... research of Steck et al.3 on anti- rickettsial acridines and Elslager et al.4 on anti- bacterial acridine N-oxides were the last major investigations on the antimicrobial properties of acridines.5 Ironically, ... presentation at the Medicinal Chemistry Symposium Jan 2008 National University of Singapore Nguyen, T.H.T; Lee, C.Y.; Ong, W.Y.; Doh-ura, K.; Go, M.L Investigation...
Ngày tải lên: 11/09/2015, 10:05
... research suggests another possible mode of action of yucca in preventing arthritis by anti-inflammatory activity Yucca contains anti-inflammatory polyphenolics such as resveratrol and yuccaols A, ... basis of the anti-protozoal activity of yucca saponins The chemistry and bioactivity of yucca saponins and phenolics have recently been reviewed by Piacente et al [21...
Ngày tải lên: 11/08/2014, 08:21
báo cáo sinh học:" Health workforce skill mix and task shifting in low income countries: a review of recent evidence" pptx
... reviews of task shifting, including HIV/AIDS treatment and care provided by lay and community health workers in Africa, maternal and child health care as well as the management of infectious diseases ... patient access and a reduction in health worker training and wage bill costs Task shifting includes various scenarios, such as substituting tasks among profes...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo toán học: "A generalized Weyl theorem and $L^p$-spectra of Schroedinger operators " pptx
Ngày tải lên: 05/08/2014, 15:21
Báo cáo khoa hoc:"Lack of congruence between morphometric evolution and genetic differentiation suggests a recent dispersal and local habitat adaptation of the Madeiran lizard Lacerta dugesii" doc
... Madeira Island and to a lesser extent with the other populations from the same island (MA1 and MA2) The two samples from the Selvagens (SE1 and SE2) and the sample from Porto Santo (PS) Island ... Allozyme variation in populations of Lacerta raddei and Lacerta nairensis (Sauria: Lacertidae) from Armenia, Amphibia-Reptilia 17 (1996) 233– 246 [6] Cavalli-Sforza L., E...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo sinh học: "Antibacterial and resistance-modifying activities of thymoquinone against oral pathogens" ppsx
... resistance-modifying activities of thymoquinone against oral pathogens Annals of Clinical Microbiology and Antimicrobials 2011 10:29 Submit your next manuscript to BioMed Central and take full advantage of: • ... properties of thymoquinone Antibacterial activity of thymoquinone Data presented in Table showed that the supplementation of TQ (at 1/2 MIC) induces the...
Ngày tải lên: 12/08/2014, 17:20
Báo cáo y học: " Integrase and integration: biochemical activities of HIV-1 integrase" pps
... Strand Transfer Mn2+ Mg2+ Palindrome Cleavage Mn2+ Mg2+ - - - - - - - - - - + + - + + + + + Figure Catalytical activities of HIV-1 integrase Catalytical activities of HIV-1 integrase The catalytical ... substantially stimulated by the release of the first integrase inhibitors onto the market and, unfortunately, by the likely emergence of resistant viruses Integrase a...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: " Recent developments and strategies in pediatric pharmacology research in the USA" ppsx
... drugs, thus integrating and complementing the exclusivity extension initiative that applies to patented drugs Industry-funded research As mentioned, the involvement of industry in pediatric research ... reflected in the decision of the European Union to enact similar incentives to industry for pediatric research [34,35] Independent analyses of the economic cost and...
Ngày tải lên: 13/08/2014, 18:21
Evaluation on sources of fund and capital raising activities of military commercial joint stock bank of vietnam (MB)
... investment activities OVERVIEW OF MILITARY COMMERCIAL JOINT STOCK BANK OF VIETNAM I History: Military Commercial Joint Stock Bank of Vietnam, abbreviated as MB, was founded on 4th November 1994 under ... term OCB SHB HD Bank AB Bank BIDV Ocean Bank VietBank Sacombank Techcombank ACB Agribank VietCapital Bank Vietcombank MB Vietinbank VP Bank Bảo Việt...
Ngày tải lên: 21/04/2017, 22:57
Báo cáo y học: "omparative Efficacy and Tolerability of 5-Loxin® and Aflapin® Against Osteoarthritis of the Knee: A Double Blind, Randomized, Placebo Controlled Clinical Study"
... prove the efficacy and tolerability of Aflapin in osteoarthritis Hence in the present clinical study we sought to evaluate the comparative efficacy and tolerability of 5-Loxin® and Aflapin® in the ... (e) in placebo, 100 mg/ day 5-Loxin® and 100 mg/day Aflapin® groups, respectively to 5, represent days of evaluations such as day 0, day 7, day 30, day...
Ngày tải lên: 25/10/2012, 11:40
Tài liệu The and Social EffEconomic ects of Financial Liberalization: A Primer for Developing Countries pdf
... Contents The Economic and Social Effects of Financial Liberalization: A Primer for Developing Countries The nature of financial liberalization The theoretical arguments for financial ... London Chandrasekhar, C.P (2004) Financial liberalization and the macroeconomics of poverty reduction” Draft Thematic Summary on Financial Liberalization for the Asia...
Ngày tải lên: 23/12/2013, 13:15
Báo cáo " Paleomagnetism of cretaceous continental redbed formations from Indochina and South China, their Cenozoic tectonic implications: a review " pdf
... J. Besse and V. Courtillot, Revised and synthetic apparent polar wander paths of the African, Eurasian, North America and Indian Plates, and true polar wander since 200 Ma, Journal of Geophysical Research B96 (1991) 4029. ... Shan‐Thai and Indochina blocks, South China Sea, Borneo, Malaya‐Indonesia Islands. During the decade 90s of the 20th Century, there have been...
Ngày tải lên: 22/03/2014, 12:20
Reactionary Philosophy and Ambiguous Aesthetics in the Revolutionary Politics of Herbert Marcuse—A Review Essay pptx
... aesthetic principles or judgments, and between the latter and his politics The missing link: Marcuse and U.S culture The most glaring omission in Reitz’s presentation is an analysis of the links ... of the sixties on the basis of the latter’s primitivist, escapist, instinctualist tendencies? Do the two then diverge because the latter was putting into practice...
Ngày tải lên: 30/03/2014, 16:20
Label free and reagentless electrochemical detection of microRNAs using a conducting polymer nanostructured by carbon nanotubes application to prostate cancer biomarker mir 141
... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... formats (Xu et al., 2004, 2006; Cai et al., 2003) In this paper, we describe a label- free and reagentless miRNA sensor based on an interpenetrated network of carbon nanotube...
Ngày tải lên: 02/07/2014, 14:14