Báo cáo khoa học: ION EXCHANGE CHROMATOGRAPHY IN FOOD ANALYSIS

Báo cáo khoa học: "Role of Verbs in Document Analysis" pot

Báo cáo khoa học: "Role of Verbs in Document Analysis" pot

... selected subordinate verbs, n = 10,295) The goal of our research is to identify the role of verbs, keeping in mind that event profile is but one of m a n y factors in determining text type In our study, ... research in terms of verb coverage and in terms of article coverage For verbs, we plan to (1) increase the verbs that we cover to include phrasal verbs; (2) incre...

Ngày tải lên: 08/03/2014, 05:21

7 416 0
Báo cáo khoa học: Metal exchange in metallothioneins – a novel structurally significant Cd5 species in the alpha domain of human metallothionein 1a ppt

Báo cáo khoa học: Metal exchange in metallothioneins – a novel structurally significant Cd5 species in the alpha domain of human metallothionein 1a ppt

... shown in the spacefilling model as located in the center of the domain Metal exchange of Zn 4a- rhMT 1a with Cd2+ The exchange reaction of the Zn-substituted a domain with Cd2+ was investigated by ... present in the a domain of human MT 1a (C) Space-filling and ribbon representations of the recombinant Cd 4a- rhMT 1a Numbering of metal i...

Ngày tải lên: 16/03/2014, 06:20

13 439 0
Báo cáo khoa học: Ion channel activity of brain abundant protein BASP1 in planar lipid bilayers pptx

Báo cáo khoa học: Ion channel activity of brain abundant protein BASP1 in planar lipid bilayers pptx

... currents across planar lipid bilayers Results BASP1 exhibits single channel- like activity on planar lipid bilayers The activity of BASP1 and GAP-43 proteins in negatively-charged lipid bilayers under ... transformation by brain acid-soluble protein (BASP1) Proc Natl Acad Sci USA 106, 5604–5609 Ion channel activity of BASP1 35 Zakharov VV & Mosevitsk...

Ngày tải lên: 28/03/2014, 23:20

9 319 0
Báo cáo khoa học: "Gas exchange in young Scots pine following pruning of current shoots" pot

Báo cáo khoa học: "Gas exchange in young Scots pine following pruning of current shoots" pot

... attack by cutting all current shoots in the upper crown of 20-yrold Scots pines while in situ gas exchange of 1-yr-old needles was followed continuously before and after the "attack" pine MATERIAL ... Troeng E, Linder S, Langström B (1979) Gas exchange in a 20-year-old stand of Scots pine V Pilot study on the effects on gas exchange during the attack of pine sh...

Ngày tải lên: 08/08/2014, 23:22

8 240 0
báo cáo khoa học: " Information exchange networks for chronic illness care in primary care practices: an observational study" pps

báo cáo khoa học: " Information exchange networks for chronic illness care in primary care practices: an observational study" pps

... connection Overlapping information exchange networks in a practice, for example, regarding different chronic diseases, will enhance the speed of information exchange and likelihood of uptake in professional ... and for giving and receiving information separately A simple tick box response format to indicate ‘yes’ was used The information being exchanged might concern i...

Ngày tải lên: 11/08/2014, 16:20

10 286 0
Báo cáo khoa học: "Acetazolamide-mediated decrease in strong ion difference accounts for the correction of metabolic alkalosis in critically ill patients" pps

Báo cáo khoa học: "Acetazolamide-mediated decrease in strong ion difference accounts for the correction of metabolic alkalosis in critically ill patients" pps

... explained by modulation of the urinary excretion of strong ions We hypothesized that acetazolamide, by inhibiting carbonic anhydrase in the proximal tubules, causes excretion of strong cations ... retention of chloride, and in this way decreases the serum SID Subsequently, the decrease in SID will correct an alkalosis by causing dissociation of water and format...

Ngày tải lên: 12/08/2014, 23:21

6 223 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... Acta Veterinaria Scandinavica 2009, 51:36 Background Files with information on animal disease have a variety of applications at both the herd and national level, including monitoring the incidence ... the aim was to reveal perceptions and reasoning behind generation of data and to describe the interaction and relations between the recording of metritis scores and...

