Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"

... 2001;413(6853):316-22. 4. Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu R, Imaki H, Ishida N, Okumura F, Nakayama K, Nakayama KI. Phosphorylation-dependent degradation of c-Myc is mediated by the F-box ... Tsunematsu R, Nakayama K, Oike Y, Nishiyama M, Ishida N, Hatakeyama S, Bessho Y, Kageyama R, Suda T, Nakayama KI. Mouse Fbw7/Sel-10/Cdc4 is required for notch degradation duri...

Ngày tải lên: 31/10/2012, 16:49

... Proteomic analysis of mechanisms of hypoxia-induced apoptosis in tro-phoblastic cells Shin-ichi Ishioka, Yoshiaki Ezaka, Kota Umemura, Takuhiro Hayashi, Toshiaki Endo, Tsuyoshi Saito Department of Obstetrics ... proteins induced by hypoxia in trophoblastic cells so as to clarify the mechanism of hypoxia-induced apoptosis by using the PoweBlot, an antibody-based Western array...

Ngày tải lên: 31/10/2012, 15:12

... TCGTTGGAGTGACATCGTCT GCTCCCACAATGAAGCATTT Actin, cyto-plasmic 1 (Beta-actin) NAP018710-001 B-actin 2.78 2.14 3.51 NC CTAAGGCCAACCGTGAAAAG CCATCACAATGCCTGTGGTA Mouse MHC class I H2-K-alpha-2 ... G2565BA. Data was extracted using Agilent Feature Extractor Software (v7.1). Statistical data analysis. All data was processed a Z score statistical analysis method developed at NIA Int. J. ... w...

Ngày tải lên: 03/11/2012, 11:35

... (M13F-cccagtcacgacgttg taaaacg- and M13R-agcggataacaatttcacacagg) were from Life Technologies, Inc. All other chemicals were of analy- tical grade or higher quality. Animals, venoms, and toxins D. marsupialis ... kDa), carbonic anhydrase (30 kDa), soybean trypsin inhibitor (20.1 kDa) and a- lactalbumin (14.4 kDa). Molecular mass DM64 molecular mass was determined by MALDI-TOF MS on a Voy...

Ngày tải lên: 21/02/2014, 01:21

... franciscana Oligomerization and thermotolerance Julie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRae Department of Biology, Dalhousie University, Halifax, Nova Scotia, Canada Oviparously ... cysts [57], and molecular mass markers o f 29 kDa (carbonic anhydrase), 66 k Da (bovine serum albumin), 150 kDa (alcohol dehydrogenase), 200 kDa (a- amylase), 443 kDa (apoferritin), and 669 kDa .....

Ngày tải lên: 22/02/2014, 04:20

... TGAAGC GAATTC TTAACGGATCCGCATGGCCATCC 479–473 C1 for TGAAGC GAATTC TTACTCCAGGTAGAGGTCCCTCT 585–579 C2 for TGAAGC GAATTC TTAGGCGGGGCCAATGATGAC 687–682 Loop back AGCTCG AGATCT GGGTCCTCAGAGGAGAGGAG ... obtained from all libraries, indicating that the humoral response against transgluta- minase occurs at the intestinal level, whereas that against gliadin occurs both peripherally and centrally. .....

Ngày tải lên: 08/03/2014, 09:20

... Structural analysis of Francisella tularensis lipopolysaccharide Evgeny Vinogradov, Malcolm B. Perry and J. Wayne Conlan Institute for Biological Sciences, National Research Council, Ottawa, Canada The ... [18]. Finally, it was noted that the LPS prepared by standard phenol–water extraction was heavily contaminated with an amylopectin-like glucan, a a-(1–6)-linear glucan, and a short...

Ngày tải lên: 08/03/2014, 09:20

... by a linear gradient of 2–600 m M NaOAc over a time of 70 min. Fractions were analyzed by analytical HPAEC and appropriately com- bined. Desalting was achieved by gelfiltration as described above. ... preliminary data were available and investigated the deacylated LPS by NMR and MS. The proposed structure determined pre- viously by methylation analysis was confirmed and is shown below...

Ngày tải lên: 08/03/2014, 09:20

... using the Bio-Rad protein assay reagent (Bio-Rad Laboratories Inc., CA, USA). Data analysis Steady state kinetic analyses for P450foxy were examined with varying concentrations of fatty acid and ... Kinetic analysis of hydroxylation of saturated fatty acids by recombinant P450foxy produced by an Escherichia coli expression system 7 Tatsuya 7 Kitazume 1 , Akinori Tanaka 1 , Naoki Tak...

Ngày tải lên: 08/03/2014, 22:20

... protein Fig. 3. Semi-native PAGE analysis of in vitr o folding of OpaB128 (A) and OpaJ129 (B). (A) Semi-native-PAGE analysis of in vitro folding of unpurified OpaB128 (Coomassie stained). Lane ... and incubated with bacterial lysates containing the CEACAM1-N -A1 domain. Binding of CEACAM1-N -A1 was determined by monoclonal anti-His Ig reacting with the His-tagged CEACAM1-N -...

Ngày tải lên: 17/03/2014, 10:20