6. BAO CAO HDQT.pdf 6. BAO CAO HDQT

... in further studies Collectively, our studies demonstrate that miR-23a potently promotes the growth of the gastric adenocarcinoma cell line MGC803, providing the first proofof-concept that there ... L.-H Zhu et al miR-23a promotes gastric cancer growth promote the growth of gastric adenocarcinoma cell line MGC803 by targeting directly the interleuki...

Ngày tải lên: 18/02/2014, 04:20

... protein crystallography Acta Crystallogr D Biol Crystallogr 50, 760–763 Navaza J (1994) Amore – an automated package for molecular replacement Acta Crystallogr A 50, 157–163 Jones TA, Zou JY, Cowan ... the accessible surface area of a monomer contributes to LlPDH dimer formation Whereas LlPDH and OaPDH have a ˚ buried surface area of  5500 A2 , TbPDH has a larger ˚ interface s...

Ngày tải lên: 19/02/2014, 05:20

... SD Bax- a5 Buffer 20% TFE 60 % TFE 0 .5 mM SDS mM SDS 23 62 61 63 61 5 15 26 27 19 25 2 3 10 0 1 0 0 1 1 19 4 1 26 11 13 10 6 Bax- a6 Buffer 20% TFE 60 % TFE 0 .5 mM SDS mM SDS 13 27 40 33 42 4 10 15 ... of Fig 5, we can estimate the upper limit for the radius of pores made by Bax- a5 and Bax- a6 in PtdCho LUVs to be 5. 8 nm, corresponding to the hydrody...

Ngày tải lên: 19/02/2014, 07:20

... cyclin D1 gene promoter We studied the mechanism(s) underlying the inhibition of cyclin D1 gene expression by EPA and DHA by examining the effects of n-3 and n-6 PUFAs incorporation on cyclin D1 promoter ... control of SMC proliferation 4466 S Bousserouel et al (Eur J Biochem 271) Modulation of cyclin D1 synthesis and hyperphosphorylation of Rb...

Ngày tải lên: 19/02/2014, 16:20

... feature of isoforms of the bifunctional enzyme from plants [11,12,14], suggesting that such proteolysis may be a widespread problem The sensitivity of the plant bifunctional enzyme to degradation by ... the bifunctional enzyme from other eukaryotes, regions flanking the catalytic domains have a profound influence on the kinetic properties of the enzyme For example, removal...

Ngày tải lên: 22/02/2014, 04:20

... phần hoá học nó, nhiệt độ áp suất Trong này, xác định độ nhớt động học II Định nghĩa Độ nhớt động học kí hiệu υ số đo lực cản chảy chất lỏng tác dụng trọng lực Trong hệ CGS, độ nhớt động chọ ... Tính kết độ nhớt động học υ=Cxt υ = 0,0182 x 415,7 = 7,56574 cSt Nhận xét: VIII Trả lời câu hỏi: Nếu nhớt kế chưa biết hệ số nhớt kế, nêu cách xác định? Dù...

Ngày tải lên: 11/03/2014, 10:20

Ngày tải lên: 12/03/2014, 07:20

... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTAT...

Ngày tải lên: 14/03/2014, 23:20

... study of the regulation of the Muc5b promoter by TTF-1 and GATA factors Using this approach, we aimed to show the transcriptional regulation of Muc5b by these two transcription factors, thereby providing ... these factors in both the human [29] and murine (this report) MUC5B mucin genes, a restricted pattern of MUC5B expression in the respiratory tract [5]...

Ngày tải lên: 15/03/2014, 00:20

... glucokinase and hexokinase I in distinct pools [3,24], or by the involvement of mechanisms, additional to Glc6P, in mediating the effects of glucokinase overexpression As glucokinase binds to a dual-specificity ... [5,7] Conditions that cause dissociation of glucokinase from GKRP are associated with a parallel increase in the cell content of Glc6P, confirming...

Ngày tải lên: 16/03/2014, 14:20

Ngày tải lên: 20/03/2014, 17:21

... proteins in the purified DNA Fig Effect of heliquinomycin on DNA helicase activity (A) Top: effects of increasing concentrations of heliquinomycin (HQ) on the DNA helicase activities of the MCM4/6/7 ... (4/6/7) 440 kDa Fig Effect of increasing concentrations of heliquinomycin (HQ) on the formation of the MCM4/6/7 complex The MCM4/6/7 complex was...

Ngày tải lên: 23/03/2014, 04:21

... Fig Structural comparisons of the funnels of LGOX, LAAO, and PAO, and the residues composing two entrances of the funnel of LGOX (A) Stereo view of funnels of LAAO, PAO, and LGOX The surfaces of ... quantitative assay of l-glutamate is important in the fields of food production and clinical biochemistry Actually, l-glutamate oxidase (LGOX; EC 1.4.3.11) was first purifie...

Ngày tải lên: 23/03/2014, 05:22

... ActR -I and ActR-II are faster (kon > 105ÆM)1Æs)1, koff > 10)1Æs)1), impeding the analysis of the dissociation rate and thus requiring analysis of the equilibrium binding ActR -I, is inactive in ... interaction analysis yields the : interaction of BMPs and their receptor ectodomain proteins NB, no binding within detection limit (upper limit: KD > 400 lM) Ligands [affinit...

Ngày tải lên: 23/03/2014, 07:20

... ngun ca cụng ty n v :triu ng Ch tiờu Nm 2003 Nm 2004 Nm 2005 Nm 20 06 T % T % T % T % Vn lu ng 35011,5 37,18 37241,5 37,95 4 160 7 38,8 61 018 40 ,65 Vn c nh 59 164 62 ,82 60 879 62 ,05 65 639,7 61 ,2 89088 ... 2005/2004 T % 20 06/ 2005 T % 21407 16, 69 21453 14,27 23 46 24,78 1550 13 ,64 91 26, 2 9,3 42859,3 39, 96 Hiu sut s 1,05 dng 1,3 1,4 1,2 0,1 7 ,6 - 0,2 -14,29 0, 96 0,77...

Ngày tải lên: 23/03/2014, 15:20