Its fun to read label the magician

Báo cáo khoa học: "Learning to “Read Between the Lines” using Bayesian Logic Programs" pptx

Báo cáo khoa học: "Learning to “Read Between the Lines” using Bayesian Logic Programs" pptx

... performance to theirs Therefore, we compared to the following methods: • Logical Deduction: This method forward chains on the extracted facts using the firstorder rules learned by L IME to infer ... relevant to the query Doppa et al (2010) use FARMER (Nijssen and Kok, 2003), an existing ILP system, to learn firstorder rules They propose several approaches to score the ru...

Ngày tải lên: 30/03/2014, 17:20

10 376 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

... archaebacteria Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ ... Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the la...

Ngày tải lên: 05/09/2013, 09:38

7 720 0
Tài liệu Using the Get* Methods to Read Column Values doc

Tài liệu Using the Get* Methods to Read Column Values doc

... You can see the SQL Server types and the values supported by those types in Table 2.3 of Chapter 2, "Introduction to Databases." Note The Get* methods are defined in all of the DataReader classes ... C# type You use this table to figure out which method to call to get a specific column type For example, if you need to get the value of a bigint column, you call th...

Ngày tải lên: 24/12/2013, 01:17

3 349 0
Tài liệu Báo cáo khoa học: "Organizing Encyclopedic Knowledge based on the Web and its Application to Question Answering" ppt

Tài liệu Báo cáo khoa học: "Organizing Encyclopedic Knowledge based on the Web and its Application to Question Answering" ppt

... Nichigai dictionary On the other hand, in the case where random choice was performed, the Nichigai dictionary and the Webbased encyclopedia were comparable in terms of both the coverage and accuracy ... Examinations The Class II examination consists of quadruple-choice questions, among which technical term questions can be subdivided into two types In the first type of que...

Ngày tải lên: 20/02/2014, 18:20

8 508 1
Tài liệu The Secret Language of Business: How to Read Anyone docx

Tài liệu The Secret Language of Business: How to Read Anyone docx

... Have fun! The study of The Secret Language of Business and the application of its principles can be a whole lot of fun if you let it be Look at people on TV to see examples of some of the topics ... scientific experts to figure out the finer points and move on to the more practical aspects of body language My goal is to help you understand The Secret...

Ngày tải lên: 21/02/2014, 03:20

258 767 0
Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf

Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf

... Both transitions to latent and substrate forms were strongly but differently influenced by the amino-acid composition of the shutter region Surprisingly, we found that substitution of Lys335 to ... investigate the importance of the shutter region for the unique types of RCL insertion in PAI-1, we have now undertaken a number of substitutions in...

Ngày tải lên: 22/02/2014, 07:20

10 431 0
The Savings and Loan Crisis and Its Relationship to Banking pptx

The Savings and Loan Crisis and Its Relationship to Banking pptx

... favor in order to keep regulators from interfering in their operations 180 History of the Eighties—Lessons for the Future Chapter The Savings and Loan Crisis and Its Relationship to Banking with ... Future Chapter The Savings and Loan Crisis and Its Relationship to Banking partly to the fact that members of both political parties were vulnerab...

Ngày tải lên: 06/03/2014, 10:20

22 447 0
Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx

Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx

... effect of HFE binding to TfR1 is to lower the affinity of the receptor for transferrin [15] This most likely reflects the existence of overlapping HFE and transferrin- binding sites on the receptor ... understanding suggests that the majority of cell types regulate cellular iron levels by binding of transferrin to the type transferrin recepto...

Ngày tải lên: 06/03/2014, 22:21

16 538 0
Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot

Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot

... activation of these genes within the same time window The activator-binding domains in the Swi1 and Snf5 subunits of the SWI ⁄ SNF complex are essential for recruitment of the SWI ⁄ SNF complex to these ... regions of SWI ⁄ SNF cannot replace the recruiting function of the Swi1 and Snf5 activator-binding domains The...

Ngày tải lên: 07/03/2014, 00:20

9 539 0
Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx

Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx

... case of the more general principle of flux minimization It has to be noted, furthermore, that minimization of fluxes in a metabolic system is closely linked to minimization of enzyme levels, because ... protein, protein interactions, enzymes, metabolites) can be used to build up mathematical models of the gene-regulatory, signal-transducing and metabolic network...

Ngày tải lên: 07/03/2014, 15:20

18 800 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...

Ngày tải lên: 07/03/2014, 16:20

12 772 0
Báo cáo khoa học: The Rab5 effector Rabaptin-5 and its isoform Rabaptin-5d differ in their ability to interact with the small GTPase Rab4 doc

Báo cáo khoa học: The Rab5 effector Rabaptin-5 and its isoform Rabaptin-5d differ in their ability to interact with the small GTPase Rab4 doc

... therefore used this assay to analyze the interaction of Rabaptin-5d with Rab4 and Rab5 Similarly to Rabaptin-5, Rabaptin-5d was not able to bind Rab4 or Rab5 in the inactive, GDP-bound form as ... Rab4 binding domain, and the region deleted in Rabaptin-5d are numbered according to the amino acid sequence of mouse Rabaptin-5 (GeneBank Accession No D...

Ngày tải lên: 16/03/2014, 18:20

10 411 0
What is Health Literacy? Health literacy is the ability to read, understand, and act on health care information. pdf

What is Health Literacy? Health literacy is the ability to read, understand, and act on health care information. pdf

... ramifications for health care professionals It is up to the health care system to be sure patients understand the information they receive well enough to apply it • The Food and Drug Administration, ... functional literacy is in the bottom 20% compared to the rest of the population Average per person expenditures were greater among those most likely to ha...

Ngày tải lên: 22/03/2014, 15:21

18 878 0
Stress and Performance - A Review of the Literature and Its Applicability to the Military pdf

Stress and Performance - A Review of the Literature and Its Applicability to the Military pdf

... peer review to ensure that they meet high standards for research quality and objectivity Stress and Performance A Review of the Literature and Its Applicability to the Military Jennifer Kavanagh ... 198 1Stress and performance : a review of the literature and its applicability to the military / Jennifer Kavanagh p cm “TR-192.” Inclu...

Ngày tải lên: 29/03/2014, 18:20

86 607 0
05 the arabic alphabet how to read and write it

05 the arabic alphabet how to read and write it

... Awde and Putros Samano THE ARABIC ALPHABET How to Read and Write it SAQI www.uz-translations.net CONTENTS A Word to the Reader Introduction to Arabic 13 The Alphabet and Writing System 21 The ... The best way to learn the alphabet is not to try to memorize a complicated table , but to take each letter one by one, to learn the basic sbape f...

Ngày tải lên: 03/04/2014, 12:40

47 603 0
Từ khóa:
w