Development and Aging of the Endocrine System

... and on the tension-time index [33] The tension-time index describes the relationship between force of contraction (Pdi/Pdimax) and duration of contraction (ratio of inspiratory time to total respiratory ... with aging [49] Reduction in supporting tissues around the airways further increases the tendency for the small airways (

Ngày tải lên: 05/03/2014, 21:20

... values analysis, item and subscales correlations and internal reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international ... adequate to generate reliable cross-cultural measures In conclusion, the Brazilian version of the AAQ instrument is a reliable, valid and consistent tool to as...

Ngày tải lên: 18/06/2014, 22:20

... values analysis, item and subscales correlations and internal reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international ... adequate to generate reliable cross-cultural measures In conclusion, the Brazilian version of the AAQ instrument is a reliable, valid and consistent tool to as...

Ngày tải lên: 20/06/2014, 16:20

... endocannabinoid system, we investigated the presence and regulation of endocannabinoids, cannabinoid receptors and FAAH in immature and mature dendritic cells obtained by stimulation with either the ... min), two fractions were obtained: a top leukocyte band containing mononuclear cells (monocytes and lymphocytes) and a lower band containing polymorphonuclear le...

Ngày tải lên: 22/02/2014, 07:20

... Microfinance Legislation in Uganda and Ethiopia 1a: Micro Deposit-taking Institutions in Uganda The push for a special regulatory niche for microfinance institutions in Uganda came in part from the ... 5.1: Assets of Depository Financial Institutions, 2001 (¢ million) 36 Review of Rural and Micro Finance Regulation in Ghana: Implications for Developm...

Ngày tải lên: 22/03/2014, 21:20

... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was and lg for placenta (lanes and 2, respectively) and 20 lg for the skin samples Side-chain cleavage of 7-DHC by placental and adrenal mitochondria Incubations were carried o...

Ngày tải lên: 23/03/2014, 13:20

... Conclusion The development and validation of the Treatment Related Impact Measure- Weight (TRIM -Weight) has been conducted according to well-defined scientific principles for the creation of a PRO measure ... debriefed version of the TRIM -Weight was incorporated into an online validation study to assess the measurement and psychometric properties of...

Ngày tải lên: 18/06/2014, 19:20

... Here 54% of the insulin- treated agreed that insulin causes weight gain, compared to 23 % in the insulin naïve The highest mean score for insulin- naïve patients was on the item pertaining to the belief ... be demanding to administer 11 Insulin means I have to give up activities I enjoy 12 Insulin means my health will deteriorate 13 Injecting insulin is embarrass...

Ngày tải lên: 18/06/2014, 22:20

... been a dearth of studies to quantitatively assess either the well-being of parents of children with type diabetes or their satisfaction with their child's diabetes regimen The paucity of information ... as of their families [3] http://www.hqlo.com/content/6/1/3 new measure: the WEll-being and Satisfaction of CAREgivers of Children with Diabetes...

Ngày tải lên: 18/06/2014, 22:20

... Development and validation of the Impact of Dry Eye on Everyday Life (IDEEL) questionnaire, a patient-reported outcomes (PRO) measure for the assessment of the burden of dry eye on patients ... Dry Eye SymptomBother, Dry Eye Impact on Daily Life, and Dry Eye Treatment Satisfaction, that allow a comprehensive ev...

Ngày tải lên: 20/06/2014, 15:20

... Here 54% of the insulin- treated agreed that insulin causes weight gain, compared to 23 % in the insulin naïve The highest mean score for insulin- naïve patients was on the item pertaining to the belief ... be demanding to administer 11 Insulin means I have to give up activities I enjoy 12 Insulin means my health will deteriorate 13 Injecting insulin is embarrass...

Ngày tải lên: 20/06/2014, 16:20

... been a dearth of studies to quantitatively assess either the well-being of parents of children with type diabetes or their satisfaction with their child's diabetes regimen The paucity of information ... as of their families [3] http://www.hqlo.com/content/6/1/3 new measure: the WEll-being and Satisfaction of CAREgivers of Children with Diabetes...

Ngày tải lên: 20/06/2014, 16:20

... measures of pain and the impact of endometriosis symptoms (i.e., the mBPI-SF pain intensity score and the EHP-30 pain subscale) and less correlated with the clinician-administered B&B Symptom Scale The ... 10.1186/1477-7525-8-64 Cite this article as: Deal et al., The development and validation of the daily electronic Endometriosis Pain and Bl...

Ngày tải lên: 20/06/2014, 16:20