79 Domain and Range math 123

79 Domain and Range math 123

79 Domain and Range math 123

... • Range = {6, 5.75, 5, 6.5} More Examples • Consider the following relation: • Is this a function? • What is domain and range? Visualizing domain of Visualizing range of • Domain = [0, ∞) Range ... Hint: Is domain of A(r) correct? Closer look at A(r) = πr2 • Can a circle have r ≤ ? • NOOOOOOOOOOOOO • Can a circle have area equal to ? • NOOOOOOOOOOOOO Domain and Range of...

Ngày tải lên: 15/06/2017, 20:03

24 302 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc

... both a novel C-terminal actin- binding submodule (CABS) containing a novel actin monomer binding verprolin homology C-terminal (VH2-C) domain and a second submodule comprising the previously characterized ... actinbinding domain (this actin- binding domain has not yet been mapped) [23] We name the actin- binding domain that we have identified VH2-C and VH2-...

Ngày tải lên: 18/02/2014, 16:20

23 680 0
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf

... Discussion The SCO2299 protein from S coelicolor The SCO2299 gene from S coelicolor was shown to encode a bifunctional enzyme consisting of an RNase H domain and an APase domain The RNase H and APase activities ... other hand, the N-terminal RNase H domain showed no phosphatase 2831 A fusion protein consisting of RNase H a...

Ngày tải lên: 19/02/2014, 18:20

10 561 1
Tài liệu Báo cáo khoa học: "Generalization Methods for In-Domain and Cross-Domain Opinion Holder Extraction" pdf

Tài liệu Báo cáo khoa học: "Generalization Methods for In-Domain and Cross-Domain Opinion Holder Extraction" pdf

... (Wiebe et al., 2005) We adhere to the definition of opinion holders from previous work (Wiegand and Klakow, 2010; Wiegand and Klakow, 2011a; Wiegand and Klakow, 2011b), i.e every source of a private ... opinion holders and therefore can be seen as a proxy (4) I always supported this idea holder: agent (5) This worries me holder: patient (6) He disappointed me holder: patient We...

Ngày tải lên: 22/02/2014, 02:20

11 428 0
Tài liệu Báo cáo khoa học: "Exploring the Use of Linguistic Features in Domain and Genre Classification" potx

Tài liệu Báo cáo khoa học: "Exploring the Use of Linguistic Features in Domain and Genre Classification" potx

... assigned the class of the majority of the items which reached it during training The trees were grown using recursive partitioning; the splitting criterion was reduction in deviance Using the Gini index ... texts of argumentative types The frequency of infinitives of auxiliaries reflects both the use of passive voice, which is formed with the auxiliary "war-...

Ngày tải lên: 22/02/2014, 03:20

8 690 1
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

12 561 0
Báo cáo khoa học: The ROQUIN family of proteins localizes to stress granules via the ROQ domain and binds target mRNAs pdf

Báo cáo khoa học: The ROQUIN family of proteins localizes to stress granules via the ROQ domain and binds target mRNAs pdf

... within the ROQ domain To test whether the ROQ domain is involved in regulation of Icos expression, we used the pR-IRES–GFP retroviral vector [1], to express either RoquinWT, RoquinM199R or the Roquin ... Taken together, these results show that the ROQ domain is essential for Roquin s repression of Icos mRNA Roquin binds Icos mRNA To determine whether Ro...

Ngày tải lên: 15/03/2014, 11:20

19 542 0
Báo cáo khoa học: "The effect of domain and text type on text prediction quality" pptx

Báo cáo khoa học: "The effect of domain and text type on text prediction quality" pptx

... spierdystrofie Conclusions In Section 1, we asked two questions: (1) “What is the effect of text type differences on the quality of a text prediction algorithm?” and (2) “What is the best choice of training ... data if domain- and text type- specific data is sparse?” By training and testing our text prediction algorithm on four different text types (Wikipedia...

Ngày tải lên: 17/03/2014, 22:20

9 465 0
Báo cáo Y học: Interactions between the Fyn SH3-domain and adaptor protein Cbp/PAG derived ligands, effects on kinase activity and affinity docx

Báo cáo Y học: Interactions between the Fyn SH3-domain and adaptor protein Cbp/PAG derived ligands, effects on kinase activity and affinity docx

... arrays [22] (C) Secondary structure elements of the Fyn SH3-domain The five b strands, numbered consecutively, are separated by the interaction loops (bold) making primary contacts with the ligand ... dependent on an initial interaction between the first prolinerich region of PAG and the SH3-domain of the kinase Fyn Our earlier investigations have highlighted the...

Ngày tải lên: 24/03/2014, 00:21

12 617 0
Báo cáo khoa học: Oligomerization states of the association domain and the holoenyzme of Ca2+ ⁄CaM kinase II pptx

Báo cáo khoa học: Oligomerization states of the association domain and the holoenyzme of Ca2+ ⁄CaM kinase II pptx

... state of the holoenzyme and that of the crystal structure of the association domain is unknown Although the association domain is necessary and sufficient for formation of oligomeric CaMKII [18,19], ... 2–311 of CaMKII (which encompasses the kinase domain and the auto-inhibitory segment, and is acetylated on the N-terminus) The other peak contained...

Ngày tải lên: 30/03/2014, 11:20

13 320 0
Báo cáo khoa học: "Chinese Numbers, MIX, Scrambling, and Range Concatenation Grammars" doc

Báo cáo khoa học: "Chinese Numbers, MIX, Scrambling, and Range Concatenation Grammars" doc

... relation if and only if /SA(p") ~ * len(l, X ) checks that the size of the range denoted by the variable X is the integer l, and • eq(X, Y ) checks that the substrings selected by the ranges X and Y ... argument, and if (XoaY, i) is an element of the mapping, we know that (Xa • Y, i + 1) must be another element Moreover, if we know that the size of the range X is and that the si...

Ngày tải lên: 31/03/2014, 21:20

8 230 0
Báo cáo sinh học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt

Báo cáo sinh học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt

... carrying operators 5'GGTGGATGTCAAG and 5'GGTGGCTGTCAAG as O64 and OL, respectively, and shown that CI binds to former operator more strongly than latter operator Interestingly, repressor- operator ... but also to stop the elongation of L5 transcripts Additional studies reveal that affinity of CI to an L1 operator (5'GGTGGCTGTCAAG) decreases notably at 42°C compare...

Ngày tải lên: 18/06/2014, 18:20

8 495 0
Báo cáo hóa học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt

Báo cáo hóa học: " Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different asymmetric operator DNAs with variable affinity" ppt

... carrying operators 5'GGTGGATGTCAAG and 5'GGTGGCTGTCAAG as O64 and OL, respectively, and shown that CI binds to former operator more strongly than latter operator Interestingly, repressor- operator ... but also to stop the elongation of L5 transcripts Additional studies reveal that affinity of CI to an L1 operator (5'GGTGGCTGTCAAG) decreases notably at 42°C compare...

Ngày tải lên: 20/06/2014, 01:20

8 362 0
Từ khóa:
w