A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi
A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi
... concerns into governance 3) Vertically integrated planning and management 4) Integration across environmental media 5) Integrated environmental management (regions) 6) Integrated environmental management ... models, of scales, of issues, and of stakeholders. Scrase and Sheate (2002) give a more detailed and critical review on the uses and meanings of integration, integrated approach and integrated assessment. ... suggests, information about the result of a transformation or an action is sent back to the input of the system in the form of input data. If these new data facilitate and accelerate the transformation...
- 139
- 492
- 0
A handbook for project managers, developers, implementers, evaluators and donors working to counter trafficking in persons. ppt
... Indicators are quantitative or qualitative benchmarks that provide a simple and reliable basis for assessing achievement, change or performance. They are a means of analyzing and monitoring the ... use of indicators. It also includes the matrix that contains the performance indicators chosen for this handbook, an explanation on how to use the matrix in developing performance indicators and ... indicators. The performance indicators provided in this handbook are meant to be, at a minimum, a starting point for anyone looking to develop performance indicators for counter-tracking projects....
- 80
- 377
- 0
The Marginal External Cost of Car - with an Application to Belgium - potx
... Department of Transport in its COBA-9 manual (Great Britain, Department of Transport (1987)). For buses average vehi- cle occupancy rates of 37 and 15 are assumed for respectively peak and off-peak ... accident rate ratio equals 1. Marginal accident externalities are then BF 1.1 in the case of urban and 'other' roads and BF 0.4 on highways. In case 2 a mar- ginal to average accident ... has to be taken into account when calculating the marginal external noise costs. Using an expected lifetime of a house of 50 years and a discount factor of 5%, we obtain a mone- tary value...
- 34
- 522
- 0
Báo cáo khoa học: "An Algorithm for Unsupervised Transliteration Mining with an Application to Word Alignment" ppt
... Val-letta, Malta.Qin Gao and Stephan Vogel. 2008. Parallel implemen-tations of word alignment tool. In Software Engineer-ing, Testing, and Quality Assurance for Natural Lan-guage Processing, ... translit-eration accuracy rather than the likelihood of thetraining data as g2p does. The training data con-tains more non-transliteration pairs than transliter-ation pairs. We don’t want to ... over training and held-out data, then a non-transliteration word pair such asthe English-Hindi pair “change – badlao” may endup in the training data and the related pair “changes– badlao” in...
- 10
- 320
- 0
Báo cáo khoa học: "A Generic Approach to Parallel Chart Parsing with an Application to LinGO" pdf
... like charts and a thread-safe uni-fication algorithm. CaLi is an instance of a MACAMBA application that implements a Chart parser for the LinGO grammar. Thedesign of CaLi was based on PET (Callmeier,2000), ... shows an outline of our approach in terms of data structures. Each thread con-tains an agenda, which can be seen as a queue of unification tasks, a chart, which stores thederived edges, and a heap, ... parsingcomputations. According to Caroll (1994),performing a complexity analysis solely at thelevel of grammars and parsing schemata cangive a distorted image of the parsing pro-cess in practice. For...
- 8
- 333
- 0
Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt
... 4725–4733.22 Kagebayashi C, Yamaguchi I, Akinaga A, Kitano H,Yokoyama K, Satomura M, Kurosawa T, WatanabeM, Kawabata T, Chang W et al. (2009) Automatedimmunoassay system for AFP-L3% using on-chipelectrokinetic ... Differential glycan profiling between cancer and normal cells enables identification of aberrant glycosylation in cancer [indicated as a red triangle in (B) and (C)] as an alteration in lectin signal pattern. ... quantitative interactiondata in terms of the affinity constants (K a ) of a series of lectins for a panel of pyridylaminated glycansobtained by automated frontal affinity chromatogra-phy with a fluorescence...
- 11
- 854
- 0
Considerations for design of piping systems
... ...
- 9
- 332
- 1
Biostatistics A Methodology for the Health Sciences Second Edition pot
... a fraction of the time. Data collected to examine the association between smokingand cancer must be analyzed with recognition of an uncertain and variable outcome.5. In designing and planning ... that differs from that planned. The need to evaluate data from a studystatistically forces an investigator to sharpen the focus of the study. It makes one translateintuitive ideas into an analytical ... the life-table method of analyzingsurvival data of importance in many biostatistical applications. The topics in this bookare tailored to the applications in mind.2. Examples are drawn from...
- 889
- 406
- 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... GCTTGAAGCAAGCCTCGATGCCTGAGGAAACCCAGACCCAA, reverse primer CAGTAGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA;Hsp90b, forward primer GCTTGAAGCAAGCCTCGATGCCTGAGGAAGTGCACCATGGA, reverse primer CAGTAGCTTCATCTT ... organization (rhodamine–phalloidin staining revealed almost instant loss of anyactin organization following Hsp90 inhibitor treatment;data not shown). After 6 h, many of these cells displayed an ... report a study of the activation of variousHsp90 clients and Hsp90 inhibitor sensitivity in suchstrains; analysis that showed that many mammalianclients are able to be activated by both Hsp9 0a andHsp90b....
- 11
- 427
- 0
Từ khóa: vba programming for microsoft project 98 through 2010 with an introduction to vsto downloadcultural intermixing the diffusion of gis and its application to coastal management in developing countriesa customer analysis based methodology for improving web business systemsa taxonomy for denial of service attacks in wireless sensor networks pdfa taxonomy for denial of service attacks in wireless sensor networkshow to create a website for free of cost in googleNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