời gian (ngày) Nồng độ sulfate pH pH Nồng độ sulfate (mM) 16 Hình 3.13 Mơ hình xử lý AMD với chất nước thải có hàm lưỡng chất hữu cao Như nước thải có hàm lượng hữu cao có khả sử dụng làm chất tốt cho vi khuẩn khử sulfate bể phản ứng xử lý AMD Việc kết hợp nước thải hữu để xử lý AMD có ý nghĩa quan trọng việc giảm giá thành công nghệ, đồng thời góp phần bảo vệ mơi trường loại nước thải hữu nước thải từ chăn nuôi, chế biến thực phẩm, nước thải sinh hoạt 3.4.3 Phân tích thành phần quần xã vi sinh vật mơ hình xử lý AMD phịng thí nghiệm E1.4 MH1 MH2 SR2 SR3 SR4 SR3  SR2  SR4 * * SR2: Desulfomicrobium sp SR3: Desulfobulbus sp SR4: Desulfovibrio sp **   Hình 3.14 Điện di biến tính (DGGE) gen 16S rDNA phân tích thành phần quần xã vi khuẩn mơ hình xử lý AMD KẾT LUẬN Đã thiết lập hỗn hợp SRB (mẫu E1-4) có hoạt tính tốt điều kiện pH thấp qua phương pháp làm giàu Phân lập chủng vi khuẩn khử sulfate SR2, SR3 SR4 từ mẫu làm giàu nói Dựa trình tự gần đủ gen 16S rDNA chủng định danh tương ứng Desulfomicrobium sp SR2, Desulfobulbus sp SR3, Desulfovibrio sp SR4 Phân tích DGGE gen 16S rDNA cho thấy chủng phân lập đại diện cho nhóm SRB mẫu làm giàu E1-4 Nghiên cứu đặc điểm sinh lý chủng thấy rằng:  Cả chủng có khả sinh trưởng tốt mơi trường có hàm lượng muối 10 – 15 g/l, tương ứng với môi trường nước lợ Đặc biệt chủng SR4 sinh trưởng tốt nồng độ muối 25 g/L, tương đương môi trường nước biển  Cả ba chủng bị ức chế pH môi trường  6, nhiên mẫu làm giàu gốc E1-4 thể khả chịu pH thấp tốt chủng khiết sinh trưởng tốt pH 5 Mơ hình thử nghiệm xử lý AMD với chất bổ sung nước thải có hàm lượng hữu cao đạt hiệu cao sử dụng chất đơn methanol Kết thu sau ngày xử lý gồm: pH tăng từ lên 8,15, nồng độ sulfate giảm từ 13,75 mM 4,5 mM, hàm lượng sắt giảm từ 200 mg/l 36 mg/l thể khả ứng dụng thực tế công nghệ References Tiếng việt Công ty cổ phần tin học, công nghệ, mơi trường, TCT Than & Khống sản Việt (2012), Kết phân tích nước thải mỏ than Nam Hồ Sỹ Giao, Mai Thế Toản (2010), “Những điểm nóng mơi trường hoạt động khai thác mỏ Việt Nam”, Hội nghị khoa học kĩ thuật mỏ quốc tế 2010 Bùi Công Quang (2011), “Tác động hoạt động khai thác mỏ đến nguồn nước hệ sinh thái”, Chuyên đề bảo vệ môi trường khai thác khoáng sản, ĐH Thủy Lợi Nguyễn Danh Sơn (2011), “Môi trường phát triển bền vững quản lý khai thác tài nguyên khoáng sản Việt Nam”, Chuyên đề bảo vệ mơi trường khai thác khống sản, Viện Khoa học xã hội Việt Nam Tiếng Anh Bahr M, Crump BC, Ceraj VK, Teske A, Sogin ML, Hobbie JE (2005), “Molecular chacterization of sulfate-reducing bacteria in a New England salt marsh”, Environ Microbiol., 7, pp.1175–1185 Ben-Dov E, Brenner A, Kushmaro (2007), “Quantification of sulfate-reducing bacteria in industrial wastewater by real-time polymerase chain reaction (PCR) using dsrA and apsA genes”, Microbiol Ecol.,54, pp 439–451 Brenner FJ (2001), “Use of constructed wetlands for acid mine drainage abatement and stream restoration”, Water Sci Technol., 44, pp 449-454 Benner SG, Blowes DW, Ptacek CJ (1997), “A full-scale porous reactive wall for prevention of acid mine drainage”, Ground Water Monit Remed., 17, pp 99-107 Bharathi PAL, Sathe V, Chandramohan D (1990), “Effect of lead, mercury and cadmium on a Sulphate-reducing bacterium”, Environ Pollut., 67, pp 361–374 10 Boetius A , Ravenschlag K, Schubert KJ, Rickert D, Widdel F, Gieseke A, Amann R, Jùrgensen BB, Witte U, Pfannkuche O (2000), “A marine microbial consortium apparently