A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi

... concerns into governance 3) Vertically integrated planning and management 4) Integration across environmental media 5) Integrated environmental management (regions) 6) Integrated environmental management ... models, of scales, of issues, and of stakeholders. Scrase and Sheate (2002) give a more detailed and critical review on the uses and meanings of integration, integ...

Ngày tải lên: 06/11/2012, 10:35

... Indicators are quantitative or qualitative benchmarks that provide a simple and reliable basis for assessing achievement, change or performance. They are a means of analyzing and monitoring the ... use of indicators. It also includes the matrix that contains the performance indicators chosen for this handbook, an explanation on how to use the matrix in developing perform...

Ngày tải lên: 30/03/2014, 01:20

...

Ngày tải lên: 05/03/2014, 16:20

... Department of Transport in its COBA-9 manual (Great Britain, Department of Transport (1987)). For buses average vehi- cle occupancy rates of 37 and 15 are assumed for respectively peak and off-peak ... accident rate ratio equals 1. Marginal accident externalities are then BF 1.1 in the case of urban and 'other' roads and BF 0.4 on highways. In case 2 a...

Ngày tải lên: 07/03/2014, 11:20

... Val- letta, Malta. Qin Gao and Stephan Vogel. 2008. Parallel implemen- tations of word alignment tool. In Software Engineer- ing, Testing, and Quality Assurance for Natural Lan- guage Processing, ... translit- eration accuracy rather than the likelihood of the training data as g2p does. The training data con- tains more non-transliteration pairs than transliter- ation pairs. We don’t...

Ngày tải lên: 23/03/2014, 16:20

... like charts and a thread-safe uni- fication algorithm. CaLi is an instance of a MACAMBA application that implements a Chart parser for the LinGO grammar. The design of CaLi was based on PET (Callmeier, 2000), ... shows an outline of our approach in terms of data structures. Each thread con- tains an agenda, which can be seen as a queue of unification tasks, a cha...

Ngày tải lên: 31/03/2014, 04:20

... 4725–4733. 22 Kagebayashi C, Yamaguchi I, Akinaga A, Kitano H, Yokoyama K, Satomura M, Kurosawa T, Watanabe M, Kawabata T, Chang W et al. (2009) Automated immunoassay system for AFP-L3% using on-chip electrokinetic ... Differential glycan profiling between cancer and normal cells enables identification of aberrant glycosylation in cancer [indicated as a red triangle in (B) and (C)] a...

Ngày tải lên: 16/02/2014, 08:20

...

Ngày tải lên: 14/03/2014, 19:33

... a fraction of the time. Data collected to examine the association between smoking and cancer must be analyzed with recognition of an uncertain and variable outcome. 5. In designing and planning ... that differs from that planned. The need to evaluate data from a study statistically forces an investigator to sharpen the focus of the study. It makes one translate intuiti...

Ngày tải lên: 15/03/2014, 04:20

... GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse primer CA GTAGCTTCATCTT ... organization (rhodamine– phalloidin staining revealed almost instant loss of any actin organization following Hsp90 inhibitor treatment; data not shown). After 6 h, many of these cells d...

Ngày tải lên: 23/03/2014, 07:20