Efficacy of meperidine versus tramadol as a treatment agent on post spinal anaesthesia shivering, hemodynamic stability and therapeutic side effects in parturients at mateme gandhi memorial hospital,

Effect of ketofol versus propofol as an induction agent on ease of laryngeal mask airway insertion conditions and hemodynamic stability in children a prospective cohort study

Effect of ketofol versus propofol as an induction agent on ease of laryngeal mask airway insertion conditions and hemodynamic stability in children a prospective cohort study

... Elsayed KM A clinical comparison of ketofol (ketamine and propofol admixture) versus propofol as an induction agent on quality of laryngeal mask airway insertion and hemodynamic stability in children ... propofol admixture) versus propofol as an induction agent on quality of laryngeal mask airway insertion and hemodynami...

Ngày tải lên: 14/08/2017, 16:46

50 191 0
Báo cáo khoa học nông nghiệp " Nutrient recovery by rice crops as a treatment for aquaculture solid waste: crop yield, nutrient status and nutrient budgets " doc

Báo cáo khoa học nông nghiệp " Nutrient recovery by rice crops as a treatment for aquaculture solid waste: crop yield, nutrient status and nutrient budgets " doc

... fishpond solid waste was applied before planting as was 50 % of the inorganic P and K The remaining P and K was applied at panicle initiation stage at 35 days after sowing (DAS) while N was split ... (Page et al 1982), plant analysis (Chapman and Pratt, 1961); water and wastes samples analysis followed methods for chemical analysis of water and wastes (MCAWW) EPA/600/4/79-020...

Ngày tải lên: 21/06/2014, 04:20

24 346 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is...

Ngày tải lên: 07/03/2014, 10:20

9 634 0
Báo cáo khoa học: " Application of ventriculoperitoneal shunt as a treatment for hydrocephalus in a dog with syringomyelia and Chiari I malformation" pptx

Báo cáo khoa học: " Application of ventriculoperitoneal shunt as a treatment for hydrocephalus in a dog with syringomyelia and Chiari I malformation" pptx

... etubirtnoc ton did aileymognirys dna noitamroflam I iraihC taht dna sulahapecordyh fo tluser a ylniam saw aixata eht taht tseggus nac ew ,suhT deniamer llits aileymognirys dna noitamroflam I iraihC ... yllanoitidart neeb sah taht nigiro niatrecnu na fo redrosid a si noitamroflam I iraihC )2 giF( aileymognirys dna noitamroflam I iraihC osla tub ,selcirtnev laretal eht fo noitatalid...

Ngày tải lên: 07/08/2014, 18:21

4 384 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

... Mason D: Evidence that the T cell repertoire of normal rats contains cells with the potential to cause diabetes Characterization of the CD4+ T cell subset that inhibits this autoimmune potential ... disease or certain forms of multiple sclerosis The adoptive transfer of regulatory T cells generated ex vivo also has the potential to prevent the rejection of al...

Ngày tải lên: 09/08/2014, 03:24

6 409 0
Báo cáo y học: "Efficacy of customised foot orthoses in the treatment of Achilles tendinopathy: study protocol for a randomised trial" pps

Báo cáo y học: "Efficacy of customised foot orthoses in the treatment of Achilles tendinopathy: study protocol for a randomised trial" pps

... head palpation, supralateral and infralateral malleolar curvature, calcaneal frontal plane position, prominence in the region of the talonavicular joint, medial arch height and abduction and adduction ... worst pain imaginable, during the activity The pain after the activity can reach on a VAS but should have subsided by the following morning Pain and stiffness in the A...

Ngày tải lên: 10/08/2014, 21:23

13 443 0
Báo cáo y học: "Psychotherapy as a treatment modality for psychiatric disorders: Perceptions of general public of Karachi, Pakistan" ppsx

Báo cáo y học: "Psychotherapy as a treatment modality for psychiatric disorders: Perceptions of general public of Karachi, Pakistan" ppsx

... metropolitan of Pakistan, towards psychotherapy as a psychiatric treatment modality and investigated any association between these perceptions and age, gender, educational level or occupational status ... that general public of the largest city of Pakistan perceive psychotherapy as a clinically effective, cost efficient and acceptable modality for management of...

Ngày tải lên: 11/08/2014, 17:20

5 284 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

... interest students in listening lessons That is the reason why this paper is made a study of using English songs as a kind of supplementary material in teaching listening skill to first year non- major ... OF USING SONGS AS A SUPPLEMENTARY MATERIAL IN TEACHING LISTENING FOR THE FIRST- YEAR NON- MAJOR STUDENTS OF ENGLISH...

Ngày tải lên: 29/01/2014, 10:33

39 1,1K 3
Tài liệu The Value of the Case Study as a Research Strategy doc

Tài liệu The Value of the Case Study as a Research Strategy doc

... re-evaluation of cases Reliability is most important during the data collection phase, and involves the use of case study protocol as well as the case study database already mentioned Validity and ... underlying the case study itself is of a holistic nature Case studies may either focus on a single case or use a number of cases: A single case may...

Ngày tải lên: 20/02/2014, 11:20

15 588 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGG...

Ngày tải lên: 06/03/2014, 22:21

13 563 0
a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry

a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry

... types of costing method such as: traditional or absorption costing method, variable costing method, throughput costing method, and ABC costing method Changes in business environments requires a better ... variable costing method was used as the only and easiest way to calculate the costs This is because it is easy to accountants as well as managers and...

Ngày tải lên: 13/03/2014, 14:19

64 512 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

... Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride Chloroplast DNA Euglenophyceae ... glaucophyte, C paradoxa that has the most primitive plastids [23], contained the PsbV and PsbU proteins as the extrinsic proteins (Figs and 2) A primitive red alga, C caldarium th...

Ngày tải lên: 23/03/2014, 15:21

11 503 0
báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot

báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot

... brevity and apparent validity as a marker for health and health behaviors, self-rated health may prove to be a useful tool for assessing health status among young military members Self-rated health ... health behaviors (e.g., tobacco, alcohol and drunk driving habits) to examine the validity of self-rated overall health as a measure of health...

Ngày tải lên: 20/06/2014, 15:20

9 301 0
Báo cáo hóa học: " Effects of pentacene-doped PEDOT:PSS as a holeconducting layer on the performance characteristics of polymer photovoltaic cells" pot

Báo cáo hóa học: " Effects of pentacene-doped PEDOT:PSS as a holeconducting layer on the performance characteristics of polymer photovoltaic cells" pot

... was thermally annealed As the annealing temperature was increased, the polymer aggregate or grain size also increased, and eventually, the continuous interfaces are formed, which improve conductivity ... through the interfaces of grains As the annealing temperature was increased, the root-mean-square [RMS] surface roughness of pentacene-doped PEDOT:PSS films increase...

Ngày tải lên: 20/06/2014, 23:20

8 401 0
Từ khóa:
w