mediating anaerobic oxidation of methane”, Nature, 407, pp 623–626 11 Boschker HTS, Nold SC, Wellsbury P, Bos D, de Graaf W, Pel R, Parkes RJ, Cappenberg (1998), “Direct linking of microbial populations to specific biogeochemical processes by 13C-labelling of biomarkers”, Nature, 392, pp 801–804 12 Boularbah A, Schwartz C, Bitton G, Morel JL (2006), “Heavy metal contamination from mining sites in South Morocco: Use of a biotest to assess metal toxicity of tailings and soils”, Chemosphere, 63, pp 802-810 13 Brookens AM, Schmidt WT, Branch WL (2000), The effectiveness of utilizing passive treatment systems for leachate discharges in Western Maryland, Presented at the American Society for Surface Mining and Reclamation 17th Annual Meeting, Tampa, Florida, June 11-15, 2000 14 Brown M, Barley B, Wood H (2002), Minewater treatment: technology, application and policy, IWA Publishing, London 15 Brysch K, Schneider C, Fuchs G, Widdel F (1987), “Lithoautotrophic growth of sulphatereducing bacteria, and description of Desulfobacterium autotrophicum gen nov., sp nov.”, Arch Microbiol.,148, pp 264–274 16 Cabrera G, Pérez RJM, Gómez, Ábalos A, Cantero D (2006), “Toxic effects of dissolved heavy metals on Desulfovibrio vulgaris and Desulfovibrio sp strains”, J Hazar Mater., 135, pp 40-46 17 Chaney RL, Brown SL, Angle JS, Stuczynski TI, Daniels WL, Henry CL, Siebielec G, Li YM, Malik M, Ryan JA, Compton H (2000), In situ Remediation/ Reclamation/Restoration of Metals Contaminated Soils using Tailor-Made Biosolids Mixtures, Symposium on Mining, Forest and Land Restoration: The Successful Use of Residuals/Biosolids/Organic Matter for Reclamation Activities, Denver, CO 18 Cooper EL, Wagner CC (1973), “The effects of acid mine drainage on fish populations”, Fish and Food Organisms in Acid Waters of Pennsylvania, US Environmental Protection, EPA, pp 32-114 19 Cord-Ruwisch R (1985), “A quick method for the determination of dissolved and precipitated sulfides in cultures of sulfate-reducing bacteria”, J Microbiol Meth 4, pp 33-36 20 Dar SA., Kuenen JG, Muyzer G (2005), “Nested PCR-denaturing gradient gel electrophoresis approach to determine the diversity of sulfate-reducing bacteria in complex microbial communities”, Appl Environ Microbiol., 71, pp 2325–2330 21 Dar SA, Stams AJ, Kuenen JG, Muyzer G (2007), “Co-existence of physiologically similar sulphate-reducing bacteria in a full-scale sulfidogenic bioreactor fed with a single organic electron donor”, Appl Microbiol Biotechnol., 75, pp 1463–1472 22 DIN 38406-E1-1 (1983), German standard methods for the examination of water, waste water and sludge, cation (group E), determination of iron (E1) 23 Doshi SM (2006), Bioremediation of Acid Mine Drainage Using Sulfate-Reducing Bacteria, Report for U.S Environmental Protection Agency 24 Dubilier N, Mülders C, Ferdelman T, de Beer D, Pernthaler A, Klein M, Wagner M, Erséus C, Thiermann F, Krieger J, Giere O, Amann R (2001), “Endosymbiontic sulphate-reducing and sulphide-oxidizing bacteria in an oligochaete worm”, Nature, 411, pp 298–302 25 Duffield S, Lucia AC, Mitchison N, Kasamas H, (2000), “Land recovery and man-made risks: a perspective from the EU accession countries”, J Hazard Mater.,78, pp 91-103 26 Elferink OSJWH, Visser A, Hulshoff-Pol LW, Stams AJM (1994), “Sulphate reduction in methanogenic bioreactors”, FEMS Microbiol Rev., 15, pp 119–136 27 EPA (1995), Human Health and Environmental Damages from Mining