Lactate Dehydrogenase as a Biomarker for Prediction of Refractory Mycoplasma pneumoniae Pneumonia

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

... defined as physiological substrates for each protein kinase Specifically, protein phosphatase inhibitor-1 was used in the PKA, MAPK, Cdk1 and Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation ... migrating bands are Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation target (Eur J Biochem 271) 3551 Fig Phosphorylation of recombina...

Ngày tải lên: 16/03/2014, 18:20

9 497 0
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

... GTPcS-loaded Rac2, MgSO4 and an optimal amount of arachidonic acid determined for each assay of oxidase activation [12] The rate of O2– production by the activated NADPH oxidase was calculated from the ... elicited NADPH oxidase activity (A) Effect of varying the molar ratio of p67phox to p47phox and Rac2 in the absence of S10 0A8 /A9 on the elicited...

Ngày tải lên: 18/03/2014, 01:20

10 396 0
Báo cáo khoa học: "A PROLOG IMPLEMENTATION OF LEXICAL LANGUAGE FUNCTIONAL PROCESSING GRAMMAR SYSTEM AS A BASE FOR A NATURAL" pdf

Báo cáo khoa học: "A PROLOG IMPLEMENTATION OF LEXICAL LANGUAGE FUNCTIONAL PROCESSING GRAMMAR SYSTEM AS A BASE FOR A NATURAL" pdf

... relations of a sentence But what about the logical relations? Recall that each clause has a unique head end that the functional features of each phrase are identified with those of its head For ... property that the functional features of each phrase are identified with those of its head The head category of a phrase is characterized by d~e assignment of the trivial...

Ngày tải lên: 24/03/2014, 05:21

6 476 0
Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx

Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx

... ratings of motion sickness as often as possible, it is always a trade-off between asking many or few questions to obtain a valid measurement of the perceived state The NoFix slope increased as Mal ... were asked to rest comfortably on board the platform in front of a blank screen The first half of these five minutes served as familiarization phase, whereas the last 2...

Ngày tải lên: 19/06/2014, 08:20

9 610 0
báo cáo hóa học: " Chitotriosidase as a biomarker of cerebral adrenoleukodystrophy" doc

báo cáo hóa học: " Chitotriosidase as a biomarker of cerebral adrenoleukodystrophy" doc

... duplication, chitotriosidase testing was performed, and in all cases no activity was measurable Each of these cases was excluded from further analysis Therefore, chitotriosidase activity could be assayed ... these patients had active disease at the time samples were collected Of the 42 CALD patients studied, in one case a plasma sample was not obtained, and in another and no spinal...

Ngày tải lên: 19/06/2014, 22:20

9 211 0
báo cáo hóa học: " Elimination kinetics of diisocyanates after specific inhalative challenges in humans: mass spectrometry analysis, as a basis for biomonitoring strategies" doc

báo cáo hóa học: " Elimination kinetics of diisocyanates after specific inhalative challenges in humans: mass spectrometry analysis, as a basis for biomonitoring strategies" doc

... this article as: Budnik et al.: Elimination kinetics of diisocyanates after specific inhalative challenges in humans: mass spectrometry analysis, as a basis for biomonitoring strategies Journal of ... median diamine values (expressed as μg/g creatinine) with standard deviations for the patient samples detected with mass spectrometry (analysed aga...

Ngày tải lên: 20/06/2014, 00:20

8 433 0
báo cáo hóa học:" Research Article A Reinforcement Learning Based Framework for Prediction of Near Likely Nodes in Data-Centric Mobile Wireless Networks" pdf

báo cáo hóa học:" Research Article A Reinforcement Learning Based Framework for Prediction of Near Likely Nodes in Data-Centric Mobile Wireless Networks" pdf

... on-demand data transfer, runtime update of near likely nodes, and adaptive adjustment through reinforcement learning 5.1 On-Demand Data Transfer In PARIS, data transfer happens on-demand, that is, ... identified as a near likely node for more than one collector nodes In PARIS, the near likely node is stateless, whereas the collector nodes keep a data track tabl...

