... primers:AACTTCAAACAGTTTGAGCAG for EF -A- mutation,GACTTTCAACAGTTTCTCAAC for EF-B-mutation, GATTACACACAGTTCGAGGCA for EF-C-mutation, AATTTCCAGCAGTTCATGAAC for EF-D-mutation. The under-lined ... K1con-centration, 80– 90% of the change in the a helix contentwas attained by binding of two Ca21. Interestingly, in themutants which have only three Ca21-binding sites, thebinding of two Ca21was ... in an EF-hand in calmodulin[18] and actually the number is different in each EF-hand in Correspondence to S. Kawamura, Department of Biology, GraduateSchool of Science, Osaka University, Machikane-yama...