and Mineral Processing Wastes, Washington DC, Office of Solid Waste, U.S Environmental Protection Agency 28 Farag, A M., D.Skaar, D.A Nimick, E MacConnell, and C Hogstrand (2003), "Characterizing aquatic health using salmonids mortality, physiology, and biomass estimates in streams with elevated concentrations of arsenic, cadmium, copper, lead, and zinc in the Boulder River Watershed, Montana", Transac Amer Fisher Soc., 132, pp 450-457 29 Felsenstein J (1985), “Confidence limits on phylogenies: an approach using the bootstrap”, Evolution, 39, pp 783-791 30 Figueroa L (2005), Microbial ecology of anaerobic biosystems treating mining influenced waters, Presented at the Mine Water Treatment Technology Conference, Pittsburgh, PA 31 Frauque, G., J.LeGall, and L L Barton (1991), “Sulphate-reducing and sulphur-reducing bacteria”, Variation in Autotrophic Life, pp 271-337 32 Fromm, P O (1980), "A review of some physiological and toxicological responses of freshwater fish to acid stress", Environ Biol Fishes, 5, pp 79-93 33 Gadd G (2004), “Microbial influence on metal mobility and application for bioremediation”, Geoderma, 122, pp 109-119 34 Gusek JJ, Wildeman TR (2002), Passive treatment of aluminum-bearing acid rock drainage, rd Proceedings of the 23 Annual West Virginia Surface Mine Drainage Task Force Symposium, Morgantown, West Virginia, April 16-17, 2002 35 Dinh TH, Kuever J, MaBmann M, Hassel AW, Martin Stratmann and Friedrich Weddel, “Iron corrosion by novel anaerobic microorganism”, Nature, 427, pp 829-832 36 Hao OJ, Chen JM, Huang L, Buglass RL (1996), “Sulphate reducing bacteria”, Crit Rev Enviro Sci Technol., 26, pp 155-187 37 Hao OJ, Huang L, Chen JM, Buglass RL (1994), “Effects of metal additions on sulphate reduction activity in wastewaters”, Toxicology and Environmental Chemistyi, 46, pp 197212 38 Higgins JP, Hard BC, Mattes A (2003), Bioremediation of rock drainage using sulphatereducing bacteria, Proceedings of Sudbury 2003: Mining and Environment, Sudbury, Ontario, May 25-28, 2003 39 Hill RD (1974), Mining impacts on trout habitat, Proceedings of a Symposium on Trout Habitat, Research, and Management, Boone, NC, Appalachian Consortium Press 40 Hilton BL, Oleszkiewiez JA (1988), “Sulfide induced inhibition of anaerobic digestion”, J Environ Eng., 114, pp 1377–1391 41 Hines ME, Evans RS, Genthner BRS, Willis SG, Friedman S, Rooney-Varga JN, Devereux R (1999), “Molecular phylogenetic and biogeochemical studies of sulfate-reducing bacteria in the rhizosphere of Spartina alterniflora”, Appl Environ Microbiol., 65, 2209–2216 42 Howells GD, Brown DJA, Sadler K (1983), "Effects of acidity, calcium, and aluminum on fish survival and productivity - a review", J Sci Food Agr., 34(6), pp 559-570 43 Itoh T, Suzuki KI, Nakase T (1998), “Thermocladium modestius gen nov., sp nov a new genus of rod-shaped, extremely thermophilic crenarchaeote”, Int J Syst Bacteriol., 48, pp 879–887 44 Itoh T, Suzuki KI, Sanches PC, Nakase T (1999), “Caldivirga maquilingensis gen nov., sp nov a new genus of rod-shaped crenarchaeote isolated from a hot spring in the Philippines”, Int J Syst Bacteriol., 49, pp 1157–1163 45 Jage CR, Zipper CE, Hendricks AC (2000), Factors affecting performance of Successive Alkalinity-Producing Systems, Presented at the American Society for Surface Mining and Reclamation 17th Annual Meeting, Tampa, Florida, June 11-15, 2000 46 Jennings SR, Neuman DR, Blicker PS (2008), Acid