a digital electronics primer

... support a larger digital system PREFACE xvii Chapter 15, “Analog Interfaces for Digital Systems,” covers the basics of analog-to -digital and digital- to-analog conversion techniques Many digital systems ... necessary to understand certain fundamental topics in circuit analysis so that digital circuits can be made to behave in the intended binary manner Part addresses many essential analog topics that ... modeled by algebraic equations Rather than using arithmetic operations such as addition and subtraction, Boolean algebra employs logical operations including AND, OR, and NOT Boolean variables have...

Ngày tải lên: 05/04/2014, 22:57

... 1–4 Adding unwanted electrostatic noise to (a) an analog waveform and (b) a digital waveform Another application of digital representations of analog quantities is data logging of alternative ... changes Voltage Voltage Waveform ON or OFF Time Time (a) (b) 11 12 10 (c) (d) Figure 1–1 Analog versus digital: (a) analog waveform; (b) digital waveform; (c) analog watch; (d) digital watch analog ... information to a digital format A digital value is represented by a combination of ON and OFF voltage levels that are written as a string of 1s and 0s For example, an analog thermometer that registers...

Ngày tải lên: 09/03/2016, 08:09

... using a National Instruments DAQ board to interact with the real world through LabVIEW digital I/O, analog out, analog in, and serial VIs Labs 2, 5, and 12 are application oriented and are designed ... Gates Application: Data Selector Another simple application of basic gates is the data selector, in which a single digital input selects one of two digital streams: Figure 1-10 A Digital Data ... in above programs) Fundamentals of Digital Electronics 6-6 © National Instruments Corporation Lab Digital- to-Analog Converter The digital- to-analog converter, known as the D /A converter (read as...

Ngày tải lên: 19/10/2013, 11:15

... digital dashboards Explain how to integrate Web content and connect to business data within a digital dashboard Explain how to personalize and customize a digital dashboard Explain how to enable ... dashboard A digital dashboard is a Web page or a series of Web pages, running inside Outlook 2000, that consolidate personal, team, corporate, and external information A digital dashboard can be as ... Digital Dashboard Capabilities of Digital Dashboards Slide Objective To list the capabilities of digital dashboards Lead-in Digital dashboards offer access to any information source, integration...

Ngày tải lên: 10/12/2013, 16:15

... using a National Instruments DAQ board to interact with the real world through LabVIEW digital I/O, analog out, analog in, and serial VIs Labs 2, 5, and 12 are application oriented and are designed ... Gates Application: Data Selector Another simple application of basic gates is the data selector, in which a single digital input selects one of two digital streams: Figure 1-10 A Digital Data ... in above programs) Fundamentals of Digital Electronics 6-6 © National Instruments Corporation Lab Digital- to-Analog Converter The digital- to-analog converter, known as the D /A converter (read as...

Ngày tải lên: 13/12/2013, 01:15

... gate) behaves the same as a NAND gate, and an AND gate with all inputs inverted (a Negative-AND gate) behaves the same as a NOR gate DeMorgan's theorems state the same equivalence in "backward" form: ... variable has a complement: the opposite of its value For example, if variable "A" has a value of 0, then the complement of A has a value of l Boolean notation uses a bar above the variable character ... must be Just as there are four Boolean additive identities (A+ O, A+ 1, A+ A, and A+ A'), so there are also four multiplicative identities: AxO, Axl, AxA, and AxA' Of these, the first two are no different...

Ngày tải lên: 30/12/2013, 22:32

... Lead Color Voltage Reading Lead Color Voltage Reading Lead Color Voltage Reading Lead Color Voltage Reading Lead Color Voltage Reading Lead Color Voltage Reading Lead Color Voltage Reading Lead ... Voltage Reading Lead Color Voltage Reading 10 Lead Color Voltage Reading 11 Lead Color Voltage Reading 12 Lead Color Voltage Reading 13 Lead Color Voltage Reading 14 Lead Color Voltage Reading ... Reading 15 Lead Color Voltage Reading 16 Lead Color Voltage Reading 17 Lead Color Voltage Reading 18 Lead Color Voltage Reading 19 Lead Color Voltage Reading 20 Lead Color Voltage Reading Step...

Ngày tải lên: 24/01/2014, 19:20

... trị thay đổi theo bước rời rạc Analog == Tương tự Digital == Rời rạc (step by step) Tín hiệu analog digital Tín hiệu analog Tín hiệu digital Ví dụ 1.1 Những đại lượng sau analog hay digital? Công ... theo ba bước sau: Biến đổi tín hiệu analog ngõ vào thành tín hiệu số (analog-to -digital converter, ADC) Xử lý thông tin số Biến đổi tín hiệu digital ngõ thành tín hiệu analog (digital- to-analog ... lưu trữ đ a CD Trong trình playback, máy CD nhận thông tin số từ đ a CD biến đổi thành tín hiệu analog, sau khuếch đại đ a 13 loa L a chọn digital & analog Hệ thống số phải thêm vào ADC DAC (phức...

