... 5'-AGCGTCTAGCCATGGCGTTAGTAT-3' 74 97 Ba 5'-TCCTCGCAATTCCGGTGTACTC-3' 161 182 Bp FAM5'-CCCCCCTCCCGGGAGAGCCATAGT-3' BHQ 121 144 ICp Cy55'-TTCCGCTGCCTGCTCAGTCGATCC-3' BHQ BHQ: Black Hole Quencher ... LOD of the duplex real-time RT-PCR assay was 38.99 IU/ml and the specificity was 100% Furthermore, the cost of the duplex real-time RT-PCR assay was considerably lower than t...
Ngày tải lên: 12/08/2014, 04:20
... template DNA preparation GPV CHV strain, a high-virulence strain of GPV, was obtained from Key Laboratory of Animal Diseases and Human Health of Sichuan Province Aleutian disease virus (ADV), canine ... size (bp) GPV-F GPV-R GPV-FP GTGCCGATGGAGTGGGTAAT ACTGTGTTTCCCATCCATTGG 6FAM-FTCGCAATGCCA ATTTCCCGAGGP TAMRA AAGCTTTGAAATGGCAGAGGGAGGA GGATCCCGCCAGGAAGTGCTTTATTTGA 3084-3103 3122-3143...
Ngày tải lên: 12/08/2014, 04:20
Tài liệu Báo cáo " Evaluation of ASTER Data Use in Land Use Study in the Mekong delta " pptx
... Evaluation of ASTER data use in land use study in the Mekong Delta 29 discrimination capacity of ASTER data in land use mapping of such a dynamic area as the Mekong Delta in Vietnam ... Sciences, T.XXIII, N0 1, 2007 Evaluation of ASTER data use in land use study in the Mekong Delta 35 The whole province covers 5,213km...
Ngày tải lên: 13/02/2014, 12:20
báo cáo khoa học:" Biological and biomechanical evaluation of interface reaction at conical screw-type implants" doc
... nifications SEM of implantation sites in tibia specimens at different magSEM of implantation sites in tibia specimens at different magnifications Bone-implant interfaces are shown after 28 days of ... areas of the micro- Figure nifications SEM of implantation sites in tibia specimens at different magSEM of implantation sites in tibia specimens at different magnifications B...
Ngày tải lên: 11/08/2014, 23:22
Báo cáo y học: "Evaluation of pathogen detection from clinical samples by real-time polymerase chain reaction using a sepsis pathogen DNA detection kit" pdf
... Crit Care Med 2008, 36:296-327 doi:10.1186/cc9234 Cite this article as: Yanagihara et al.: Evaluation of pathogen detection from clinical samples by real-time polymerase chain reaction using a sepsis ... Nagasaki 852-8501, Japan 4Second Department of Internal Medicine, Nagasaki University School of Medicine, 1-7-1 Sakamoto, Nagasaki City, Nagasaki 852-8501, Jap...
Ngày tải lên: 13/08/2014, 21:21
An evaluation of land use development processes for the knowledge based urban development (KBUD) using agent based modelling
... An evaluation of land use development Rengarajan processes for the Knowledge Based Urban Satyanarain Development (KBUD) using agent based modelling 2014 An evaluation of land use development ... processes for the Knowledge Based Urban Development (KBUD) using agent based modelling RENGARAJAN SATYANARAIN (B.TECH, INDIA...
Ngày tải lên: 09/09/2015, 11:10
Báo cáo y học: "Evaluation of the Prevalence of Concomitant Idiopathic Cyclic Edema and Cellulit"
... causes of edema were excluded An evaluation for idiopathic cyclic edema is routinely made in the diagnosis of cellulite, in obesity and in other evident causes of clinical edema The diagnosis of idiopathic ... edema The observation of cyclic edema demonstrated the success of the treatment and the need for its control, but we had no idea of the...
Ngày tải lên: 25/10/2012, 10:51
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
... Manchikanti L, Manchikanti KN, Manchukonda R, et al Evaluation of lumbar facet joint nerve blocks in the management of chronic low back pain: A preliminary report of a randomized, double-blind controlled ... 20: 539-45 Schwarzer AC, Wang SC, Bogduk N, et al Prevalence and clinical features of lumbar zygapophysial joint pain: A study in an Austra...
Ngày tải lên: 26/10/2012, 09:07
Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"
... study reveals the kinetic pathway for an interfacial reaction Journal of the American Chemical Society 2004; 126: 15613-7 Pozsgay V, Vieira NE, Yergey A A method for bioconjugation of carbohydrates ... ring systems are commercially available or are easily to prepare By this means a wide range of dienophilic compounds is available for DARinv In order to obtain reaction times in...
Ngày tải lên: 26/10/2012, 09:39
Báo cáo y học: "Evaluation of maternal infusion therapy during pregnancy for fetal development"
... prevalence of infusion during the study pregnancy in any CA-groups On the other hand the maternal infusion during the study pregnancy showed 139 a lower occurrence in two CA-groups: hypospadias ... prevalence of maternal infusion in the group of total CAs, and within them, of hypospadias and multiple CAs Thus, we were not able to detect any teratogenic potential of...
Ngày tải lên: 02/11/2012, 11:08
Báo cáo y học: "Evaluation of Fractional Analysis of Bronchoalveolar Lavage Combined with Cellular Morphological Features"
... often had a foamy appearance Figure Morphology of hypersensitivity pneumonitis (HP) lymphocytes HP lymphocytes morphology and diameter varied considerably The cell morphology was consistent with ... primary objective of this study was to develop a sequential analysis of cells in FBAL with special references to the distribution of inflammatory cells in the airways and alveolar sa...
Ngày tải lên: 03/11/2012, 11:48
An evaluation of the material “basic english iii” for the second year non- english major students at bac giang teachers’ training college
... definitions of materials evaluation, purposes for materials evaluation, types of materials evaluation, materials evaluators, models for materials evaluation, criteria for materials evaluation, as ... purposes of materials evaluation, types of materials evaluation, materials evaluators, models for materials 16 evaluation and criteria for materials evaluation The...
Ngày tải lên: 07/11/2012, 14:50
Construction engineering students' evaluation of the esp programme at vinh university
... What are the learners’ evaluative comments on the ESP programme for Construction at Vinh University? 2) What are the learners’ needs for learning ESP at Vinh University? 3) How should the ESP programme ... issues in programme evaluation as follows: • What is the purpose of the evaluation? • Who is the audience for the evaluation? • What principles...
Ngày tải lên: 07/11/2012, 14:54
Evaluation of consolidation parame ters in CL tests
... corresponding value of TCL using the CCL vs TCL theoretical dependence Then CCL vs TCL is simply transformed into consolidation parameters: t(T = 1) and cv (Fig 8) In other CL tests (CRS and CG tests) ... delayed in compari- Evaluation of consolidation parameters in CL tests; theoretical and practical aspects 407 Table Geotechnical properties of soils and conditions...
Ngày tải lên: 22/03/2013, 15:01
Evaluation of institutional method used in teaching of english in secondary schools of Haripur District
... INSTITUTE OF EDUCATION AND RESEARCH UNIVERSITY OF PESHAWAR (2005) EVALUATION OF INSTRUCTIONAL METHODS USED IN TEACHING OF ENGLISH IN SECONDARY SCHOOLS OF HARIPUR DISTRICT Submitted ... successful in each and every sphere of this mortal life APPROVAL SHEET The thesis entitled Evaluation of instructional method used in teaching of English In...
Ngày tải lên: 10/04/2013, 10:37