... Issues Business at its Best: Driving Sustainable Value Creation Sustainable Value Creation: What's different? Is Sustainable Value Creation simply the pursuit of profit under a different name? What’s ... that’s what I think is so exciting about it.” Business at its Best: Driving Sustainable Value Creation Business at its Best: Driving Sust...
Ngày tải lên: 23/03/2014, 02:20
... ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGT...
Ngày tải lên: 18/02/2014, 06:20
Báo cáo khoa học: Auto-methylation of the mouse DNA-(cytosine C5)-methyltransferase Dnmt3a at its active site cysteine residue pot
... between the enzyme and the substrate base The formation of the cysteine cytosine bond increases the negative charge density at the C5 atom of the cytosine, which then attacks the methyl group bound ... orange, Dnmt3a colored by atom type The distance between the sulfhydryl atom of the catalytic cysteine side chain and sulfur ˚ atom of AdoHcy (7.66 A) is in...
Ngày tải lên: 14/03/2014, 23:20
The digital company 2013 Freedom to collaborate - A report from the Economist Intelligence Unit Sponsored by: AT&T, Nokia, PricewaterhouseCoopers, SAP pptx
... The digital company 2013 Freedom to collaborate © Economist Intelligence Unit 2008 About the research T he digital company 2013: Freedom to collaborate is the second of two Economist Intelligence ... Media, a UK telecoms and media company, says that the ratio of desktops to laptops in the company is already about 65% to 35% “Knowledge worker...
Ngày tải lên: 23/03/2014, 02:20
THE THIRTEENTH CENTURY.—THE MANOR AT ITS ZENITH, WITH SEEDS OF DECAY ALREADY VISIBLE.—WALTER OF HENLEY pdf
... part of the high ridges, into which the land was thrown for purposes of drainage, was cultivated, the lower parts being left to natural grass [79] The greatest authority for the farming of the thirteenth ... fact that the later writer agreed with the earlier as to the superiority of oxen 'A plough of oxen', says Walter, 'will go as far in the year as a plough...
Ngày tải lên: 29/06/2014, 15:20
Báo cáo lâm nghiệp: "Nutrition of silver fir (Abies alba Mill) growing at the upper limit of its occurrence in the Šumava National Park and Protected Landscape Area" pot
... The natural range of silver fir is discontinuous It grows in the mountains of Southern Europe, from the Pyrenees to the Balkans The main centres of the range are situated in Central ... Pinto et al (2008) The paper presents the results of the nutrient balance and content of the stress elements in the current year needles of fir taken in 2006...
Ngày tải lên: 07/08/2014, 10:21
246. America Remembers Its Space Travelers at Astronaut Hall of Fame pot
... three space shuttle trips His first space trip carried the European-built Spacelab and the first international shuttle crew He also served on the committee that investigated the space shuttle Challenger ... shuttle Challenger explosion in nineteen eighty-six Sixty-three space explorers are honored at the United States Astronaut Hall of Fame They include Neil Armstrong, John...
Ngày tải lên: 14/08/2014, 21:21
Construction engineering students' evaluation of the esp programme at vinh university
... What are the learners’ evaluative comments on the ESP programme for Construction at Vinh University? 2) What are the learners’ needs for learning ESP at Vinh University? 3) How should the ESP programme ... issues in programme evaluation as follows: • What is the purpose of the evaluation? • Who is the audience for the evaluation? • What principles...
Ngày tải lên: 07/11/2012, 14:54
a study on the problems in teaching english speaking skills to the minority students at sonla ethnic boarding high school and so
... Minority students at Son La Ethnic Boarding High School and some Suggested Solutions with the hope to make a small contribution to the quality of teaching and learning speaking skills at Son La Ethnic ... transactional and interpersonal skills Skills in talking short and long speaking in turns Skills in the management of interactions...
Ngày tải lên: 07/09/2013, 13:06