Ngày tải lên: 25/01/2014, 12:20

... using a National Instruments DAQ board to interact with the real world through LabVIEW digital I/O, analog out, analog in, and serial VIs Labs 2, 5, and 12 are application oriented and are designed ... Gates Application: Data Selector Another simple application of basic gates is the data selector, in which a single digital input selects one of two digital streams: Figure 1-10 A Digital Data ... in above programs) Fundamentals of Digital Electronics 6-6 © National Instruments Corporation Lab Digital- to-Analog Converter The digital- to-analog converter, known as the D /A converter (read as...

Ngày tải lên: 25/01/2014, 13:20

... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average efficiency ± SD Template Optimal PCR conditions Cocktail PCR conditions ... Primer sequence 5¢-Forward-3¢ 5¢-Reverse-3¢ CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA...

Ngày tải lên: 14/02/2014, 19:20

... environmental rationality against trade rationality, human rights rationality against the rationality of diplomatic intercourse Thus described, fragmentation of international law would articulate a rather ... Michael F Brown, Who Owns Native Culture?, Cambridge, MA: Harvard University Press, 2004, at p 107 25 Beatriz Caiuby Labate and Wladimyr Sena Araujo, O Uso Ritual da Ayahuasca, Campinas: Mercado ... accident that the parties to this contract were a record company and a representative of Afghanistan, at that time a constitutional monarchy This contract nationalized tradition: it was not an...

Ngày tải lên: 07/03/2014, 11:20

... the great amounts of American capital transferred abroad by the marriage of wealthy American women with titled foreigners Such alliances mean not only the transfer of large amounts of capital en ... afterward There used to be a saying among exchange dealers that cotton exports make exchange faster than anything, but nowadays bond sales abroad have come to take first place For foreign participation ... such a privilege, and the only way he can get actual possession of the goods is to actually pay the draft under a rebate-of-interest arrangement All bills drawn on banks are naturally "acceptance"...

Ngày tải lên: 15/03/2014, 00:20

... download from www.hsrcpress.ac.za gradual In addition, indigenised languages from the Malayo-Polynesian (Malagasy) and Indo-European (Afrikaans) families are also found in Africa In many areas, ... in savanna regions such as the Sahel Over the vast distances where languages such as Arabic, the Berber languages (including Tamazight and Tamasheq), Fula and Swahili are spoken, dialectal and ... detail and with more currency than earlier mapping of African languages The African Academy of Languages (ACALAN) recently launched such a project (Alexander 2008; Afrik.com 2008) and there have...

Ngày tải lên: 15/03/2014, 02:20

... innovative distribution systems that attract large audiences and earn money Machinima animations a filmmaking technique that uses computer game action sequences, shot with in-game cameras and then ... Croatia, free software programmers in the Netherlands, South Korean judges, Italian law professors, South African musicians, Malaysian citizenjournalists, Bulgarian filmmakers, and Taiwanese songwriters ... scholars and tech activists was becoming alarmed by the antisocial, anti-democratic tendencies of copyright law and digital technology Scholars such as Lawrence Lessig, James Boyle, and Hal Abelson...

Ngày tải lên: 22/03/2014, 22:20

... Auckland Bangkok Bombay Calcutta Cape Town Dar es Salaam Delhi Florence Hong Kong Istanbul Karachi Kuala Lumpur Madras Madrid Melbourne Mexico City Nairobi Paris Singapore Taipei Tokyo Toronto and ... underwater hazard, a bluff reef, just ahead Bixby, however, declares that Twain has made a mistake and that he should resume the original course Twain answers: "But I saw it It was as bluff as that one ... realms of law and media as distinct and independent, each having an impact on behavior and attitudes but having little influence on each other As Peter Martin has observed, "law and lawyers are...

Ngày tải lên: 23/03/2014, 06:20

... Implementation Launch TOTAL Start 01-Jan 13-Jan 3-Feb 24-Feb 17-Mar 7-Apr 21-Apr 28-Apr Finish 10-Jan 24-Jan 14-Feb 7-Mar 28-Mar 11-Apr 25-Apr 28-Apr Duration days 10 days 10 days 10 days 10 days days ... standards a project manager establishes the basis for negotiations and the tone in which they are conducted This can often be done by a simple appraisal of the facts and an appeal for assistance ... graphical and textual elements seems right to you Sales Product list Customer details Invoice details CRM Database Invoice details Customer Finance Database Product status update A Project Management...

Ngày tải lên: 23/03/2014, 23:21

... Telecommunications 1 Page 8/13/13 What is the Digital Electronics •  Advantages of Digital Electronics + Digital systems are generally easier to design + Information storage is easy + Precision is greater ... Operation can be programmed + Digital circuits are less affected by noise + More digital circuitry can be fabricated on IC chips •  Limitations - Real world is mainly analog, so ADC and DAC are ... 8/13/13 What is the Digital Electronics   Analog signal and Analog system Analog  Continuous Dr Le Dung - School of Electronics and Telecommunications Page What is the Digital Electronics ...

Ngày tải lên: 28/03/2014, 00:39