... Tyr158, Glu2 12, Arg215 and Trp246 in ricin) and another ve conserved residues (Asn 72, Arg 124 , Gln160, Glu195 and Asn196 in abrin -a and abrin-c and Asn78, Arg134, Gln1 72, Glu208 and Asn209 in ricin) ... Journal 27 2 (20 05) 120 1 121 0 ê 20 05 FEBS 120 3 Pulchellin A- chain: cloning and structural studies A A L C Silva et al B C Fig (A) A- chain expression anal...
Ngày tải lên: 07/03/2014, 16:20
... observed in of patients with RCC in this study confirmed the efficacy of everolimus in Chinese patients with RCC, consistent with experience from the larger phase III study in RCC [11] At the time of ... al.: Two-dose-level confirmatory study of the pharmacokinetics and tolerability of everolimus in Chinese patients with advance...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "Understanding uptake of continuous quality improvement in Indigenous primary health care: lessons from a multi-site case study of the Audit and Best Practice for Chronic Disease project" ppt
... article as: Gardner et al., Understanding uptake of continuous quality improvement in Indigenous primary health care: lessons from a multi-site case study of the Audit and Best Practice for Chronic ... mitigate against the successful uptake of innovations like ABCD High among these was the turnover and shortage of staff in many In...
Ngày tải lên: 11/08/2014, 05:21
Stable solid dosage forms of amlodipine besylate and processes for their preparation
Ngày tải lên: 14/06/2016, 22:04
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc
... 5¢-CAGAATTCatg gagcagaagctgatctccgaggaggacctgctgGTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG CCTATGTTCTTATAATG-3¢ (An engineered EcoRI recognition ... the coupling of M2 with GOA-1 We prepared an M2 mutant: :GOA-1 fusion protein and directly assessed the muscarinic- ligand-dependent activation of GOA-1 Results Expressio...
Ngày tải lên: 07/03/2014, 11:20
Comparative Study of HIV Associated Pulmonary Tuberculosis in Chest Clinics from Two Regions of Edo State, Nigeria docx
... with that induced by HIV In 1992, WHO estimated that about million people have been infected with both M tuberculosis and HIV since the beginning of the pandemic, with 95% being in developing countries.10 ... difference in the incidence of HIV, PTB and HIV- PTB in the two regions Whereas, the significantly high incidence of PTB recorded among people above 60 years i...
Ngày tải lên: 22/03/2014, 18:20
Báo cáo khoa học: Crystal structures of open and closed forms of D-serine deaminase from Salmonella typhimurium – implications on substrate specificity and catalysis pptx
... enzymes and undergoes conformational change from an open unliganded state to a closed liganded state It has a low affinity for the cofactor PLP under the conditions of crystallization An ion bound ... (residues 4 3–7 5, 10 9–2 38) and a large domain (residues 1–4 2, 7 6–1 08 and 23 9–4 40) The small domain folds as an open twisted a ⁄ b structure consisting of a fou...
Ngày tải lên: 28/03/2014, 22:20
Báo cáo hóa học: " Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics" ppt
... investigation, we carried out a systematic and extended mutational screening of 12S rRNA gene in a cohort of 440 hearing- impaired Han Chinese pediatric subjects from two otology clinics at Ningbo ... examining the allelic frequency in 449 Han Chinese control population Nineteen out of 41 variants were absent in this Chinese control population O...
Ngày tải lên: 18/06/2014, 16:20
báo cáo sinh học:" Job satisfaction and motivation of health workers in public and private sectors: cross-sectional analysis from two Indian states" ppt
... article as: Peters et al.: Job satisfaction and motivation of health workers in public and private sectors: cross-sectional analysis from two Indian states Human Resources for Health 2010 8:27 Submit ... aspects of health workers job satisfaction and motivation in different settings in two states in India: Andhra Pradesh (AP) and Utta...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo nghiên cứu khoa học: " BUILDING A GOOD IMAGE FROM TWO COLOR IMAGES OF CAMERA MODEL USING GA AND DISCRETE WAVELET TRANSFORM" pptx
... perform the analysis and synthesis on each color separately to build a good color image Fig and are two red color images perceived from two original color image 4a and 4b After passing these images ... view Left Camera Right Camera Left Image Right Image Common Image Left Image Right Image Good Image Diagram Two- camera system 2.2.The Posi...
Ngày tải lên: 22/07/2014, 02:21
Báo cáo toán học: "Two finite forms of Watson’s quintuple product identity and matrix inversion" pptx
... different finite form of this identity was independently discovered by Guo and Zeng [6, Theorem 8.1] via recurrence approach Their result is Theorem (Another finite form of Watson’s quintuple product identity) ... new and perhaps the simplest proof, Chen, Chu and Gu [4] found that it can be derived simply from the following almost-trivial algebraic identity, called a...
Ngày tải lên: 07/08/2014, 13:21
Báo cáo lâm nghiệp: "Botanical determinants of foliage clumping and light interception in two-year-old coppice poplar canopies: assessment from 3-D plant mock-ups" ppsx
... alternating inter-row distances of 0.75 m and 1.5 m, and a within row spacing of 0.9 m, to yield a planting density of plant m−2 From model outputs, basic structural plant dimensions and canopy ... maximising light interception and C gain at plant level According to our results, leaves with a longer petiole and/ or a narrow blade benefit both clones in light int...
Ngày tải lên: 07/08/2014, 16:21
Báo cáo khoa học: "Infrared spectroscopy characterization of normal and lung cancer cells originated from epithelium" pdf
... band at ∼1,650 cm 1 Table Spectral data and vibrational assignments of normal and lung cancer cells* Normal cells † (NHBE ) Cancer cells (NCI-H358) Cancer cells (NCI-H460) 1,649 1,548 1,456 1,400 ... lung cancer cells The NCI-H460 lung cancer cells originated from a patient with large cell cancer of the lung (ATCC catalog number: HTB-177), which...
Ngày tải lên: 07/08/2014, 23:22