Performance of Jatropha curcas: A biofuel crop in wasteland of Madhya Pradesh, India
Performance of Jatropha curcas: A biofuel crop in wasteland of Madhya Pradesh, India
Ngày tải lên: 05/09/2013, 16:11
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
Ngày tải lên: 25/10/2012, 11:00
A study of the english translational versions of tring cong son's songs in terms of semantic and syntactic features
... translate a language into another language effectively and transfer the specific messages into the target is always a very difficult task. Especially, translating literary works is one of ... a text into another language in the way that the author intended the text. The purpose of translation is that the audience in the TL feel and reacts in the same ways as the audience...
Ngày tải lên: 26/11/2013, 13:23
A contrastive analysis of encouraging as a speech act in english and vietnamese
... concerns of discourse studies across languages is that of setting up comparable units of analysis within the various languages being studied. Thomas, J. (1995), “Meaning in interaction: An introduction ... speakers of English and native speakers of Vietnamese for encouraging as a speech act. - To suggest solutions for the English teaching and learning of encouraging i...
Ngày tải lên: 26/11/2013, 13:31
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... 4919 Proteomic analysis of dopamine and a- synuclein interplay in a cellular model of Parkinson’s disease pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia ... kinase, 60S acidic ribosomal protein P2 (RPLP2), eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄L12, annexin A2 , annexin A5 , aldolase A, fascin 1 and perox...
Ngày tải lên: 15/02/2014, 01:20
Th e Care of Brute Beasts A Social and Cultural Study of Veterinary Medicine in Early Modern England pot
... providing a warm, dry place to sleep and appropriate foodstu s for the season. However, a great deal of in- depth information was available in a range of printed literature on diet, as well as ... marketplace included highly trained members of the Company of Farriers. It will also discuss the many other types of ani- mal healers in the marketplace, many of whom appe...
Ngày tải lên: 06/03/2014, 16:20
Gradual phase and morphology transformation of Fe3O4nanoparticles to a - FeOOH nanorods in alcohol/water mediain the presence of surfactant F127
... well. The magnetism of the samples prepared in pure water and in alcohol/water media is also investigated, as shown in Fig. 3. The value of saturation magnetization of samples a, b, and c is 75.4 ... starting material in the production of a- Fe 2 O 3 (hematite) and c-Fe 2 O 3 (maghemite). Acicular a- FeOOH particles are used in the production of maghemite and in vario...
Ngày tải lên: 19/03/2014, 16:48
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, distinguished by different migration in a 1% agarose ... from hippocampus, amygdala and cerebral cortex of human adult brain, and on cDNA from human fetal brain. Cb was barely detectable in fetal brain (Fig. 3B, lane 1) A. C. V. Larsen et al....
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... Zymed, San Francisco, CA, USA) added and the plate incubated for 20 min. The plate was washed and 100 lL of tetramethylbenzidine substrate containing 0.01% H 2 O 2 (Kirkegaard and Perry, Gaithersburgh, ... TNF -a. The level of U 1A mRNA was similar in all samples as shown in Fig. 4A. This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription...
Ngày tải lên: 31/03/2014, 01:20
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R) 12 reverse CAAGGAGCGTTAGAATCTAAAG H1R 13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R) 14 reverse GATTTAAGTGGAGCGGAATGCTA ... reverse ACGAAACCTGGCAGAGTCCAAG B6R 5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R 3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R 7 both forward CAGAAAAAGACAAGGAGGAC F19R Isoform-specific ... &...
Ngày tải lên: 19/02/2014, 02:20