... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may...
Ngày tải lên: 19/02/2014, 17:20
... Parallel changes in developmental divergence and conservation along branches leading to evolutionarily derived life histories can provide a deeper understanding of the role that adaptation has ... pooled larval/pupal, and adult), sequence data from five species in the melanogaster subgroup, and thousands of randomly selected genes to examine how selective constraint changes as...
Ngày tải lên: 06/08/2014, 19:20
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... increase the competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand ... qualities, brand loyalty, brand awareness, brand association and other propriety assets According to him, Brand loyalty has to with the level of...
Ngày tải lên: 24/09/2012, 17:19
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... Acta Veterinaria Scandinavica 2009, 51:36 Background Files with information on animal disease have a variety of applications at both the herd and national level, including monitoring the incidence ... the aim was to reveal perceptions and reasoning behind generation of data and to describe the interaction and relations between the recording of metritis scores and...
Ngày tải lên: 25/10/2012, 10:45
Situation of recruitment of TOTO Vietnam Co., Ltd; recommendations to improve the quality of recruitment.doc
... Recommendations to improve the quality of recruitment of TOTO Vietnam Co., Ltd Nguyen Thi Thu B - FBE - C47 CHAPTER I: OVERVIEW OF TOTO CO., LTD AND TOTO VIETNAM CO., LTD 1.1 Introduction to TOTO Co., ... Ltd; Nanjing TOTO Co., Ltd In USA: TOTO U.S.A., Inc; TOTO Kiki U.S.A., Inc In Hong Kong: TOTO Kiki (H.K.) Ltd In Viet Nam: TOTO Vietna...
Ngày tải lên: 27/10/2012, 16:51
DEVELOPING, USING AND ANALYZING THE RESULTS OF INTERVIEWS TO DETERMINE THE FEELINGS OF FOREIGN TOURISTS ON THEIR VISIT TO VIET NAM
... Most of them seemed too closed, to be friendly and warmhearted, and welcome us They told us everything they did in Vietnam and they thought about Vietnam in their travels Therefore, they helped ... in Vietnam? What is your opinion about the services you has used in Vietnam? The quality of tour guide in Vietnam is: Your search information about Vietnam by: Do you often use a...
Ngày tải lên: 25/04/2013, 15:42
Indoor tests to investigate the effect of brine depth on the performance of solar still
... and brine depth) The objective of this work is to investigate the effect of brine depth on the productivity and efficiency of solar still under laboratory conditions Table shows a summary of some ... summary of some of the studies cited in the literature that examined the effect of brine depth on productivity It can be seen from the table...
Ngày tải lên: 05/09/2013, 16:10
A computational study to investigate the effects of insulation and EGR in a diesel engine
... of insulation of an IDI diesel engine The indicated power increased at the adiabatic case 30% and 22.5% in part and full loads respectively Although in the EGR applying case, performance characteristics ... also worked as a Professor and Head of department in the Department of Mechanical Engineering, Vidya Vikas Institute of Technology, Andhra Pradesh,...
Ngày tải lên: 05/09/2013, 16:11
Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english a comparison
... groups of participants: Vietnamese learners of English and native speakers of English For the Vietnamese group, we contacted most of the Vietnamese participants in person and some via e-mail to ask ... (Journal of Japanese Language Teaching), 87, 25 - 39 Lauper, J A (1997) Refusal strategies of native English speakers in Spanish and in English...
Ngày tải lên: 07/09/2013, 13:31
Tài liệu 03) Avoid using ''''s to form the possesive of pdf
... Avoid using 's to form the possesive of a noun that does not name a person Instead of: Your foot’s bottom is soft and vulnerable to infections, cuts, and bruises Write: The bottom of your ... foot is soft and vulnerable to infections, cuts, and bruises About author Hans Anderson 2007-Present: Lecturer at FPT Greenwich Programmes, FPT University 2007: M.S., Computat...
Ngày tải lên: 13/12/2013, 10:15
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... not the amount of relationships since firms have the help of sophisticated information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure ... HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE ABSTRACT CRM strategy (Customer Relationship Management) is a business phil...
Ngày tải lên: 20/12/2013, 17:15
Tài liệu The Go Big Now Guide - 5 Steps to Make the Law of Attraction Key Work for You docx
... The Go Big Now Guide - Steps to Make the Law of Attraction Key Work for YOU © Kristen Howe 2009 The Go Big Now Guide Steps to Make the Law of Attraction Key Work for YOU! Discover the Steps of ... http://www.gobigcoach.com/gobignow The Go Big Now Guide - Steps to Make the Law of Attraction Ke...
Ngày tải lên: 24/12/2013, 13:15
Tài liệu Laser-Optimized Fiber: Built for Price, Bandwidth, and Distance to Make the Most of Your Investment doc
... 10 Gbps 850 nm Laser Laser-Optimized Fiber: Built for Price, Bandwidth, and Distance to Make the Most of Your Investment Unfortunately, the use of VCSELs can cause differential mode ... to travel at similar speeds thus increasing Page Laser-Optimized Fiber: Built for Price, Bandwidth, and Distance to Make the Most of Your Inve...
Ngày tải lên: 24/01/2014, 11:20