Experiences of female juvenile delinquents and available rehabilitation programs in remand home, addis ababa

Tài liệu SOCIAL REPRESENTATIONS OF FEMALE-MALE BEAUTY AND AESTHETIC SURGERY: A CROSS-CULTURAL ANALYSIS ppt

Tài liệu SOCIAL REPRESENTATIONS OF FEMALE-MALE BEAUTY AND AESTHETIC SURGERY: A CROSS-CULTURAL ANALYSIS ppt

... link with Romanians, who also show a weaker link with Body and Beauty compared Italian and Spanish participants The second phase of data analysis, using the One Way ANOVA test and the Games Howell ... with the Italian participants b) in the Italian sample, we notice the absence of a significant association to plastic surgery and also between I and make-up and old age,...

Ngày tải lên: 19/02/2014, 17:20

24 554 0
Tài liệu Conditions of the surface water and ground water resources in the rural area of the Mekong Delta, Vietnam pptx

Tài liệu Conditions of the surface water and ground water resources in the rural area of the Mekong Delta, Vietnam pptx

... agricultural land use with farms, mainly cropping rice and fruits Some of the farms maintain small animal husbandries and fishponds Surface water, rain water and ground water are used for the drinking and ... Outlook Regarding the ground water and the surface water quality the two study sites Hoa An and An Binh are typical for the conditions of...

Ngày tải lên: 16/01/2014, 17:20

17 695 0
Tài liệu Impact Evaluation Of Small And Medium Enterprise Programs In Latin America And The Caribbean pptx

Tài liệu Impact Evaluation Of Small And Medium Enterprise Programs In Latin America And The Caribbean pptx

... Colombia – Small and Medium Enterprise – Monitoring and Evaluation Peru – Small and Medium Enterprise – Monitoring and Evaluation Impact Evaluation of SME Programs in Latin America and Caribbean ... Colombia Small and Medium Enterprise - Monitoring and Evaluation – Peru Mexico – Small and Medium Enterprise – Monitoring and Evalu...

Ngày tải lên: 14/02/2014, 21:20

142 663 1
Tài liệu Báo cáo Y học: Structural determinants of the half-life and cleavage site preference in the autolytic inactivation of chymotrypsin pdf

Tài liệu Báo cáo Y học: Structural determinants of the half-life and cleavage site preference in the autolytic inactivation of chymotrypsin pdf

... D -chymotrypsin trypsin Phe114 !Ile-D -chymotrypsin Phe114 !Ile-D -chymotrypsin ( –Ca21) Phe114 !Ile-D -chymotrypsin trypsin Wild-type trypsin Mutant trypsin Mutant trypsin trypsin Mutant trypsin ... by analyzing the linearized time dependence curves Enzyme(s) Wild-type chymotrypsin D -Chymotrypsin D -Chymotrypsin ( –Ca21) D -Chymotrypsin trypsin Tyr146 !His/Asn147!Ser D -chymotryp...

Ngày tải lên: 22/02/2014, 07:20

9 613 0
A Review of the Medical Benefits and Contraindications to Breastfeeding in the United States ppt

A Review of the Medical Benefits and Contraindications to Breastfeeding in the United States ppt

... Cite as Lawrence RA 1997 A Review of the Medical Benefits and Contraindications to Breastfeeding in the United States (Maternal and Child Health Technical Information Bulletin) Arlington, VA: National ... age and maturity of the infant play an important role in the way compounds are metabolized by the infant; gesta- A Review of the Medical...

Ngày tải lên: 05/03/2014, 10:20

40 816 1
Implementation of the Waste Electric and Electronic Equipment Directive in the EU pot

Implementation of the Waste Electric and Electronic Equipment Directive in the EU pot

... understanding into the implementation of the Directive by the Member States and to obtain feedback on potential areas for revision The review of the implementation of the WEEE Directive in EU Member ... centres in Beijing After the basic sorting and dismantling, e -waste from Beijing is sent to Southeast China, mainly the provinces of Guang Dong and...

Ngày tải lên: 08/03/2014, 13:20

108 457 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

... TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTCATCGTCTTTGTAGTCCATGG TGGT-3¢, respectively pBOS-HA-pVHL ... oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, into t...

Ngày tải lên: 16/03/2014, 05:20

9 421 0
Báo cáo khoa học: Role of the hinge peptide and the intersubunit interface in the swapping of N-termini in dimeric bovine seminal RNase pptx

Báo cáo khoa học: Role of the hinge peptide and the intersubunit interface in the swapping of N-termini in dimeric bovine seminal RNase pptx

... have investigated the effects of mutation of two paradigmatic residues involved in the dislocation of BS -RNase N-terminal arms, i.e Pro19 and Leu28, located in the hinge peptide and in the intersubunit ... [11] The kinetics of the N-terminal arms swapping in the P19A-BSRNase is comparable to that of BS -RNase (Fig 5B) Interestingly, the amount...

