A Quick Tour of the C++CLI Language Features

A Quick Tour of the C++CLI Language Features

A Quick Tour of the C++CLI Language Features

... CHAPTER 2 A Quick Tour of the C++/CLI Language Features T he aim of this chapter is to give you a general idea of what C++/CLI is all about by providing a brief look at most of the new language ... declaration. The managed array is a reference type, so the array and its values are allocated on the managed heap. So what exactly can you embed as fields in a...

Ngày tải lên: 05/10/2013, 08:20

18 539 0
A Brief Tour of the X Display Environment

A Brief Tour of the X Display Environment

... a totally separate system. The variants of the Microsoft Windows operating system cannot export the display of an individual application to be viewed on a separate machine. If an application ... view a whole desktop as opposed to an individual application remotely across the network. X-enabled programs are different in that they have the ability to set display details at...

Ngày tải lên: 05/10/2013, 08:51

10 403 0
A quick tour of adobe Illustrator pot

A quick tour of adobe Illustrator pot

... The trick is creating the correct shape for the result that you want. In this image we will create the three-dimensional shape of a crayon. The shape has already been created and saved as another ... leave the middle crayon red. Applying transparency In Adobe Illustrator you have the ability to apply various levels of transparency to objects. Blending modes are also av...

Ngày tải lên: 23/03/2014, 14:20

403 654 0
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

... 2095 Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Tho ¨ ny-Meyer EMPA, Swiss Federal Laboratories for Materials Testing and Research, Laboratory for Biomaterials, ... presence of an amino acid that occludes the active site. This idea has been proposed because of similarities in the structures of the C-terminals of the related fami...

Ngày tải lên: 06/03/2014, 11:20

13 779 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

... 5¢-cttcctgtgtcaagtggcag-3¢ (for- ward), 5¢-gttggcagtggcattcacga-3¢ (reverse); and NeuroD 5¢-aagacgcatgaaggccaatg-3¢ (forward), 5¢-catgatgcgaatggct atcg-3¢ (reverse). Hybridization, washing, antibody reaction and ... basal layer (b), and lamina propria (lp). The o-macs mRNA was not detected in the apical (a) or basal (b) layer of the VNE. Scale bars indicate 1 mm and 100 lm for the l...

Ngày tải lên: 08/03/2014, 02:20

10 394 0
Báo cáo khoa học: by nucleotide affinity cleavage: a distinct nucleotide specificity of the C-terminal ATP-binding site potx

Báo cáo khoa học: by nucleotide affinity cleavage: a distinct nucleotide specificity of the C-terminal ATP-binding site potx

... and after an additional incubation of 15 min at 37 °C affinity cleavage was induced by the addi- tion of 0.5 m M FeCl 3 and 30 m M ascorbate and completed by an additional incubation of 30 min at ... this apparent contradiction, and made an additional attempt to resolve the discrepancy. Using the affinity cleavage the hydroxyl radicals gener- ated by the oxidation of iron teth...

Ngày tải lên: 08/03/2014, 02:21

8 392 0
Báo cáo khoa học: "The Human Language Project: Building a Universal Corpus of the World’s Languages" pptx

Báo cáo khoa học: "The Human Language Project: Building a Universal Corpus of the World’s Languages" pptx

... One measure of adequacy of a language digitization is the abil- ity of a human—already fluent in a reference language to acquire fluency in the digitized lan- guage using only archived material. ... London), and the Pacific And Regional Archive for Digi- tal Sources in Endangered Cultures (Australia) of- fer broad coverage of languages, but the majority of their offe...

Ngày tải lên: 16/03/2014, 23:20

10 574 0
A Brief History of the English Language and Literature, Vol. 2 doc

A Brief History of the English Language and Literature, Vol. 2 doc

... happened to adjectives, verbs, and other parts of language. The causes of this are not far to seek. Spoken language can never be so accurate as written language; the mass of the English and Danes never ... vocabulary of the language is concerned, the Latin contribution is by far the most important element in our language. Latin was the language of the Romans...

Ngày tải lên: 17/03/2014, 02:20

127 957 0
Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

... catalytic pockets in the asymmetric unit, and the glutamate-binding modes are identical to each other (Fig. 2A) . The a- carboxyl and a- amino groups of the bound glutamate are at the bottom of the pocket, ... 5¢- CATATGGATGAGTACAAACA AGTAGATG-3¢ and reverse primer 5¢- GGATCCTCGAG CTCATTTACGTTTTAAATTAATGCCGAT-3¢ (underlin- ed sequences indicate NdeI and BamHI sites, respecti...

Ngày tải lên: 22/03/2014, 21:20

10 375 0
w