Evaluation of Nutrient Loads from a Citrus Orchard in Japan
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... by DAS 1.0 (Anhui, China) program. Bioavailability (BA) is a measurement of the rate and extent of a therapeutically active drug that reaches the systemic circulation and is available at the ... buered formalin, embedded in paraf- n, sectioned, and stained with hematoxylin and eosin (H&E). In vivo pharmacokinetics and bioavailability In vivo pharmacokinetic study was conducted ... is the area under the curve. Statistical analysis All data are presented as a mean value with its stand- ard deviation indicated (mean ± SD). Statistical analysis was conducted using the...
- 7
- 391
- 0
Tài liệu EFFECTS OF AIR POLLUTION FROM A NICKEL-COPPER INDUSTRIAL COMPLEX ON BOREAL FOREST VEGETATION IN THE JOINT RUSSIAN-NORWEGIAN-FINNISH BORDER AREA ppt
... impact.Statistical analysis of ground vegetation and environmental variablesThe variation in species composition in the total dataset of 212 quadrates was analysed with indi-rect gradient analysis ... et al. 1998). The Barents Sea creates a climatic gradient with a coastal climate in the north, and an increas-ingly continental climate on moving towards the south. The annual mean temperature ... reported in the same area by Tømmervik et al. (1998, 2003), Chernenkova and Kuperman (1999), Aarrestad and Aamlid (1999) and Aamlid et al. (2000) as an effect of air pollution from Nikel and Zapolyarnyy.The...
- 18
- 640
- 0
Tài liệu Báo cáo khoa học: Properties of ecdysteroid receptors from diverse insect species in a heterologous cell culture system – a basis for screening novel insecticidal candidates docx
... dibenzoylhydrazines onlarvicidal activity against the Colorado potato beetleLeptinotarsa decemlineata. Pest Manag Sci 57, 858–865.36 Nakagawa Y, Minakuchi C, Takahashi K & Ueno T(2002) Inhibition of [3H] ... S1. Amino acid alignment of linker region andligand-binding domain (LBD) of ecdysone receptors.Fig. S2. Amino acid alignment of linker region andligand-binding domain (LBD) of ultraspiracle ... showing bothinductive and potentiative activity.ResultsThe DNA-binding domains (DBDs) of Leptinotarsaand Drosophila EcR and USP are identical at everyamino acid position that is conserved among...
- 12
- 627
- 0
Tài liệu 13 Days The Chronicle of an Escape from a German Prison doc
... of a later dateto that of the first day of the unlimited submarine campaign arrived in the camp. This did not look a all like a complete blockade of England!After careful thought a satisfactory ... interest, being watched by a smallcrowd of the prison inhabitants every day.Quite a number of canaries, a dog or two and a cat, were also in the camp, and would have to be taken awayby their ... that five or six officers were missing at the final roll-call, another nominal roll-call wasordered that evening in order to ascertain the names of those who were missing. The Crab was in charge...
- 71
- 446
- 0
Báo cáo khoa học: Role of active-site residues of dispersin B, a biofilm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx
... ForwardCCACAGAATAACCAAATTGATCGCCACC ReverseY18 7A GATGAATTTGGTGCGTCTGTGGAAAG ForwardCTTTCCACAGACGCACCAAATTCATC ReverseW23 7A CCGAATATTGAAATTACTTATGCGAGCTATGATGGCG ForwardCGCCATCATAGCTCGCATAAGTAATTTCAATATTCGG ... ForwardCGCCATCATAGCTCGCATAAGTAATTTCAATATTCGG ReverseY27 8A CCTATTATCTTGCGATTGTTCCGAAAGC ForwardGCTTTCGGAACAATCGCAAGATAATAGG ReverseW330Y GCAGCATTATCGATCTACGGAGAAGATGC ForwardGCATCTTCTCCGTAGATCGATAATGCTGC ReverseE332Q ... GCTGGACATCGCCAAACATTTTTATTCACCCG ForwardCGGGTGAATAAAAATGTTTGGCGATGTCCAGC ReverseD183N GGTGGCAACGAATTTGGTTATTCTGTGG ForwardCCACAGAATAACCAAATTCGTTGCCACC ReverseE184Q GGTGGCGATCAATTTGGTTATTCTGTGG ForwardCCACAGAATAACCAAATTGATCGCCACC...
- 13
- 311
- 0
Báo cáo khoa học: "Large-Scale Induction and Evaluation of Lexical Resources from the Penn-II Treebank" potx
... prepositional details are included.5.2 Lexical Accession RatesAs well as evaluating the quality of our extractedsemantic forms, we also examine the rate at whichthey are induced. (Charniak, 1996) and ... system of (Briscoe and Carroll, 1997)distinguishes 163 verbal subcategorisation classesby means of a statistical shallow parser, a classifier of subcategorisation classes, and a priori estimates of ... is a partic-ularly important issue. In this paper we present anapproach to automating subcategorisation frame ac-quisition for LFG (Kaplan and Bresnan, 1982) i.e.grammatical function-based...
- 8
- 405
- 0
Từ khóa: how to remove sound from a video clip in windows live movie makeras root launch admintool from a terminal window in a cde environment if the utility is nota quantitative evaluation of linguistic testsa framework for the evaluation of texta qualitative evaluation of association measures for collocationwriting a letter of resignation from a boardchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM