Abstracting and correlating heterogeneous events to detect complex scenarios

interactions of yeasts, moulds, and antifungal agents how to detect resistance

interactions of yeasts, moulds, and antifungal agents how to detect resistance

... Interactions of Yeasts, Moulds, and Antifungal Agents Gerri S Hall Editor Interactions of Yeasts, Moulds, and Antifungal Agents How to Detect Resistance Editor Gerri S Hall, ... designed to cover the topic of antifungal agents and resistance detection in fungal organisms, both yeasts and molds One chapter is devoted to a description of the...

Ngày tải lên: 29/05/2014, 16:51

183 603 0
Báo cáo y học: "Using Medical Emergency Teams to detect preventable adverse events"

Báo cáo y học: "Using Medical Emergency Teams to detect preventable adverse events"

... An adverse outcome is any suboptimal outcome experienced by the patient By definition, any MET call is an adverse outcome An adverse event is an adverse outcome caused by the processes of medical ... than by the progression of disease Medical management refers to all aspects of care A preventable adverse event is an adverse event caused by error or health system flaw An er...

Ngày tải lên: 25/10/2012, 10:06

5 531 0
Báo cáo khoa học: "A multi-staged approach to identifying complex events in textual data" ppt

Báo cáo khoa học: "A multi-staged approach to identifying complex events in textual data" ppt

... understood as relations (job title) or events (acquisitions) 3.3 Statistical training Because we had no existing methods to address financial events or relations, we took this opportunity to develop ... contextual information using text classification methods We also use text classification methods to help users to more quickly focus on an area where interesting transactions exist...

Ngày tải lên: 08/03/2014, 21:20

4 404 0
Báo cáo khoa học: "Using Focus to Generate Complex and Simple Sentences" pot

Báo cáo khoa học: "Using Focus to Generate Complex and Simple Sentences" pot

... proposition focuses on Focl and mentions an unfocused argument Goall, and if the second proposition specifies Goall as its focus, but in the third proposition the focus returns to Focl, then the first and ... proved too timeconsuming (McKeown, 1982) and efforts have been made to alter the algorithm to improve efficiency (Appelt, 1983) Efficiency continues to be a problem a...

Ngày tải lên: 17/03/2014, 19:21

8 349 1
Báo cáo hóa học: " Interactive Video Coding and Transmission over Heterogeneous Wired-to-Wireless IP Networks Using an Edge Proxy" pdf

Báo cáo hóa học: " Interactive Video Coding and Transmission over Heterogeneous Wired-to-Wireless IP Networks Using an Edge Proxy" pdf

... previously in Figures 11 and 9, respectively It clearly Video Coding and Transmission on IP Networks Using an Edge Proxy demonstrates the substantial improvement using an edge proxy For example, ... Video Coding and Transmission on IP Networks Using an Edge Proxy 39 Edge proxy 38 λ=0 37 PSNR (dB) 261 λ = 1% 36 JSCC λ = 2% λ = 5% 35 λ 34 33 32 50 N...

Ngày tải lên: 23/06/2014, 01:20

12 231 0
Báo cáo y học: "The use and abuse of commercial kits used to detect autoantibodies" ppsx

Báo cáo y học: "The use and abuse of commercial kits used to detect autoantibodies" ppsx

... high level of security, of scrutiny and of standardization, and under good laboratory practices and quality control Many of these companies subscribe to and offer postmarketing quality assurance ... guide to autoantibody test requests Patient The ongoing demands of quality control and quality assurance are highly dependent on the availability of prototype sera and...

Ngày tải lên: 09/08/2014, 01:23

10 414 0
Báo cáo y học: "Local IL-13 gene transfer prior to immune-complex arthritis inhibits chondrocyte death and matrix-metalloproteinase-mediated cartilage matrix degradation despite enhanced joint inflammation" pps

Báo cáo y học: "Local IL-13 gene transfer prior to immune-complex arthritis inhibits chondrocyte death and matrix-metalloproteinase-mediated cartilage matrix degradation despite enhanced joint inflammation" pps

... significantly increased the inflammatory cell mass in joint cavity and synovium, by 60% and 30%, respectively, days after arthritis induction (Fig 2a) After days, joint inflammation seemed to normalize ... day after the onset of immune-complex- mediated arthritis The inflammatory cell mass was significantly enhanced by IL-13 in both the joint cavity and the synovium day...