Ngày tải lên: 21/06/2014, 18:20

17 362 0
A Development of Novel Integral Method for Prediction of Distorted Inlet Flow Propagation_2 docx

A Development of Novel Integral Method for Prediction of Distorted Inlet Flow Propagation_2 docx

... rise of compressor are investigated to study the effects of inlet parameters on the compressor performance and characteristics Figure 4.16 indicates that a smaller inlet flow angle causes a higher ... vertical distorted velocity coefficient propagates along axial direction at higher inlet incident angles, θ ≥ 25° In Fig 4.6, smaller inlet incident angle induces a larger...

Ngày tải lên: 21/06/2014, 21:20

10 240 0
Báo cáo lâm nghiệp: "old hardiness as a factor for assessing the potential distribution of the Japanese pine sawyer Monochamus alternatus (Coleoptera: Cerambycidae) in China" pdf

Báo cáo lâm nghiệp: "old hardiness as a factor for assessing the potential distribution of the Japanese pine sawyer Monochamus alternatus (Coleoptera: Cerambycidae) in China" pdf

... determining the geographical range of the beetle Meteorological data showed that local minimum temperature generally decreased with increasing latitude in eastern China (Climatic Atlas of the People’s ... a basis for predicting its potential distribution and dispersal, based on its cold hardiness, and to further evaluate the risks of transmission of the pine wil...

Ngày tải lên: 07/08/2014, 16:20

8 343 0
Báo cáo khoa học: " Application of ventriculoperitoneal shunt as a treatment for hydrocephalus in a dog with syringomyelia and Chiari I malformation" pptx

Báo cáo khoa học: " Application of ventriculoperitoneal shunt as a treatment for hydrocephalus in a dog with syringomyelia and Chiari I malformation" pptx

... etubirtnoc ton did aileymognirys dna noitamroflam I iraihC taht dna sulahapecordyh fo tluser a ylniam saw aixata eht taht tseggus nac ew ,suhT deniamer llits aileymognirys dna noitamroflam I iraihC ... yllanoitidart neeb sah taht nigiro niatrecnu na fo redrosid a si noitamroflam I iraihC )2 giF( aileymognirys dna noitamroflam I iraihC osla tub ,selcirtnev laretal eht fo noitatalid...

Ngày tải lên: 07/08/2014, 18:21

4 384 0
Báo cáo khoa học: "Near infrared analysis as a tool for rapid screening of some major wood characteristics in a eucalyptus breeding program" ppsx

Báo cáo khoa học: "Near infrared analysis as a tool for rapid screening of some major wood characteristics in a eucalyptus breeding program" ppsx

... screening A value of above 3.0 is regarded as satisfactory for screening (for example in plant breeding) , values of and upward are suitable for quality control analysis, and values of above are ... composition of lignin, shrinkage or the extent of longitudinal growth stress This paper evaluates the potential of NIRS for the assessment of some major chemic...

Ngày tải lên: 08/08/2014, 14:20

12 316 0
Báo cáo khoa học: "An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different branching intensities" ppt

Báo cáo khoa học: "An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different branching intensities" ppt

... clones of oak it was necessary to allow for shoot length which was very variable and has a close relation- decapitation ship with numbers of buds and branches (Ward, 1964; Harmer, 198 9a; 199 2a) Similar ... active was assessed at 8-d intervals — — — At the end of the first period of growth the number of lateral branches on the original shoot was counted be...

Ngày tải lên: 08/08/2014, 19:21

14 240 0
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

... 5'-AGC CGG AAG GTT ATT GTG GTA GT-3' mTLR4 lower 5'-TGC CGT TTC TTG TTC TTC CTC T- 3' mTLR6 upper 5'-ATA CCA CCG TTC TCC ATT T- 3' mTLR6 lower 5'-GAC GTG CTC TAT CAT CAG TG-3' FACS sorting, by using ... inflamed joint activated and memory T cells can pass endothelial barriers TLR ligands can activate T cells independent of antigenic specificity release of inflammatory cytoki...

Ngày tải lên: 09/08/2014, 01:23

14 506 0
w