Mine Drainage and Effects on Fish Health and Ecology: A Review, Reclamation Research Group Publication, Bozeman MT 47 Jeanthon C, Haridon SL, Cueff V, Banta A, Reysenbach AL, Prieur D (2002), “Thermodesulfobacterium hydrogeniphilum sp nov., a thermophilic, chemolithoautotrophic sulfate-reducing bacterium isolated from a deep-sea hydrothermal vent at Guaymas Basin and emendation of the genus Thermodesulfobacterium”, Int J Syst Evol Microbiol., 52, pp 765–772 48 Jong T, Parry DL (2006), “Microbial sulfate reduction under sequentially acidic conditions in an upflow anaerobic packed bed bioreactor”, Water Res., 40, pp 2561-2571 49 Kaksonen AH, Plumb JJ, Franzmann PD, Puhakaka JA (2004a), “Simple organic electron donors support diverse sulphate- reducing communities in fluidized-bed reactors treating acid metal- and sulphate-containing wastewater”, FEMS Microbiol Ecol., 47, pp 279–289 50 Kaksonen AH, Plumb JJ, Franzmann PD, Puhakaka JA (2004b), “Effects of hydraulic retention time and sulphide toxicity on ethanol and acetate oxidation in sulphate reducing metal-precipitating fluidized-bed reactor”, Biotechnol Bioeng., 86, pp 332–343 51 Kepler DA, McCleary EC (1994), “Successive alkalinity-producing systems (SAPS) for the treatment of acidic mine drainage”, Proceedings of the International Land Reclamation and Mine Drainage Conference and the Third International Conference on the Abatement of Acidic Drainage, Pittsburgh, PA, April 24-29, 1994, pp 195-204 52 Kniemeyer O, Musat F, Sievert SM, Knittel K, Wilkes H, Blumenberg M, Michaelis W, Classen A, Bolm C, Joye SB, Widdel F (2007), “Anaerobic oxidation of short-chain hydrocarbons by marine sulphate-reducing bacteria”, Nature, 449, pp 898–901 53 Kovacik WPJ (2006), “Molecular analysis of deep subsurface Cretaceous rock indicates abundant Fe(III)- and S°-reducing bacteria in a sulfate-rich environment”, Environ Microbiol., 8, 141–155 54 Kremer DR, Hansen TA (1988), “Pathway of propionate degradation in Desulfobulbus propionicus”, FEMS Microbiol Lett., 49, pp 273-277 55 Laanbroek HJ, Geerligs HJ, Sijtsma L, Veldkamp H (1984), “Competition for sulfate and ethanol among Desulfobacter, Desulfobulbus, and Desulfovibrio species isolated from intertidal sediments”, Appl Environ Microbiol., 47, pp 329–334 56 Logan MV, Reardon KF, Figueroa LA, McLain JET, Ahmann DM (2005), “Microbial community activities during establishment, performance, and decline of bench-scale passive treatment systems for mine drainage”, Water Res., 39, pp 4537-4551 57 Lopez IFR, Larrea L, Cocolin E, Orr T, Phister M, Marshall J, Gheynst V, Mills DA (2003), “Design and evaluation of PCR primers for analysis of bacterial populations in wine by denaturing gradient gel electrophoresis”, Appl Environ Microbiol., 69, pp 6801–6807 58 Maillacheruvu KY, Parkin GF (1996), “Kinetics of growth, substrate utilization and sulphide toxicity for propionate, acetate and hydrogen utilisers in anaerobic systems”, Water Environ Res., 68, pp 1099–1106 59 Marmur J (1961), “A procedure for the isolation of deoxyribonucleic acid from microorganisms”, J Mol Biol, 3, pp 208-218 60 McCartney DM, Oleszkiewicz JA (1991), “Sulphide inhibition of anaerobic degradation of lactate and acetate”, Water Res., 25, pp 203–209 61 McCartney DM, Oleszkiewicz JA (1993), “Competition between methanogens and sulphate reducers: effect of COD: sulphate ratio and acclimation”, Water Environ Res., 65, pp 655–664 62 