a first example of a lyotropic smectic c analog phase
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on filamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC...
- 11
- 679
- 0
Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt
... that the inhibitory effect of NAMI-A on c-myc gene expression may have occurred by suppressing ERK1/2 activation and activity elicited by PMA-generated signals Unlike the ras gene family, mutations ... relationship between the inhibitory effect of NAMI-A on ERK1/2 activation and NAMI-A- induced down regulation of c-myc gene expression NAMI-A inhibits c-myc gene transcription and protein expression To ... establish whether the decrease in c-myc mRNA expression elicited by NAMI-A might have occurred at the transcriptional level, we assessed the rate of transcription of the c-myc gene by using an...
- 10
- 703
- 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx
... catalytic activity of a subunit toward calmodulin and for the activation by polybasic compounds The examination of amino-acid alignment in the acidic region of three Drosophila CK2 regulatory subunits ... coimmunoprecipitated with CK2 a subunit in Drosophila testes extracts Fig Analysis of oligomerization status of the CK 2a and CK2btes proteins by gel filtration The CK 2a and CK2btes proteins alone or in the ... reasonable to suppose a possibility of a replacement of one b subunit by another in the case of a deficiency of any of the subunits, i.e a so called ÔbypassÕ mechanism may operate in order to maintain...
- 10
- 464
- 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... long-chain acyl-CoA synthetase (mVLACS), human long-chain acyl-CoA synthetase (hLACS1), mouse mediumchain acyl-CoA synthetase proteins (mSA, mMACS1, mKS, and mKS2), mouse acetylCoA synthetase (mAceCS1), ... to the murine acetyl-CoA synthetase (AceCS) family was much less (20–30%) These observations indicate that the O-MACS protein is a novel member of the acyl-CoA synthetase family, belonging to the ... octanoate; C10, decanoate, C12, dodecanoate, C16, palmitate, BA, benzoate The data are means ± SD of triplicate assays transcripts for the SA and MACS1 genes are present only in the RE area of the...
- 10
- 393
- 0
Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt
... solutions of human polyclonal IgA and IgA1, human myeloma IgA2 and IgM, human secretory IgA, human polyclonal IgG, human myeloma IgD or recombinant mouse (light chain and VH): :human (epsilon 1–4 heavy ... surface Affinity recovery of IgA from a spiked E coli total lysate To investigate the potential use of the ZIgA1 affibody as an IgA-specific ligand in affinity chromatography applications, an affinity ... polyclonal IgA1 (Calbiochem, USA, cat no 400105), human myeloma IgA2 (Calbiochem, cat no 400110), human myeloma IgM (Pharmacia Diagnostics), human polyclonal IgG (Pharmacia, Sweden), human myeloma...
- 9
- 579
- 0
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc
... focus on the biochemical properties of both splice variants of hGBP5, hGBP 5a ⁄ b (amino acids 1 -58 6) and the C-terminally truncated hGBP5ta (amino acids 1-489), using isothermal titration calorimetry ... hGBP1 and other large GTPases, we analysed the enzymatic activity of hGBP 5a ⁄ b and hGBP5ta in a concentration-dependent manner Various concentrations of purified hGBP 5a ⁄ b and hGBP5ta were incubated ... Biophysical properties of hGBP 5a ⁄ b and hGBP5ta M Wehner and C Herrmann hand, interact dynamically with the bound nucleotide, and usually bind nucleotides in the micromolar range In addition to these...
- 9
- 462
- 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt
... Ha and side chain protons The spin systems of Lys10 and Arg11 are indicated by rectangles as both contain a second HN in the side chain The N-terminal Gly1 appears as a weak and very broad peak ... FEBS 2004 Recombinant mutant of surfactant protein C (Eur J Biochem 271) 2077 Table Amino-acid sequences of several SP -C polypeptides, including human, porcine and recombinant human SPC with FFI ... resonances implies that we are observing speci c oligomers Finally, chemical shifts of the Ha resonances are a clear indication that both oligomers are mainly a- helical and that their structures...