Ngày tải lên: 09/08/2014, 06:22

10 389 0
Báo cáo y học: "Drug efficacy by direct and adjusted indirect comparison to placebo: An illustration by Mycobacterium avium complex prophylaxis in HIV" potx

Báo cáo y học: "Drug efficacy by direct and adjusted indirect comparison to placebo: An illustration by Mycobacterium avium complex prophylaxis in HIV" potx

... show/NCT00811954?term=ACTG+5257&rank=3] doi:10.1186/1742-6405-8-14 Cite this article as: Chu et al.: Drug efficacy by direct and adjusted indirect comparison to placebo: An illustration by Mycobacterium avium complex prophylaxis ... compared to the Nightingale et al placebo arm Comparison of direct and adjusted indirect comparison methods The effi...

Ngày tải lên: 10/08/2014, 05:22

6 342 0
Báo cáo y học: "The challenge to detect heart transplant rejection and transplant vasculopathy non-invasively a pilot study" ppsx

Báo cáo y học: "The challenge to detect heart transplant rejection and transplant vasculopathy non-invasively a pilot study" ppsx

... were analysed Zytological analyses This summarizes analyses of sputum, pharyngeal smear and urine to assess any bacterial, viral or fungal infections Electrocardiogram A 12-lead electrocardiogram ... ventricular morphology, systolic function, diastolic function, and myocardial inflammation makes it an excellent candidate to noninvasively diagnose and screen for heart transplant...

Ngày tải lên: 10/08/2014, 10:20

9 399 0
báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx

báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx

... ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA -AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ... ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA B A genome B genome D genome CCTCGATTTTATTTTCTAATGTTAT...

Ngày tải lên: 12/08/2014, 03:21

14 324 0
Báo cáo y học: "Texture analysis of cartilage T2 maps: individuals with risk factors for OA have higher and more heterogeneous knee cartilage MR T2 compared to normal controls - data from the osteoarthritis initiative" pptx

Báo cáo y học: "Texture analysis of cartilage T2 maps: individuals with risk factors for OA have higher and more heterogeneous knee cartilage MR T2 compared to normal controls - data from the osteoarthritis initiative" pptx

... Texture analysis of cartilage T2 maps: individuals with risk factors for OA have higher and more heterogeneous knee cartilage MR T2 compared to normal controls – data from the osteoarthritis ... unadjusted -1 7.89 -2 4.86 -1 6.6 -0 .07 -0 .06 -0 .03 -2 5.4 -3 2.97 -2 2.81 -0 .72 -1 .18 -0 .72 $ Coeffic...

Ngày tải lên: 12/08/2014, 18:20

34 294 0
Development and validation of a generic assay to detect compounds acting via an aggregation based mechanism

Development and validation of a generic assay to detect compounds acting via an aggregation based mechanism

... Plate reader-mostly fluorescence, luminescence and absorbance Reporting format “Representative” data; statistical analysis of manually curated dataset Automated analysis of all data using statistical ... establish viability of application Furthermore, a generic assay that could be applied to any HTS campaign to eliminate inhibitors acting via an aggregation- based...

Ngày tải lên: 04/10/2015, 15:46

86 1,1K 0
The Scientist and Engineer's Guide to Digital Signal Processing Second Edition

The Scientist and Engineer's Guide to Digital Signal Processing Second Edition

... Be sure to visit the book’s website at: www.DSPguide.com The Scientist and Engineer's Guide to Digital Signal Processing Second Edition by Steven W Smith California ... Smith California Technical Publishing San Diego, California The Scientist and Engineer's Guide to Digital Signal Processing Second Edition by Steven W Smith copyright © 1997-1999...

Ngày tải lên: 13/09/2012, 10:21

14 1K 0
Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"

Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"

... intravenously injected into nude mice and the distribution and migration of MSCs were dynamically monitored to evaluate the feasibility and safety of intravenous implantation of allogeneic MSCs in the ... transplanted the bone marrow stem cells into the necrotic femoral heads, and results show bone marrow stem cells can remove vascular lesions...

Ngày tải lên: 25/10/2012, 11:18

10 584 0
w