Menendez R (1978), “Effects of acid water on Shavers Fork – a case history”, Surface mining and fish/wildlife needs in the Eastern United States., U.S DOI, Fish and Wildlife Service, pp 160-169 63 Minz D, Flax JL, Green SJ, Muyzer G, Cohen Y, Wagner M, Rittmann EB, Stahl DA (1999), “Diversity of sulfate-reducing bacteria in oxic and anoxic regions of a microbial mat characterized by comparative analysis of dissimilatory sulfite reductase genes”, Appl Environ Microbiol 65, pp 4666–4671 64 Munshower FF, Neuman DR, Jennings SR, Phillips GR (1997), “Effects of land reclamation techniques on runoff water quality from the Clark Fork River floodplain, Montana”, Washington, DC, EPA Office of Research and Development, pp 199-208 65 Mussmann M, Ishii K, Rabus R, Amann R (2005), “Diversity and vertical distribution of cultured and uncultured Deltaproteobacteria in an intertidal mud flat of the Wadden Sea”, Environ Microbiol., 7, pp 405–418 66 Muyzer G, Stams AJM (2008), “The ecology and biotechnology of sulphate-reducing bacteria”, Nature, 6, pp 441-454 67 Nilsen RK, Beeder J, Thostenson T, Torsvik T (1996), “Distribution of thermophilic marine sulfate reducers in North Sea oil field waters and oil reservoirs”, Appl Environ Microbiol., 62, pp 1793–1798 68 Nordstrom DK, Alpers CN (1999), “Negative pH, efflorescent mineralogy, and consequences for environmental restoration at the Iron Mountain Superfund site, California”, National Acad Sci., 96, pp 3455-3462 69 Nordstrom DK, Jenne EA, Averett RC (1977), “Heavy metal discharges into Shasta Lake and Keswick Reservoir on the Sacramento River, California – a reconnaissance during low flow”, U.S Geological Survey Open-File Report, pp 76-49 70 Nordwick S, Zaluski M, Park B, Bless D (2006), “Advances in development of bioreactors applicable to the treatment of ARD”, Proceedings, 7th Int Conf on Acid Rcok Drainage, St Louis, MO, March 26-30, 2006, ed by R.I Barnhisel, pp 1410-1420 71 O’Flaherty V, Colleran E (1998), “Effect of sulphate addition on volatile fatty acid and ethanol degradation in an anaerobic hybrid reactor I: process disturbance and remediation”, Biores Technol., 68, pp 101–107 72 Ollivier B, Caumette P, Garcia JL, Mah RA (1994), “Anearobic bacteria from hypersaline enviroments”, Microbiol Rev., 58, pp 27-38 74 Peck HD, Lissolo T (1988), “Assimilatory and dissimilatorymsulphate reduction: enzymology and bio energentics”, The Ntrogen and Sulphur Cycles, pp 99-132 75 Perry RH, Green D (1984), Perry’s Chemical Engineer’s Handbook, 6th Ed McGraw-Hill Book Company, Singapore 76 Pfennig N, Widdel F, Truper HG (1981), “The dissimilatory sulphate reducing bacteria”, in The Prokaryotes, 2, pp 926-940 77 Postage JR (1984), The sulphate reducing bacteria, 2nd ed, Cambridge Univertsity Press, Cambridge 78 Ramsing NB, Kühl M, Jørgensen BB (1993), “Distribution of sulfate-reducing bacteria, O2, and H2 S in photosynthetic biofilms determined by oligonucleotide probes and microelectrodes”, Appl Environ Microbiol., 59, pp 3840–3849 79 Ravenschlag K, Sahm K, Knoblauch C, Jørgensen BB, Amann R (2000), “Community structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine Arctic sediments”, Appl Environ Microbiol., 66, pp 3592–3602 80 Reis MAM, Almeida JS, Lemos PC, Carrondo MJT (1992), “Effect of hydrogen sulphide on growth of sulphate-reducing bacteria”, Biotechnol Bioeng., 40, pp 593–600 81 Rissati JB, Capman WC, Stahl DA (1994), “Community structure of