Ngày tải lên: 25/10/2012, 10:45

10 588 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC ... RPE6 5a- His-Fwd NA TGCARRAAYATHTTYTCCAG AYRAAYTCRWRBCCYTTCCA GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTT...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

... describing systems biology applied to biochemistry in the years 2000–2010 employing the ten most commonly used software tools models, lindo (Lindo Systems Inc., Chicago, IL, USA; www.lindo.com) and ... found using the keyword systems biology actually reflect applications of systems biology approaches to biological systems resulting in new biological insights However, on...

Ngày tải lên: 14/02/2014, 14:20

91 733 0
Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

... phosphorylation levels of BTK SYK ITK SYK was highly phosphorylated in both COS7 and 293T cells and did not vary like BTK SYK; therefore, the differences in the PH–TH domains remain the decisive factor ... capacity, we constructed the corresponding fusion kinase BTK SYK, harboring the PH–TH domain doublet (amino acids 1–1 96) of BTK fused with the linker B kina...

Ngày tải lên: 14/02/2014, 18:20

10 927 0
Tài liệu Báo cáo khoa học: RMI1 deficiency in mice protects from diet and genetic-induced obesity pptx

Tài liệu Báo cáo khoa học: RMI1 deficiency in mice protects from diet and genetic-induced obesity pptx

... diet- induced obesity in RMI1+ /) mice Wild-type (RMI1+ ⁄ +) and heterozygous (RMI1+ ⁄ )) littermate mice were created via in vitro fertilization using a single RMI1+ ⁄ ) male At weeks of age, the individually ... tolerance test showed that diet- induced glucose intolerance improved significantly in RMI1+ ⁄ ) mice (Fig 2C,D) Insulin levels did not differ between RMI1+ ⁄ +...

Ngày tải lên: 16/02/2014, 09:20

10 694 0
Tài liệu Báo cáo khoa học: SREBPs: SREBP function in glia–neuron interactions pdf

Tài liệu Báo cáo khoa học: SREBPs: SREBP function in glia–neuron interactions pdf

... exception- SREBP function in glia–neuron interactions ally high lipid ⁄ protein ratio The myelin membrane contains myelin-specific proteins, such as myelin protein zero, peripheral myelin protein-22, ... al sion of SREBP- 1 in the brain does increase in mice during aging [39], a phenomenon also observed in the peripheral nerve [3] The meaning of this aging-related increase in...

Ngày tải lên: 18/02/2014, 13:20

9 711 1
Tài liệu Báo cáo khoa học: Transcriptional upregulation of inflammatory cytokines in human intestinal epithelial cells following Vibrio cholerae infection pptx

Tài liệu Báo cáo khoa học: Transcriptional upregulation of inflammatory cytokines in human intestinal epithelial cells following Vibrio cholerae infection pptx

... of cytokines upon V cholerae infection in intestinal epithelial cells Reports have shown the induction of IL-8 in intestinal epithelial cells upon V cholerae infection [11–13] The induction of ... upregulation of many proinflammatory mediators, such as cytokines [14] However, little is known about the role of V cholerae in initiating and sustaining t...

Ngày tải lên: 18/02/2014, 16:20

12 462 0
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

... Discussion The main finding of this study is the identification of a metabolic gene switch from fatty acids to glucose in the murine female heart at baseline linked to enhanced mitochondrial respiratory ... al Metabolic gene switching in murine female heart function [8] Likewise, high fatty acid oxidation rates in the diabetic heart results in...

Ngày tải lên: 18/02/2014, 16:20

7 582 0
Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx

Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx

... Thus, integrin-dependent cell volume sensing and signaling integrates into the overall context of insulin signaling Similarly, sensing of glutamine-induced hepatocyte swelling by integrins feeds into ... Osmosensing and signaling in mammalian cell function F Schliess et al [7] On the other hand, hyperosmotic shrinkage prevents insulin-induced hepatocyte swelling...

Ngày tải lên: 18/02/2014, 16:20

5 792 0
w