a first example of a lyotropic smectic c analog phase

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on filamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTG...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt

Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt

... that the inhibitory effect of NAMI-A on c-myc gene expression may have occurred by suppressing ERK1/2 activation and activity elicited by PMA-generated signals Unlike the ras gene family, mutations ... relationship between the inhibitory effect of NAMI-A on ERK1/2 activation and NAMI-A- induced down regulation of c-myc gene expression NAMI-A inhibits...

Ngày tải lên: 21/02/2014, 01:21

10 703 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

... catalytic activity of a subunit toward calmodulin and for the activation by polybasic compounds The examination of amino-acid alignment in the acidic region of three Drosophila CK2 regulatory subunits ... coimmunoprecipitated with CK2 a subunit in Drosophila testes extracts Fig Analysis of oligomerization status of the CK 2a and CK2btes proteins by gel fi...

Ngày tải lên: 21/02/2014, 15:20

10 465 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

... long-chain acyl-CoA synthetase (mVLACS), human long-chain acyl-CoA synthetase (hLACS1), mouse mediumchain acyl-CoA synthetase proteins (mSA, mMACS1, mKS, and mKS2), mouse acetylCoA synthetase (mAceCS1), ... to the murine acetyl-CoA synthetase (AceCS) family was much less (20–30%) These observations indicate that the O-MACS protein is a novel member of the acyl-C...

Ngày tải lên: 08/03/2014, 02:20

10 394 0
Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt

Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt

... solutions of human polyclonal IgA and IgA1, human myeloma IgA2 and IgM, human secretory IgA, human polyclonal IgG, human myeloma IgD or recombinant mouse (light chain and VH): :human (epsilon 1–4 heavy ... surface Affinity recovery of IgA from a spiked E coli total lysate To investigate the potential use of the ZIgA1 affibody as an IgA-specific ligand in affinity chromatograp...

Ngày tải lên: 08/03/2014, 23:20

9 579 0
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc

Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc

... focus on the biochemical properties of both splice variants of hGBP5, hGBP 5a ⁄ b (amino acids 1 -58 6) and the C-terminally truncated hGBP5ta (amino acids 1-489), using isothermal titration calorimetry ... hGBP1 and other large GTPases, we analysed the enzymatic activity of hGBP 5a ⁄ b and hGBP5ta in a concentration-dependent manner Various concentrations of p...

Ngày tải lên: 15/03/2014, 10:20

9 462 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

... Ha and side chain protons The spin systems of Lys10 and Arg11 are indicated by rectangles as both contain a second HN in the side chain The N-terminal Gly1 appears as a weak and very broad peak ... FEBS 2004 Recombinant mutant of surfactant protein C (Eur J Biochem 271) 2077 Table Amino-acid sequences of several SP -C polypeptides, including human, porcine and re...

Ngày tải lên: 16/03/2014, 16:20

10 426 0
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx

Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx

... each relation the address of its parameters Of course, all of them are not to be filled in All the information thus annotated is then translated into an XML format Annotation of the example of ... Table 1: Annotated chunks and relations Annotation formalism The definition of the annotation formalism is the core element of the evaluation process Indeed, the formal...

Ngày tải lên: 17/03/2014, 22:20

4 323 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

... hepatitis < /b> B and < /b> hepatitis < /b> C are important public health problems and < /b> that there are several barriers to prevention < /b> and < /b> control < /b> efforts, such as a < /b> lack of < /b> knowledge and < /b> awareness about chronic ... chronic hepatitis < /b> B and < /b> hepatitis < /b> C, and < /b> conduct targeted active surveillance to monitor incid...

Ngày tải lên: 22/03/2014, 17:20

4 405 1
Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt

Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt

... example of a C ∗ -algebra A for which Ext (A) is not a group Introduction A random matrix X is a matrix whose entries are real or complex random variables on a probability space (Ω, F, P ) As in ... Annals of Mathematics, 162 (2005), 711–775 A new application of random matrices: ∗ Ext(Cred(F2)) is not a group By Uffe Haagerup and Steen Thorbjørn...

Ngày tải lên: 22/03/2014, 20:20

66 378 0
THE FIRST BANK OF THE UNITED STATES - A CHAPTER IN THE HISTORY OF CENTRAL BANKING pdf

THE FIRST BANK OF THE UNITED STATES - A CHAPTER IN THE HISTORY OF CENTRAL BANKING pdf

... of its capitalization made the First Bank not only the largest financial institution in the new nation but also the largest corporation of any type by far The bank s sale of shares was also the ... United States 11 rates and thus bank profits Without the restraining hand of the Bank of the United States, state banks became less cautious in their...

Ngày tải lên: 22/03/2014, 21:20

20 695 0
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

... G A G A A A A A AT T TA A G AT C T AT T T G A A C T A G A C C A AT G C T G G G A G A A A A A AT T TA A G AT C T Mut A AT T T G A A C T G T G A A G AT G C T G G G A G A A A A A AT T TA A G AT ... together, these data establish LIN54 as an essential member of the LINC ⁄ DREAM complex delayed entry into mitosis [9] To address whether...

Ngày tải lên: 23/03/2014, 04:20

14 456 0
w