- 10
- 426
- 0
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx
... each relation the address of its parameters Of course, all of them are not to be filled in All the information thus annotated is then translated into an XML format Annotation of the example of ... Table 1: Annotated chunks and relations Annotation formalism The definition of the annotation formalism is the core element of the evaluation process Indeed, the formalism must have a coverage ... number of parsers will allow the production of a good quality validated linguistic resource Indeed, we will produce the automatic fusion of all annotated data of the parsers, and then manually...
- 4
- 323
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf
... hepatitis < /b> B and < /b> hepatitis < /b> C are important public health problems and < /b> that there are several barriers to prevention < /b> and < /b> control < /b> efforts, such as a < /b> lack of < /b> knowledge and < /b> awareness about chronic ... chronic hepatitis < /b> B and < /b> hepatitis < /b> C, and < /b> conduct targeted active surveillance to monitor incidence and < /b> prevalence of < /b> hepatitis < /b> B and < /b> hepatitis < /b> C in populations not fully captured by core surveillance ... being allocated to viral hepatitis < /b> prevention,< /b> control,< /b> and < /b> surveillance programs Increased knowledge and < /b> awareness about chronic viral hepatitis,< /b> improved surveillance for < /b> hepatitis < /b> B and < /b> hepatitis...
- 4
- 404
- 1
Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt
... example of a C ∗ -algebra A for which Ext (A) is not a group Introduction A random matrix X is a matrix whose entries are real or complex random variables on a probability space (Ω, F, P ) As in ... Annals of Mathematics, 162 (2005), 711–775 A new application of random matrices: ∗ Ext(Cred(F2)) is not a group By Uffe Haagerup and Steen Thorbjørnsen* Dedicated to the memory of Gert ... for all separable unital C ∗ -algebras A Anderson [An] provided in 1978 the first example of a unital C ∗ -algebra A for which Ext (A) is not a group The C ∗ -algebra A in [An] is generated by the...
- 66
- 378
- 0
THE FIRST BANK OF THE UNITED STATES - A CHAPTER IN THE HISTORY OF CENTRAL BANKING pdf
... of its capitalization made the First Bank not only the largest financial institution in the new nation but also the largest corporation of any type by far The bank s sale of shares was also the ... United States 11 rates and thus bank profits Without the restraining hand of the Bank of the United States, state banks became less cautious in their lending habits and credit expanded rapidly In ... and the Bank of Massachusetts Economic historian David Cowen calls this “arguably the most important ‘all-nighter’ in American banking history. ” See Cowen, p 10 The First Bank of the United States...
- 20
- 695
- 0
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt
... G A G A A A A A AT T TA A G AT C T AT T T G A A C T A G A C C A AT G C T G G G A G A A A A A AT T TA A G AT C T Mut A AT T T G A A C T G T G A A G AT G C T G G G A G A A A A A AT T TA A G AT ... together, these data establish LIN54 as an essential member of the LINC ⁄ DREAM complex delayed entry into mitosis [9] To address whether this is an isolated function of LIN9 or whether it is ... integral and essential subunit of this complex To analyze the function of LIN54, we created a set of deletion mutants Using these mutants, we found that a region of LIN54 that is predicted to form an...
- 14
- 456
- 0
Từ khóa: first example of monitoring metal pollutionexample of a header file in clistening carefully to a song the first time you hear it is an example of794 state assignment example a adjacency diagram b a 2 cube c one of eight possas root create a file system on the first slice of a newly partitioned disk for examplešmaking a blood smear a placing second slide at a 23eangle b blood distributing itself along second slide™s edge c drawing blood across surface of slide d example of a properly prepared blood smearexample of a business plan for investorsthe first law of thermodynamics states that energy in a system isthe first law of thermodynamics is a restatement of themy first experience of learning a foreign language was with frenchthe first law of thermodynamics is a restatement of which of these lawsthe first law of thermodynamics is a restatement of the quizletthe first law of thermodynamics is a restatement of the law of conservation of momentumgive an example of a conflict of interest in scienceexample of a business letter to a doctorNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI