Development of a ball balancing robot

... from medical aspects, a 3-PUU translational parallel manipulator was chosen and designed to satisfy the specific requirement The kinematic analysis was performed and the manipulatorreachable workspace ... represents an ∂R equation in a single variable R and allows the calculation of the values of R and H in sequence B Design Variables and Objective Function The architec...

Ngày tải lên: 04/08/2014, 09:54

... moment gyro (CMG) as an actuator The control moment gyro (CMG) is typically used in a spacecraft to orient the vessel [5] Appling a CMG as an actuator to balance a bicycle is a creative and novel approach; ... provides a comparison of the various methods to balance a bicycle, evaluated their advantages and disadvantages The most significant contribution of thi...

Ngày tải lên: 02/10/2015, 17:14

... A dynamically-controlled, holonomic mobile robot is particularly desirable in a mobile manipulation system for many reasons A holonomic robot makes for easier gross motion planning and navigation ... and to the work of all the individuals stable platform for mobile manipulation there, especially Anthony del Balso, Rich Legrand, We have also described a new ap...

Ngày tải lên: 26/10/2014, 14:32

... role in human emotion perception and social interaction, and has attracted much attention in the areas of pattern recognition, computer vision, human- computer interaction, and humanrobot interaction ... and teachers, and can be employed for animal-assisted therapy (AAT) and animal-assisted activities (AAA) instead of real animals [2] This can partly reduce wor...

Ngày tải lên: 09/09/2015, 10:18

... - Appearance & Abilities 31 Chapter – Our Design Approach Based on the study of social robotics and successful social robotic heads, we come up with an approach to designing Dorothy s appearance ... and Mr Sakthiyavan S/O Kuppusamy (Mechatronics & Control Lab 1, Department of Mechanical Engineering, National University of Singapore) Thanks for their assistance in financial...

Ngày tải lên: 04/10/2015, 10:26

... Identify appropriate terms to measure emotions associated with foods maximizing information about the product Identify scaling approaches to measure emotions with consumers Develop a test protocol to ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited vi...

Ngày tải lên: 03/04/2013, 21:07

... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... Risk Management Framework  Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Man...

Ngày tải lên: 28/10/2013, 11:15

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...

Ngày tải lên: 18/02/2014, 17:20

... example, Raman Spectra of Vietnam petrol extracts excited by a 30mW He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser ... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator Th...

Ngày tải lên: 05/03/2014, 14:20

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20

... the software package interface Fig The flowchart of the program for 3D structured elliptic mesh generation Results The software package developed has been tested and applied to the mesh generation ... input data and the output meshes The software package has been initially used as a tool for 3D structured mesh generation for simulations of compressi...

Ngày tải lên: 14/03/2014, 13:20

... in ltrated zones at the indicated time points (Fig 1D) The extent of the HR in the PR zone was significantly suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage ... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after A...

Ngày tải lên: 15/03/2014, 00:20

Ngày tải lên: 15/03/2014, 23:56

... scheme, and allows the assessment of the contribution of biogeochemically available trace metals to the total particulate metal concentration in SPM Materials and methods 2.1 Reagents and labware All ... was calculated as: Percentage OC ˆ 100 A B A (1) 2.3 Use of EDTA as extractant The interaction between an added chelating ligand and metals complexed by naturally occurring ligands i...

Ngày tải lên: 15/03/2014, 23:56

... Semantic Organization of Scientific Terms." Information Storage and Retrieval (April 1967), pp 35-115 Earl, Lois L "Part -of- Speech Implications of Affixes." Mechanical Translation and Computational ... discussion of this specific problem and of this report as a whole DEVELOPMENT OF A STEMMING ALGORITHM After a word in the library user's query has been stemmed and a match...

Ngày tải lên: 16/03/2014, 19:20