... MarketWise Trading School, L.L.C OPTION EXCHANGES It wasn’t until 1973 when the Chicago Board Options Exchange (CBOE), the first options exchange in the U.S., opened its doors that the options trading ... Successful options trading involves implementation of the same sound trading rule that is used in equity trading which is; plan your trade then trade your plan I’ve often d...
Ngày tải lên: 19/10/2012, 16:16
... movement; • Was able to eliminate currency risk for the Germany supplier Bae Currency Futures versus Currency Options Currency Futures Obligation to buy/sell FC Currency Options Right to buy/sell ... General Rules General Rules on Using Currency Options versus Currency Futures When the quantity of FC cash outflow is known, buy currency forward; when unknown, buy a c...
Ngày tải lên: 24/01/2014, 06:20
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average efficiency ± SD Template Optimal PCR conditions Cocktail PCR...
Ngày tải lên: 14/02/2014, 19:20
A FOREIGN EXCHANGE PRIMER By FRANKLIN ESCHER doc
... afterward There used to be a saying among exchange dealers that cotton exports make exchange faster than anything, but nowadays bond sales abroad have come to take first place For foreign participation ... bought and sold in the exchange market A finance bill looks exactly the same as a long bill drawn by a banker for a commercial customer who wants to anticipate the paym...
Ngày tải lên: 15/03/2014, 00:20
A Project Management Primer or “a guide on how to make projects work” ppt
... a primary contact name, contact details and a list of all sales to the customer within the past sales year • Contact details must consist of a phone number, an address and an optional email address ... standards a project manager establishes the basis for negotiations and the tone in which they are conducted This can often be done by a simple appraisal of the facts and an appeal...
Ngày tải lên: 23/03/2014, 23:21
A Software Testing Primer pdf
... Physical organisation of software (media, manuals, etc.) Data storage and elements Operating system, hardware platform Any modifiable configuration elements and their values Each use case scenario ... there are a number of software vendors who claim to be able to just this! They offer automated tools which take a test case, automate it and run it against a software target repeatedly...
Ngày tải lên: 27/06/2014, 20:20
Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx
... 5'aattTAATACGACTCACTATAGGcccggatagctcagtcgg 3' and 5'cgcccgaacagggacttgaaccctgg accctcagattaaaagtctgatgctctaccgactgagctatccgggc 3' (tRNALys,3); 5' aattTAATACGACTCACTATAGGcctcgttagcgcagtagg 3' and ... tgccccgtgtgaggatcgaactcacg accttcagattatgagactgacgcgctacctactgcgctaacgagg (tRNAMet(e)); 5' aattTAATACGACTCACTATAGGagcagagtggcgcagcgg 3' and 5' tagcagaggatggtttcgatccatcg acctctgggttatgggccc...
Ngày tải lên: 13/08/2014, 09:20
A Semantic Web Primer - Chapter 0 docx
... Zahir Tari, editors, 200 0 Workflow Management: Models, Methods, and Systems Wil van der Aalst and Kees Max van Hee, 200 2 A Semantic Web Primer Grigoris Antoniou and Frank van Harmelen, 200 4 TLFeBOOK ... the Web has changed all that Databases today are made available, in some form, on the Web where users, application programs, and uses are open-ended and ever changing In such a...
Ngày tải lên: 14/08/2014, 11:20
A Semantic Web Primer - Chapter 1 potx
... information: data about data Metadata capture part of the meaning of data, thus the term semantic in Semantic Web In our example scenarios in section 1. 2 there seemed to be no barriers in the access ... government has established the DARPA Agent Markup Language (DAML) Project, and the Semantic Web is among the key action lines of the European Union’s Sixth Framework Programme 1....
Ngày tải lên: 14/08/2014, 11:20
A Semantic Web Primer - Chapter 2 pot
... of an e-mail to contain exactly one text and a number of attachments Modify the schema to allow for an arbitrary number of texts and attachments in any order 2. 2 Search the Web for XML applications, ... data and metadata from one XML representation to another makes it a most valuable tool for XML-based applications Generally XSLT is chosen when applications that use different DTDs or...
Ngày tải lên: 14/08/2014, 11:20
A Semantic Web Primer - Chapter 3 doc
... superclasses; all instances of a class are instances of its superclass Note that a class may be a subclass of more than one class As an example, the class femaleProfessor may be a subclass of ... machineaccessible, in accordance with the Semantic Web vision In this chapter, sections 3. 2 and 3. 3 discuss RDF: the basic ideas of RDF and its XML-based syntax, and sections 3. 4 a...
Ngày tải lên: 14/08/2014, 11:20
A Semantic Web Primer - Chapter 4 pptx
... necessary to declare owl:Class as a subclass of rdfs:Class TLFeBOOK TLFeBOOK Exercises and Projects 149 4. 10 In chapter we presented an axiomatic semantics for RDF A similar axiomatic semantics can ... value, or part of the built-in vocabulary, and not more than one of these This means that, for example, a class cannot at the same time be an individual, or that a property cannot h...
Ngày tải lên: 14/08/2014, 11:20
A Semantic Web Primer - Chapter 5 ppt
... Bn 5. 3.2 Facts A fact is an atomic formula, such as loyalCustomer (a3 456 78); it says that the customer with ID a3 456 78 is loyal The variables of a fact are implicitly universally quantified 5. 3.3 ... Carlos’s requirements and the available apartments, we see that • flat a1 is not acceptable because it has one bedroom only (rule r2 ) • flats a4 and a6 are unacceptable because pets...
Ngày tải lên: 14/08/2014, 11:20
A Semantic Web Primer - Chapter 6 ppsx
... the semantics of the data 6. 3.3 The Contribution of Semantic Web Technology Using ontologies as semantic data models can rationalize disparate data sources into one body of information By creating ... 6. 4 6. 6 e-Learning 6. 6.1 Browsing ontologically organized papers in Spectacle The Setting The World Wide Web is currently changing many areas of human activity, among them learni...
Ngày tải lên: 14/08/2014, 11:20