Development of a facebook addiction scale

Consumer perceived value The development of a multiple item scale

Consumer perceived value The development of a multiple item scale

... susceptibility of change of the four dimensions of value Notes The results of the factor analysis on the data collected in the first stage are available on request from the authors Appendix A partial-disaggregation ... reliabilities appear on the diagonal Reliability of linear composite of scale (19 items) ϭ 0.96 The reliabilities of the factors and the...

Ngày tải lên: 24/09/2016, 18:06

18 547 0
báo cáo hóa học: " Development of a proxy-reported pulmonary outcome scale for preterm infants with bronchopulmonary dysplasia" ppt

báo cáo hóa học: " Development of a proxy-reported pulmonary outcome scale for preterm infants with bronchopulmonary dysplasia" ppt

... BR, Jobe AH, Wright LL, Fanaroff AA, Wrage LA, Poole K, National Institutes of Child Health and Human Development Neonatal Research Network: Validation of the National Institutes of Health consensus ... outcome scale for preterm infants with bronchopulmonary dysplasia Health and Quality of Life Outcomes 2011 9:55 Submit your next manuscript to BioMed Central and take f...

Ngày tải lên: 20/06/2014, 15:20

11 490 0
báo cáo hóa học:" The positive mental health instrument: development and validation of a culturally relevant scale in a multi-ethnic asian population" pdf

báo cáo hóa học:" The positive mental health instrument: development and validation of a culturally relevant scale in a multi-ethnic asian population" pdf

... Institute of Mental Health and the Domain Specific Review Board of the National Healthcare Group, Singapore Ethical approval covered all aspects of the study including design, sample size and selection, ... all components of PMH scale would have negative correlation with the GAD-7, SDS and PHQ-8 scales All statistical significance was set at a p value of less t...

Ngày tải lên: 20/06/2014, 15:20

18 487 0
báo cáo khoa học:" Development of a patient reported outcome scale for fatigue in multiple sclerosis: The Neurological Fatigue Index (NFI-MS)" pptx

báo cáo khoa học:" Development of a patient reported outcome scale for fatigue in multiple sclerosis: The Neurological Fatigue Index (NFI-MS)" pptx

... phase of measurement, with the aim of developing a valid and reliable patient reported outcome scale for fatigue, the Neurological Fatigue Index (NFIMS) The items in the scale are based on the ... the notion that the sub-dimensions were part of a single, supraordinate theme of neurological fatigue Fit of scale data to the Rasch model also...

Ngày tải lên: 12/08/2014, 01:21

10 356 0
Development of a new steady state zerodimensional simulation model for woody biomass gasification in a full scale plant

Development of a new steady state zerodimensional simulation model for woody biomass gasification in a full scale plant

... [5] Ahmad AA, Zawawi NA, Kasim FH, Inayat A Assessing the gasification performance of biomass: a review on biomass gasification process conditions, optimization and economic evaluation Renew ... JC, Coronas A Review and analysis of biomass gasification models Renew Sustain Energy Rev 2010;14:2841–51 [8] Baruah D, Baruah DC Modelling of biomass gasification: a revie...

Ngày tải lên: 01/08/2016, 09:29

12 221 0
Development And Validation Of A Brand Trust Scale

Development And Validation Of A Brand Trust Scale

... variables affecting brand trust such as brand reputation or shared values with the brand Especially brand reputation could play an important role in a model of brand trust because it can signal ... that brand trust has considerable influence on brand loyalty explaining over half of its variance (SMS= 0.69) 27 In summary, as far as brand trust is positive related...

Ngày tải lên: 24/09/2016, 18:03

58 417 0
Development of a method to measure consumer emotions associated with foods

Development of a method to measure consumer emotions associated with foods

... Identify appropriate terms to measure emotions associated with foods maximizing information about the product Identify scaling approaches to measure emotions with consumers Develop a test protocol to ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited vi...

Ngày tải lên: 03/04/2013, 21:07

10 782 3
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... Risk Management Framework  Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Man...

Ngày tải lên: 28/10/2013, 11:15

10 584 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...

Ngày tải lên: 18/02/2014, 17:20

11 874 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

... example, Raman Spectra of Vietnam petrol extracts excited by a 30mW He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser ... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator Th...

Ngày tải lên: 05/03/2014, 14:20

6 524 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20

14 473 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Báo cáo "Development of a software package for 3D structured mesh generation " pdf

... the software package interface Fig The flowchart of the program for 3D structured elliptic mesh generation Results The software package developed has been tested and applied to the mesh generation ... input data and the output meshes The software package has been initially used as a tool for 3D structured mesh generation for simulations of compressi...

Ngày tải lên: 14/03/2014, 13:20

14 402 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

... in ltrated zones at the indicated time points (Fig 1D) The extent of the HR in the PR zone was significantly suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage ... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after A...

Ngày tải lên: 15/03/2014, 00:20

15 479 0
Development of a simple

Development of a simple

... scheme, and allows the assessment of the contribution of biogeochemically available trace metals to the total particulate metal concentration in SPM Materials and methods 2.1 Reagents and labware All ... was calculated as: Percentage OC ˆ 100 A B A (1) 2.3 Use of EDTA as extractant The interaction between an added chelating ligand and metals complexed by naturally occurring ligands i...

Ngày tải lên: 15/03/2014, 23:56

15 410 0
w