Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"

Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"

Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"

... commentaryreviewreportsresearchAvailable online http://ccforum.com/content/5/5/271Research articleUtility of routine chest radiographs in a medical–surgicalintensive care unit: a quality assurance ... prospectivelyevaluate their utility in our medical–surgical ICU as part of aquality assurance survey. The goals of this study were todetermine the percentage of...

Ngày tải lên: 25/10/2012, 10:45

5 507 0
 Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"

Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"

... cell carcinoma Akiko Kuwahara 1, Motohiro Yamamori 2, Kohshi Nishiguchi 3,4, Tatsuya Okuno 3, Naoko Chayahara 3, Ikuya Miki 3, Takao Tamura 3, Tsubasa Inokuma 2, Yoshiji Takemoto 2, Tsutomu Nakamura ... Nakamura 3, Kazusaburo Kataoka 1 and Toshiyuki Sakaeda 2,3  1. School of Pharmacy and Pharmaceutical Sciences, Mukogawa Women’s University, Nishinomiya, Japan; 2. Graduate School of Pharm...

Ngày tải lên: 26/10/2012, 09:53

7 531 0
Báo cáo y học: " Role of Dietary Soy Protein in Obesity"

Báo cáo y học: " Role of Dietary Soy Protein in Obesity"

... that soy protein intake stimulates skeletal muscle fatty acid oxidation by activating PPAR path-ways leading to reduced accumulation of body fat. Soy protein may reduce adiposity by modulating ... plasma levels of alanine transaminase and aspartate transaminase [55]. These effects were accompanied by increased activities of mitochondrial and peroxisomal beta-oxidation, ace-tyl-CoA carbo...

Ngày tải lên: 31/10/2012, 14:59

11 670 2
Báo cáo y học: "Treatment of Chronic HCV Infection in Special Populations."

Báo cáo y học: "Treatment of Chronic HCV Infection in Special Populations."

... reduction in viral RNA was seen to be less in African Americans than Caucasians by 50%. This indicates a larger population of slow responders in African Americans which may explain a low SVR in this ... particularly in genotype 1 patients [10]. A study by Sanchez-Tapias et al [7] treated patients with a pegylated alpha 2a plus ribavirin (1000 or 1200 mg ) for 4 weeks. Pre...

Ngày tải lên: 02/11/2012, 09:48

6 389 0
Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc

Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc

... a1 ,3GalT-5¢ -A p12 CCTGTCAAAAGAATAAACAGCGGTT Exon 3 a1 ,3GalT-5¢ -A p13 CACTGTTCCCTCAGCCGAGGAC Exon 1 a1 ,3GalT-5¢-B and -E p14 CCAACTCCTGATCGGCAGAAGC Exon 1 a1 ,3GalT-5¢B and E p15 ACTTCTGAAGCCTAAAGGATGCGA ... ACTTCTGAAGCCTAAAGGATGCGA Exon 2 a1 ,3GalT-5¢-C p16 AGGCAGGGCTGGGAGGAA Exon 3 a1 ,3GalT-5¢-C p17 TTGCTGTCGGAAGATACATTGAG Exon 8 a1 ,3GalT-coding region p18 CTTTGTGGCCAACCATGAA...

Ngày tải lên: 08/03/2014, 16:20

10 444 0
Báo cáo Y học: Role of critical charged residues in reduction potential modulation of ferredoxin-NADP+ reductase Differential stabilization of FAD redox forms doc

Báo cáo Y học: Role of critical charged residues in reduction potential modulation of ferredoxin-NADP+ reductase Differential stabilization of FAD redox forms doc

... and E sq/rd . Previous characterization of the reactivity of this E30 1A FNR mutant in complex formation and ET to its substrates had already indicated that the lack of its semiquinone stabilization was the cause ... Stankovich 2 and Milagros Medina 1 1 Departamento de Bioquı ´ mica y Biologı ´ a Molecular y Celular, Facultad de Ciencias, Universidad de Zaragoza, Spain; 2 Depar...

Ngày tải lên: 08/03/2014, 23:20

6 437 0
Báo cáo Y học: Oxidation of propionate to pyruvate in Escherichia coli Involvement of methylcitrate dehydratase and aconitase pot

Báo cáo Y học: Oxidation of propionate to pyruvate in Escherichia coli Involvement of methylcitrate dehydratase and aconitase pot

... primer Acs 5¢- TAATACGACTCACTATAGGGA*5¢-AACACACCATTCCTGCCAAC-3¢ CCACCACAGGTCGCGCC-3¢ AcnB 5¢- TAATACGACTCACTATAGGGA*5¢-CTCACACGCTGCTGATGTTC-3¢ CGTGGTTACGCACTTCACC-3¢ PrpD 5¢- TAATACGACTCACTATAGGGA*5¢-AACATCGGCGCGATGATCC-3¢ TCGCTGCTTCAACTGCCG-3 PrpE ... threo-2-methylisocitrate and erythro-2-methylisoci- trate, trans-aconitate, D -malate and L -malate, fumarate, maleate, D -tartrate and meso-t...

Ngày tải lên: 17/03/2014, 10:20

11 615 0
Báo cáo Y học: Regulation of peptide-chain elongation in mammalian cells pptx

Báo cáo Y học: Regulation of peptide-chain elongation in mammalian cells pptx

... The available evidence suggests that phosphorylation of eEF 1A/ B and of valyl- tRNA synthetase by PKC increases their activities in translation elongation and amino acylation, respectively. The increased ... activity of eEF2 kinase from ventricular myocytes, suggesting that these cells may contain a distinct isoform of eEF2 kinase, as mentioned above. In heart cells, increasing...

Ngày tải lên: 23/03/2014, 21:20

9 469 0
Báo cáo Y học: Expression of uncoupling protein-3 in subsarcolemmal and intermyofibrillar mitochondria of various mouse muscle types and its modulation by fasting docx

Báo cáo Y học: Expression of uncoupling protein-3 in subsarcolemmal and intermyofibrillar mitochondria of various mouse muscle types and its modulation by fasting docx

... or human UCP3. Figure 2A shows that the UCP3 signal of human recombinant protein interacting with the antibody to human UCP3 increases linearly as a function of increasing amounts of the protein ... chemiluminescence using a standard ECL kit and developed Hyperfilm ECL film. They were quantified by scanning photodensitometry using ImageQuant Software 3.3 (Molecular Dynamics, Sunnyvale...

Ngày tải lên: 24/03/2014, 04:21

7 535 0
Báo cáo Y học: Inhibition of glycosyl-phosphatidylinositol biosynthesis in Plasmodium falciparum by C-2 substituted mannose analogues pot

Báo cáo Y học: Inhibition of glycosyl-phosphatidylinositol biosynthesis in Plasmodium falciparum by C-2 substituted mannose analogues pot

... nonmannosylated GPtdIns glucosamine-phosphatidylinositol (GlcN–PtdIns) and glu- cosamine-acylphosphatidylinositol (GlcN-acyl–PtdIns) (Fig. 2). These data imply that mannosamine was incorporated into ... nor nonmannosylated intermediates accumulated in the pre- sence of mannosamine. The absence of new mannosamine- containing GPtdIns and the inhibition of incorporation of tritiated gl...

Ngày tải lên: 31/03/2014, 23:20

8 334 0
w