Design a web based maternal death surveillance and response system for addis ababa city administration health bureau, ethiopia

... this study, we measured the incremental costs of setting-up and implementing an integrated surveillance and response strategy in Burkina Faso, Eritrea and Mali In each country, the cost of IDSR ... Appendix _ Cost Analysis of IDSR Appendix List of IDSR priority diseases and diseases of public health importance weekly or monthly reported in Burkina, Eritre...

Ngày tải lên: 13/08/2014, 11:22

... for an evaluation and a strategic university planning For the implementation, a Web-based DSS is based on ISO 9000 factors for the evaluation and strategic planning for a case study of Vietnam ... and plan for a strategy in educational management of organizations in Vietnam and Asia [3] However, there are no DSS applications to apply a r...

Ngày tải lên: 05/03/2014, 14:20

... Friedman and Maniatis Genome Biology 2011, 12:R69 http://genomebiology.com/2011/12/7/R69 SOFTWARE Open Access ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression ... data Brad A Friedman1,2,3* and Tom Maniatis4 Abstract RNA-Seq and microarray platforms have emerged as important tools for detecting changes in gene...

Ngày tải lên: 09/08/2014, 23:20

... use a daily food diary which links to a database of over 40000 branded and unbranded food items, automatically calculating an estimate of calorie intake A daily exercise diary encourages additional ... this article as: Johnson and Wardle: The association between weight loss and engagement with a web-based food and exercise diary in a commerci...

Ngày tải lên: 14/08/2014, 08:20

... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGA...

Ngày tải lên: 14/08/2014, 16:21

Ngày tải lên: 13/11/2014, 09:46

... for a manufacturing company that aims to improve and enhance their manufacturing system and operations The major advantages of a Web- based Kanban system is the availability of visible and real-time ... withdrawal Kanban signal and place it in ‘on-hold’ status on Web- based Kanban screen [2] The withdrawal Kanban signal from Kanban screen will be translated...

Ngày tải lên: 04/10/2015, 15:45

... Geographic Information system (GIS) is any system integrates hardware, software, and data for capturing, managing, analyzing, and displaying all forms of geographically referenced information ... operating system - Easy to manage, update database: Database is located at dedicated server that managers can maintain and update it easily - Quick delivery: web-based model make it portabl...

Ngày tải lên: 27/10/2012, 16:40

... and Comparative Evaluation in Natural Language Generation Rainer Malaka and Er Zipf 2000 Deep Map - challenging IT research in the framework of a tourist information system In Information and Communication ... Navigation Systems This framework can be used to evaluate a variety of navigation systems Route navigation has been an interesting research topic for researchers in both geoinfo...

Ngày tải lên: 07/03/2014, 18:20

... for (a) training and (b) tagging Machine learning components in Argo In order to ensure flexibility in building workflows, we split the machine learning capability into three distinct processing ... namely feature generator, model trainer and tagger The trainer and the tagger are intrinsic machine learning components, whereas the feature generator is a convenient and customisable proces...

Ngày tải lên: 16/03/2014, 20:20

... insight into the type of problems in (computer aided) human translation and the time spent to solve these problems Conclusions We described the new computer aided translation tool caitra that allows ... phrase translation are displayed alongside the input words, ranked and color-coded by their probability the translation word by word, she is aided by a machine translation sy...

Ngày tải lên: 17/03/2014, 02:20

... performance and user satisfaction In Proc DARPA Speech and NL Workshop M Walker, D Litman, C Kamm, and A Abella 1997 PARADISE: A general framework for evaluating spoken dialogue agents In Proc ACL/EACL ... seventh train leaves at 5:OOpm on Saturda); and it takes I hour 12 rains Please say "list" to hear trains at a time, or say "add constraint" to constrain your departure time o...

Ngày tải lên: 17/03/2014, 07:20

... Conference on Natural Language Learning, pages 152–164 Association for Computational Linguistics Hamish Cunningham, Diana Maynard, Kalina Bontcheva, Valentin Tablan, Niraj Aswani, Ian Roberts, Genevieve ... Extraction (IE) tasks (Figure 2) Additional aspects of annotations can be marked using attributes, binary or multi-valued flags that can be added to other annotations Finally, annotators...

Ngày tải lên: 17/03/2014, 22:20

... current information b October 1998 1.5 ( 1-3 ) 267 (22 5-2 94) 11.8 (9. 9-1 2.9) AIG annual meetings October 1998 0.2 0.5 ( 0-1 .5) 252 (13 6-3 59) 11.1 (6. 0-1 5.9) 1.5 ( 1-2 .5) 387 (26 1-6 27) 17.1 (11. 5-2 7.7) ... (0. 5-1 .5) 204 (15 6-2 74) 28.8 (22. 1-3 8.7) DIR contact person information October 1998 0.5 0.5 ( 0-1 ) 164 (14 9-1 89) 23.1 (21. 0-2 6.7)...

Ngày tải lên: 22/03/2014, 11:20

... may influence the feasibility and the acceptance of MDR The Ministry of Health in Senegal initiated MDR in 2004 in five pilot hospitals with the collaboration of researchers of the University of ... professionals interviewed, the perinatal information system in the hospitals was, in general, not suitable to allow an extensive identification of all the maternal...

Ngày tải lên: 18/06/2014, 17:20