Ngày tải lên: 16/03/2014, 23:20

7 404 0
Báo cáo Y học: Monitoring the structural consequences of Phe12 fi D-Phe and Leu15 fi Aib substitution in human/rat corticotropin releasing hormone Implications for design of CRH antagonists pdf

Báo cáo Y học: Monitoring the structural consequences of Phe12 fi D-Phe and Leu15 fi Aib substitution in human/rat corticotropin releasing hormone Implications for design of CRH antagonists pdf

... Glu39 in 40 out Ó FEBS 2002 of 40 DYANA models) further support the continuous C-terminal helix structure Monitoring the Phe12 fi D-Phe and Leu15 fi Aib substitution The NOE pattern of the CRH analogue ... Arg16 and Glu20 The biological impact of the Aib1 5 and D -Phe12 modifications on the synthetic CRH analogue is illustrated by the pepti...

Ngày tải lên: 17/03/2014, 10:20

11 515 0
Diagnosis and management of acute rheumatic fever and rheumatic heart disease in Australia pptx

Diagnosis and management of acute rheumatic fever and rheumatic heart disease in Australia pptx

... rates of procedures and death among young adults Diagnosis and management of acute rheumatic fever and rheumatic heart disease in Australia DIAGNOSIS AND MANAGEMENT OF ACUTE RHEUMATIC FEVER 2.1 ... routine care on standardised evidence-based guidelines Diagnosis and management of acute rheumatic fever and rheumatic heart disease...

Ngày tải lên: 28/03/2014, 09:20

100 333 0
Báo cáo khoa học: Roles of prolactin-releasing peptide and RFamide related peptides in the control of stress and food intake potx

Báo cáo khoa học: Roles of prolactin-releasing peptide and RFamide related peptides in the control of stress and food intake potx

... Takayanagi and T Onaka PrRP and RFRPs in metabolism and stress Table Summary of mammalian RFamide peptides and their receptors The effects of administration of RFamide peptides upon stress responses ... in the termination of meals and the induction of energy consumption Energy homeostasis and stress interact with each other Stress affects food...

Ngày tải lên: 29/03/2014, 21:20

8 490 0
Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

... the lack of a satiety signalling, whereas no change in food intake was detected in the B [a] P-treated animals In addition, the absolute values of leptin in control and B [a] P-treated animals were ... Results are shown as the average weight gain every days ± SEM rine-induced lipolysis Chronic (15 day) B [a] P exposure caused a significant weight gain and increa...

Ngày tải lên: 30/03/2014, 11:20

11 425 0
the role of neutrinos, strings, gravity, and variable cosmological constant in particle physics

the role of neutrinos, strings, gravity, and variable cosmological constant in particle physics

... The Role of Neutrinos, Strings, Gravity, and Variable Cosmological Constant in Elementary Particle Physics This page intentionally left blank The Role of Neutrinos, Strings, Gravity, and Variable ... N Kursunoglu, Stephan Mink, and Arnold Perlmutter Plenum Press, 2001 The Role of Neutrinos, Strings, Gravity, and Variable Cosmologica...

Ngày tải lên: 24/04/2014, 17:07

284 2,2K 0
báo cáo hóa học: " Validation of two complementary oral-health related quality of life indicators (OIDP and OSS 0-10 ) in two qualitatively distinct samples of the Spanish population" potx

báo cáo hóa học: " Validation of two complementary oral-health related quality of life indicators (OIDP and OSS 0-10 ) in two qualitatively distinct samples of the Spanish population" potx

... Packing Gingival bleeding Other causes TOTAL n (% of sample )) (2.3 %) 37 (28.0 %) (6.1 %) 10 (7.5 %) (4.5 %) (21.1 %) (5.3 %) (5.3 %) (15.8 %) (6.3 %) (31.3 %) (12.5 %) (1.4 %) (2.9 %) (4.3 %) (2.8 %) (1.4 %) (2.5 %) ... (2.5 %) 16 (19.8 %) (5.0 %) (2.5 %) 41 (50.6 %) (2.0 %) (5.6 %) 13 (24.1 %) (7.4 %) (3.7...

Ngày tải lên: 18/06/2014, 19:20

14 490 0
báo cáo hóa học:" Comparison of the SF-6D and the EQ-5D in patients with coronary heart disease" pdf

báo cáo hóa học:" Comparison of the SF-6D and the EQ-5D in patients with coronary heart disease" pdf

... that the scoring range of the EQ-5D is twice that of the SF-6D The location of the baseline median scores in the scoring range was quite different: in the top quarter for EQ-5D, halfway for the ... were much larger than in the SF-6D (Table 2) There were no floor-effects in the utility scores, with minimum values of -0.32 for the EQ-5D and +0....

Ngày tải lên: 20/06/2014, 15:20

9 408 0
w