a learned society in a period of transition

Focus - A simplicity manifesto in the Age of Distraction

Focus - A simplicity manifesto in the Age of Distraction

... closely, and constantly read updates of news sites. Being connected all the time, being part of this constant stream of distraction, is an expectation that society now has of us. And going against ... the expectation of society that I’d be available via email and at least make the attempt to reply. Interesting, because just a decade earlier, many people didn’t use email and no one cared if ... later. Checking email, or any similar online activity, has that addictive quality of instant positive feedback and delayed negative feedback. You check your email and hey! A new email from a...

Ngày tải lên: 05/01/2014, 15:25

121 553 1
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... kinase, 60S acidic ribosomal protein P2 (RPLP2), eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄L12, annexin A2 , annexin A5 , aldolase A, fascin 1 and peroxyredoxin 1] displayed quantitative ... pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna Tosi 3 , Leonardo Lopiano 4 and Mauro Fasano 1 1 Department of Structural and ... alterations associated with the interplay of cytosolic dopamine and increased a- synuc- lein are still unclear. Catecholaminergic SH-SY5Y human neuroblastoma cells are a suitable model for investigating dopamine...

Ngày tải lên: 15/02/2014, 01:20

11 776 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... in cold adaptation of an alkaline phosphatase Konstantinos Mavromatis 1, *, Iason Tsigos 2, *, Maria Tzanodaskalaki 2 , Michael Kokkinidis 1,3 and Vassilis Bouriotis 1,2 1 Department of Biology, ... group of Ala261 side-chain could produce steric clashes with the aromatic ring of Tyr269, and these unfavorable interactions could lead to a decrease of local flexibility and an increased E a value. The ... mutant alkaline phosphatases. (A) Temperature dependence of k cat of TAB5 (d), mutants G26 1A (r), G26 1A/ Y26 9A (j)andE.coli (·) alkaline phosphatases at temperature range 5–25 °C. k cat values...

Ngày tải lên: 22/02/2014, 04:20

6 489 0
A "Y Girl in France Letters of Katherine Shortall docx

A "Y Girl in France Letters of Katherine Shortall docx

... getting some one to play the mandolin too, then organizing a Virginia reel or a square dance. It invariably takes coaxing, cajoling, insisting, to get them started, and then they get going, and ... Y.M.C .A. made use of all of us girls and gave a dance, five of us furnishing the music, I alternately playing my guitar and then using it as a drum, beating it on the back with my ring. It made ... you must, at no additional cost, fee or expense to the user, provide a copy, a means of exporting a copy, or a means of obtaining a copy upon request, of the work in its original "Plain Vanilla ASCII"...

Ngày tải lên: 08/03/2014, 00:20

29 357 0
A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Business Administration potx

A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Business Administration potx

... example, writes that "the purpose of investment is to have funds available at a later date for spending. 112 In a different passage he states : "Any earner who earns more than ... 1965. Tjalling Koopmans, "Stationary Ordinal Utility and Impatience?', Econometrica, April 1960. 3 Tjalling Koopmans, Peter Diamond, and Richard Williamson, stationary Utility and Time ... is arbi- trarily distant. The individual's resources consist of an initial capi- tal positio~ (which may be ~egative) and a noc-capital income stream which is known with certainty...

Ngày tải lên: 23/03/2014, 04:21

143 404 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

... Fragariaxananassa UGT78D1 A. thaliana UGT8 6A1 A. thaliana UGT8 7A1 A. thaliana UGT8 3A1 A. thaliana UGT8 2A1 A. thaliana UGT8 5A1 A. thaliana SbHMNGT S. bicolor UGT76D1 A. thaliana UGT76E1 A. thaliana S39507 ... thaliana OsSGT1 O. sativa UGT74F1 A. thaliana UGT74F2 A. thaliana NtGT2 N. tabacum UGT75C1 A. thaliana UGT75B1 A. thaliana UGT75D1 A. thaliana UGT84B1 A. thaliana UGT8 4A1 A. thaliana FaGT2 Fragariaxananassa UGT78D1 ... lycopersicum UGT76F1 A. thaliana CAO69089 V. vinifera UGT76B1 A. thaliana UGT76C1 A. thaliana UGT71B1 A. thaliana CaUGT1 C. roseus UGT71C1 A. thaliana UGT71D2 A. thaliana UGT8 8A1 A. thaliana UGT72E2 A. thaliana UGT72E3...

Ngày tải lên: 28/03/2014, 23:20

11 661 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

... human ACACAAAGCCACTGAA (V) TTCCGTAGAAGGTCCTTGAG (VII) Cb1, human CCCTTCTTGCCATCG (I) TTCCGTAGAAGGTCCTTGAG (VII) Cb2, human GCCGGTTATTTCATAGACAC (II) CCTAATGCCCACCAATCCA (VI) Cb3, human AAGACGTTTAGGTGCAAT ... primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, distinguished by different migration in a 1% agarose ... expressed in human and Rhesus monkey brain. Transient expression and characterization of the CbD4 variants demonstrated that they are catalytically inactive both in vitro against typical protein kinase...

Ngày tải lên: 30/03/2014, 04:20

13 344 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

... component of the cell walls of Gram-negative bacteria, is an important microbial molecular pattern that initiates in ammatory and coagulation reactions as part of the host innate immune response to infection. ... synthesis of human T lym- phocytes by selectively preventing a transmembrane signal trans- duction pathway leading to sustained activation of a protein kinase C isoenzyme, protein kinase C-beta. Eur. ... U 1A and one for TNF -a. The level of U 1A mRNA was similar in all samples as shown in Fig. 4A. This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription inhibitor....

Ngày tải lên: 31/03/2014, 01:20

7 322 0
Báo cáo " North Atlantic Treaty - a global document in a Critical Discourse Analysis " docx

Báo cáo " North Atlantic Treaty - a global document in a Critical Discourse Analysis " docx

... an international peace plan that would granted a period of autonomy for the Yugoslav province of Kosovo”. In Afghanistan, American and British forces “began aerial bombing of al-Qaeda camps ... Parties agree that an armed attack against one or more of them in Europe or North America shall be considered an attack against them all and consequently they agree that, if such an armed attack ... stated, “shall/should” can be used in legal and quasi-legal injunction. In case of “will” in this Treaty, we think it has the same meaning and it acts as an alternative to “shall” to make...

Ngày tải lên: 28/03/2014, 11:20

10 375 0
Public management as a social science or a business subject in a   luận án tiến sỹ của tác giã nước ngoài liên quan đến đề tài về kiểm toán

Public management as a social science or a business subject in a luận án tiến sỹ của tác giã nước ngoài liên quan đến đề tài về kiểm toán

... Management teaching in South Africa to the Indian Institute of Management, Ahmabedabad, India in March 1995. 2. Presented paper on Training and education as a strategy for self-governance and autonomy ... revived in international debates such as the Commonwealth Association of Public Administration and Management (CAPAM) and the International Association of Schools and Institutes of Administration ... Education has contracted him periodically as a Programme Evaluator for graduate and post-graduate academic programmes in the following academic disciplines, namely Marketing Management, Management,...

Ngày tải lên: 02/04/2014, 00:13

25 499 0

Bạn có muốn tìm thêm với từ khóa:

w