Experiences of female juvenile delinquents and available rehabilitation programs in remand home, addis ababa

... link with Romanians, who also show a weaker link with Body and Beauty compared Italian and Spanish participants The second phase of data analysis, using the One Way ANOVA test and the Games Howell ... with the Italian participants b) in the Italian sample, we notice the absence of a significant association to plastic surgery and also between I and make-up and old age,...

Ngày tải lên: 19/02/2014, 17:20

... agricultural land use with farms, mainly cropping rice and fruits Some of the farms maintain small animal husbandries and fishponds Surface water, rain water and ground water are used for the drinking and ... Outlook Regarding the ground water and the surface water quality the two study sites Hoa An and An Binh are typical for the conditions of...

Ngày tải lên: 16/01/2014, 17:20

... Colombia – Small and Medium Enterprise – Monitoring and Evaluation Peru – Small and Medium Enterprise – Monitoring and Evaluation Impact Evaluation of SME Programs in Latin America and Caribbean ... Colombia Small and Medium Enterprise - Monitoring and Evaluation – Peru Mexico – Small and Medium Enterprise – Monitoring and Evalu...

Ngày tải lên: 14/02/2014, 21:20

... D -chymotrypsin trypsin Phe114 !Ile-D -chymotrypsin Phe114 !Ile-D -chymotrypsin ( –Ca21) Phe114 !Ile-D -chymotrypsin trypsin Wild-type trypsin Mutant trypsin Mutant trypsin trypsin Mutant trypsin ... by analyzing the linearized time dependence curves Enzyme(s) Wild-type chymotrypsin D -Chymotrypsin D -Chymotrypsin ( –Ca21) D -Chymotrypsin trypsin Tyr146 !His/Asn147!Ser D -chymotryp...

Ngày tải lên: 22/02/2014, 07:20

... Cite as Lawrence RA 1997 A Review of the Medical Benefits and Contraindications to Breastfeeding in the United States (Maternal and Child Health Technical Information Bulletin) Arlington, VA: National ... age and maturity of the infant play an important role in the way compounds are metabolized by the infant; gesta- A Review of the Medical...

Ngày tải lên: 05/03/2014, 10:20

... understanding into the implementation of the Directive by the Member States and to obtain feedback on potential areas for revision The review of the implementation of the WEEE Directive in EU Member ... centres in Beijing After the basic sorting and dismantling, e -waste from Beijing is sent to Southeast China, mainly the provinces of Guang Dong and...

Ngày tải lên: 08/03/2014, 13:20

... TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTCATCGTCTTTGTAGTCCATGG TGGT-3¢, respectively pBOS-HA-pVHL ... oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, into t...

Ngày tải lên: 16/03/2014, 05:20

... have investigated the effects of mutation of two paradigmatic residues involved in the dislocation of BS -RNase N-terminal arms, i.e Pro19 and Leu28, located in the hinge peptide and in the intersubunit ... [11] The kinetics of the N-terminal arms swapping in the P19A-BSRNase is comparable to that of BS -RNase (Fig 5B) Interestingly, the amount...

Ngày tải lên: 16/03/2014, 23:20

... Glu39 in 40 out Ó FEBS 2002 of 40 DYANA models) further support the continuous C-terminal helix structure Monitoring the Phe12 fi D-Phe and Leu15 fi Aib substitution The NOE pattern of the CRH analogue ... Arg16 and Glu20 The biological impact of the Aib1 5 and D -Phe12 modifications on the synthetic CRH analogue is illustrated by the pepti...

Ngày tải lên: 17/03/2014, 10:20

... rates of procedures and death among young adults Diagnosis and management of acute rheumatic fever and rheumatic heart disease in Australia DIAGNOSIS AND MANAGEMENT OF ACUTE RHEUMATIC FEVER 2.1 ... routine care on standardised evidence-based guidelines Diagnosis and management of acute rheumatic fever and rheumatic heart disease...

Ngày tải lên: 28/03/2014, 09:20

... Takayanagi and T Onaka PrRP and RFRPs in metabolism and stress Table Summary of mammalian RFamide peptides and their receptors The effects of administration of RFamide peptides upon stress responses ... in the termination of meals and the induction of energy consumption Energy homeostasis and stress interact with each other Stress affects food...

Ngày tải lên: 29/03/2014, 21:20

... the lack of a satiety signalling, whereas no change in food intake was detected in the B [a] P-treated animals In addition, the absolute values of leptin in control and B [a] P-treated animals were ... Results are shown as the average weight gain every days ± SEM rine-induced lipolysis Chronic (15 day) B [a] P exposure caused a significant weight gain and increa...

Ngày tải lên: 30/03/2014, 11:20

... The Role of Neutrinos, Strings, Gravity, and Variable Cosmological Constant in Elementary Particle Physics This page intentionally left blank The Role of Neutrinos, Strings, Gravity, and Variable ... N Kursunoglu, Stephan Mink, and Arnold Perlmutter Plenum Press, 2001 The Role of Neutrinos, Strings, Gravity, and Variable Cosmologica...

Ngày tải lên: 24/04/2014, 17:07

... Packing Gingival bleeding Other causes TOTAL n (% of sample )) (2.3 %) 37 (28.0 %) (6.1 %) 10 (7.5 %) (4.5 %) (21.1 %) (5.3 %) (5.3 %) (15.8 %) (6.3 %) (31.3 %) (12.5 %) (1.4 %) (2.9 %) (4.3 %) (2.8 %) (1.4 %) (2.5 %) ... (2.5 %) 16 (19.8 %) (5.0 %) (2.5 %) 41 (50.6 %) (2.0 %) (5.6 %) 13 (24.1 %) (7.4 %) (3.7...

Ngày tải lên: 18/06/2014, 19:20

... that the scoring range of the EQ-5D is twice that of the SF-6D The location of the baseline median scores in the scoring range was quite different: in the top quarter for EQ-5D, halfway for the ... were much larger than in the SF-6D (Table 2) There were no floor-effects in the utility scores, with minimum values of -0.32 for the EQ-5D and +0....

Ngày tải lên: 20/06/2014, 15:20