Tài liệu Exporting the Results of a Query as a String docx

Tài liệu Exporting the Results of a Query as a String docx

Tài liệu Exporting the Results of a Query as a String docx

... Team LiB ] Recipe 5.11 Exporting the Results of a Query as a String Problem You need to export the results of a query to a string in a manner similar to the GetString( ) method of the ADO ... Recordset. The method iterates over the collection of rows and columns in the table appending the field values to a string. Null values are r...

Ngày tải lên: 24/12/2013, 05:15

4 388 0
Tài liệu Exporting the Results of a Query to an Array pdf

Tài liệu Exporting the Results of a Query to an Array pdf

... Team LiB ] Recipe 5.12 Exporting the Results of a Query to an Array Problem You need to export the results of a query to an array in a manner similar to the GetRows( ) method of the ADO ... colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected from the table. dt The DataT...

Ngày tải lên: 26/01/2014, 10:20

5 310 0
Tài liệu Determining the Length of Columns in a SQL Server Table doc

Tài liệu Determining the Length of Columns in a SQL Server Table doc

... ConfigurationSettings.AppSettings["Sql_ConnectString"]); // Create DataAdapter. SqlDataAdapter da = new SqlDataAdapter(sqlText, conn); // Add table mappings. da.TableMappings.Add("Table", ... da.TableMappings.Add("Table", "Orders"); da.TableMappings.Add("Table1", "Order Details"); // Create the DataSet. DataSet ds = n...

Ngày tải lên: 24/12/2013, 05:15

4 458 0
Tài liệu Lincoln: The Biography of a Writer docx

Tài liệu Lincoln: The Biography of a Writer docx

... his father’s character. It was not a char- acter that he admired. And it was one that he needed later to distance h imself from. Thomas Lincoln “was not a lazy man,” a contemporary of Abraham’s ... Kaplan the central moral claim much of its force. His command of language is measured to the intellectual complexity of the issue, to the balance of heart and head, of...

Ngày tải lên: 18/02/2014, 10:20

417 654 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Tài liệu SCRIBE: The design of a large-scale event notification infrastructure? doc

Tài liệu SCRIBE: The design of a large-scale event notification infrastructure? doc

... router-based multicast approaches and the lack of wide deployment of IP multicast limits their ap- plicability. As a result, application-level multicast is gaining popularity. Appropriate algorithms ... in the topic. Pastry and Scribe are fully decentralized, all decisions are based on local information, and each node has identical capabilities. Each node can act as a publishe...

Ngày tải lên: 19/02/2014, 18:20

13 631 0
Tài liệu Hardscrabble The Fall of Chicago: A Tale of Indian Warfare pot

Tài liệu Hardscrabble The Fall of Chicago: A Tale of Indian Warfare pot

... a sort of granary and depot for the provisions of the family, was ascended by means of a ladder, and through a square aperture just large enough to admit with ease the body of a man. There was, ... This man was about five and thirty. The last of the little party was a boy. He was a raw-boned lad of about fourteen years of age, and of fair complexion, with...

Ngày tải lên: 22/02/2014, 04:20

89 456 0
Tài liệu In the Shadows of a Fallen Wall docx

Tài liệu In the Shadows of a Fallen Wall docx

... features. A few feet away stood another boy, at least as tall as me but heavier and probably older than the redhead. Though he was somewhat light skinned, many of his features— the kinky hair, the ... That Thomas was not worried about the hat— a Russian ushanka with large, de- tachable earaps that I was fond of —made me even more disappointed for having spent so much...

Ngày tải lên: 22/02/2014, 06:20

208 481 0
Tài liệu KRONE - the effect of Errors in TCP applications performance (full) pdf

Tài liệu KRONE - the effect of Errors in TCP applications performance (full) pdf

... none, it acknowledges the last segment and the transmission is complete. TCP Performance Traditionally, the efficiency of a data communications task is defined as the ratio of the data successfully transferred ... most implementations, each of the layers shown creates one of the headers in the encapsulated message. As a specific example, suppose a client devi...

Ngày tải lên: 09/12/2013, 16:15

12 534 0
Tài liệu Accelerating the Deployment of VoIP and VoATM pdf

Tài liệu Accelerating the Deployment of VoIP and VoATM pdf

... to process and communicate call control instructions to a media gateway. A signaling gateway can either stand-alone or be integrated with a softswitch/media gateway. In the traditional circuit-switched ... a legacy switch provides the interface directly to the SS7 world, essentially acting as a signaling gateway. 9. The Softswitch/Media Gateway Controller A softswitc...

Ngày tải lên: 10/12/2013, 17:15

21 502 0
w