a microbial mat: the phylogenetic dimension”, Proc Nat Acad Sci USA, 91, pp 10173–10177 82 Rodríguez L, Ruiz E, Alonso-Azcárate J, Rincón, J (2009), “Heavy metal distribution and chemical speciation in tailings and soils around a Pb–Zn mine in Spain”, J Environ Manag., 90 , pp 1106-1116 83 Rose AW, Alcorn GS, Phelps LB, Bower PR (2001), Case study of Pot Ridge Passive Treatment Systems, Cambria County, Pennsylvania, Presented at the American Society for th Surface Mining and Reclamation 18 Annual National Meeting, Albuquerque, New Mexico, June 3-7, 2001 84 Saitou N, Nei M (1987), “The neighbor-joining method: a new method for reconstructing phylogenetic trees”, Mol Biol Evol., 4, pp 406-425 85 Sass H, Wieringa E, Cypionka H, Babenzien HD, Overmann J (1998), “High genetic and physiological diversity of sulfate-reducing bacteria isolated from an oligotrophic lake sediment”, Arch Microbiol., 170, pp 243–251 86 Schink B, Stams AJM (2006), “The Prokaryotes”, Springer Verlag, New York, pp 309–335 87 Schönheit P, Kristjansson JK, Thauer RK (1982), “Kinetic mechanism for the ability of sulphate reducers to out-compete methanogens for acetate”, Arch Microbiol., 132, pp 285–288 88 Sen AM (2001), Acidophilic Sulphate Reducing Bacteria: Candidates for Bioremediation of Acid Mine Drainage Pollution, Thesis, Univ Wales 89 Singer P, Stumm W (1970), “Acid mine drainage: the rate determining step”, Science, 167, pp 1121-1123 90 Skousen J, Sextone A, Cliff J, Sterner P, Calabrese J, Ziemkiewicz P (1999), Acid mine drainage treatment with a combined wetland/anoxic limestone drain: greenhouse and field th systems, Presented at the American Society for Surface Mining and Reclamation 16 Annual National Meeting, Scottsdale, Arizona, August 13-19, 1999 91 Skousen J, Ziemkiewicz P (1996), Acid Mine Drainage Control and Treatment, 2nd Ed National Research Center for Coal and Energy, National Mine Land Reclamation Center, West Virginia University, Morgantown, WV, pp 362 92 Spear JR, Figueroa LA, Honeyman BD (2000), “Modeling the removal of uranium U(VI) from aqueous solution in the presence of sulfate reducing bacteria”, Environ Sci Technol., 66, pp 3711-3721 93 Speece RE (1983), “Anaerobic biotechnology of industrial wastewaters”, Environ Sci Technol., 17, pp 416A–427A 94 Stadnitskaia A, Muyzer G, Abbas B, Coolena MJL, Hopmans EC, Baas M, van Weeringa TCE, Ivanovb MK, Poludetkina E, Sinninghe Damste JS (2005), “Biomarker and 16S rDNA evidence for anaerobic oxidation of methane and related carbonate precipitation in deep-sea mud volcanoes of the Sorokin Trough, Black Sea”, Mar Geol., 217, pp 67–96 95 Stams AJ, Elferink OS, Westermann P (2003), “Metabolic interactions between methanogenic consortia and anaerobic respiring bacteria”, Adv Biochem Eng Biotechnol., 81, pp 31–56 96 Stephenson SL, Studiar SM, McQuattie CJ (1995), “Effects of acidification on bryophyte communities in West Viginia moutain streams”, J Environ Qual., 24, pp 116 – 125 97 Teitzel GM, Parsek MR (2003), “Heavy metal resistance of biofilm and planktonic Pseudomonas aeruginosa”, Appl Environ Microbiol., 69, pp 2313–2320 98 Thauer RK, Jungermann K, Decker K (1977), “Energy conservation in chemotrophic anaerobic bacteria”, Bacteriol Rev., 41, pp 100-180 99 Tsukamoto TK, Killion HA, Miller GC (2004), “Column experiments for microbial treatment of acid mine drainage: low-temperature, low-pH and matrix investigations”, Water Res., 38, pp 1405-1418 100 U.S.Department of Agriculture (USDA) and EPA Region III (2000), A Handbook of Constructed Wetlands, Report# 843F00003 101 U.S.Department of Energy (US DOE) (1998), Research and Application of Permeable Reactive Barriers, Document# K0002000 102 US EPA (2004a), Nationwide Identification of Hardrock Mining Sites, Report #2004-P00005, Office of the Inspector General 103 US EPA (2004b), Abandoned Mine Lands Team Reference Notebook 104 Vega FA, Covelo EF, Andrade ML (2006), “Competitive sorption and desorption of heavy metals in mine soils: Influence of mine soil characteristics”, J Colloid Interface Sci., 298, pp 582-592 105 Warner RW (1971), "Distribution of biota in a stream polluted by acid mine drainage", Ohio J Sci., 71, pp 202-215 106 Watzlaf G, Schroeder K, Kleinmann R, Kairies C, Nairn R (2003), “The passive treatment of coal mine drainage”, US Department of Energy NETL, pp 72 107 Wawer C, Jetten MS, Muyzer G (1997), “Genetic diversity and expression of the NiFe hydrogenase large-subunit gene of Desulfovibrio spp in environmental sample”, Appl Environ Microbiol., 61, pp.4360–4369 108 Webster G, Watt LC, Rinna J, Fry JC, Evershed RP, Parkes RJ, Weightman AJ (2006), “A comparison of stable isotope probing of DNA and phospholipids fatty acids to study prokaryotic functional diversity in sulfate-reducing marine sediment enrichment slurries”, Environ Microbiol., 8, pp 1575–1589 109 Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) "16S ribosomal DNA amplification for phylogenetic study" J Bacteriol., 173: 697–703 110 Weijma J, Gubbels F, Hulshoff Pol LW, Stams AJM, Lens P, Lettinga G (2002), “Competition for H2 between sulphate reducers, methanogens and homoacetogens in a gaslift reactor”, Water Sci Technol., 45, pp 75–80 111 Widdel F (1988), “Microbiology and ecology of sulphate- and sulphur-reducing bacteria”, in Biology of Anaerobic Microorganism, pp 469-585 112 Widdel F, Bak F (1992), “Gram-negative mesophilic sulfate-reducing bacteria”, in The Prokaryotes, 2nd ed Spinger, Berlin Heidelberg New York, pp 3352-3378 113 Widdel F, Pfennig N (1984), “Dissimilatory sulfate- and sulfur-reducing bacteria”, Bergey’s Manual of Systematic Bacteriology, 1, pp 663-679 114 Widdel F, Hansen TA (1991), “The dissimilatory sulphate and sulphur reducing bacteria”, in The prokaryotes, pp 583-624 115 Younger PL, Banwart SA, Hedin RS (2002b), Mine water: hydrology, pollution, remediation, Dordrecht; Boston, Kluwer Academic Publishers.16, pp 442 116 Zeikus JG, Dawson MA, Thompson TE, Lugvorsen K, Hatchikian EC (1983), “Microbial ecology of volcanic sulphidogenesis: Isolation and characterization of Thermodesulfobacteria commune gen nov and sp nov J Gen Microbiol., 129, pp 11591169 117 Zhou J, Bruns MA, Tiedje JM (1996), “DNA recovery from soils of diverse composition”, Appl Environ Microbiol., 62, pp 316-322  ... hình xử lý AMD với chất nước thải có hàm lưỡng chất hữu cao Như nước thải có hàm lượng hữu cao có khả sử dụng làm chất tốt cho vi khuẩn khử sulfate bể phản ứng xử lý AMD Vi? ??c kết hợp nước thải. .. sở đó, E1-4 sử dụng để tiến hành phân lập chủng SRB khiết (a) (b) Hình 3.2 Làm giàu phân lập vi khuẩn khử sulfate từ mẫu nước thải (a) – Mẫu làm giàu vi khuẩn SRB E1-4; (b) – Khuẩn lạc SRB hình... Các mẫu nƣớc thải  Mẫu nước thải để làm giàu SRB thu thập từ số hệ thống xử lý nước thải điều kiện kỵ khí Quảng Ngãi, Bình Dương, Bắc Ninh  Mẫu nước thải AMD để thử nghiệm xử lý mơ hình phịng