... [8] In the present study, we examined the nutritive value and potential risk of using wastewater of Hanoi City for agricultural cultivation Materials and methods 2.1 Study site ten inner city ... by using wastewater and river water for irrigation (kg ha-1) Two horizontal lines show the nutrition demand for N, P, K of rice and maize H and L indicat...
Ngày tải lên: 22/03/2014, 12:20
... History of planning Urbanization Urban planning Regional planning Spatial planning Relationship between socioeconomic planning and spatial planning Strategic planning Urban Design Planning of Rural ... the results of the needs analysis which lays the foundation for designing an ESP reading syllabus for the second- year students at the...
Ngày tải lên: 29/01/2014, 14:39
Báo cáo y học: "Effect of Acute Administration of an Herbal Preparation on Blood Pressure and Heart Rate in Humans"
... p-synephrine and bitter orange extract will likewise result in increases in heart rate and blood pressure [8-11] The purpose of this study was to determine the effects of the acute administration ... administration of a product containing caffeine from guarana, p-synephrine from C aurantium and a green tea polyphenolic extract on heart rate and blood p...
Ngày tải lên: 25/10/2012, 11:10
Báo cáo y học: "Different effect of exercise on left ventricular diastolic time and interventricular dyssynchrony in heart failure patients with and without left bundle branch block"
... mechanical ventricular dyssynchrony in heart failure patients with normal QRS duration By characterizing mechanical interventricular dyssynchrony, which was commonly found to be associated with intra-LV ... Furthermore, exercise LV dyssynchrony may play a more important role in the pathophysiology of left ventricular remodelling than baseline LV dyssynchrony (...
Ngày tải lên: 05/11/2012, 11:32
Tài liệu Báo cáo khoa học: Role of receptor-mediated endocytosis, endosomal acidification and cathepsin D in cholera toxin cytotoxicity pdf
... chloroquine and monensin interfered with the ATP-dependent intraendosomal degradation of internalized radioactive CT [6] Recently, we have identified an endosomal aspartic acid protease, cathepsin D, ... action of cholera toxin and cathepsin D T El Hage et al min) increased two-fold in endosomes isolated from CT-injected rats (closed squares), but this was not observed f...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: "Applications of GPC Rules and Character Structures in Games for Learning Chinese Characters" doc
... pronunciations of hosting characters and (2) teachers compile the games with tools that are supported by sublexical information in Chinese The games aim at implicitly informing players of the Chinese GPC rules, ... to Chinese characters learning: System design and development, Proc of the Int’l Conf on Edutainment, 559–564 C.-Y Lee 2009 The cognitive and neural bas...
Ngày tải lên: 19/02/2014, 19:20
FACING THE REALITY OF DRUG-RESISTANT TUBERCULOSIS: CHALLENGES AND POTENTIAL SOLUTIONS IN INDIA pot
... Facing the Reality of Drug-Resistant Tuberculosis: Challenges and Potential Solutions in India: Summary of a Joint Workshop by the Institute of Medicine, the Indian Nation FACING THE REALITY ... Facing the Reality of Drug-Resistant Tuberculosis: Challenges and Potential Solutions in India: Summary of a Joint Workshop by the Insti...
Ngày tải lên: 05/03/2014, 11:20
RISK OF PULMONARY TUBERCULOSIS ASSOCIATED WITH EXOGENOUS REINFECTION AND ENDOGENOUS REACTIVATION IN A SOUTH INDIAN RURAL POPULATION-A MATHEMATICAL ESTIMATE* doc
... the duration of infected status; Indian Journal of Tuberculosis 1976, Vol 33/1, National Tuberculosis Institute, Bangalore Tuberculosis in a rural population of South India : a five year epidemiological ... secretarial help and Mr B.R Narayana Prasad graphics References Krishnamurthy, VV, Nair, SS, Gothi, GD, a Chakraborty, AK Incidence of Tuberculosis among ne...
Ngày tải lên: 06/03/2014, 04:20
Báo cáo khoa học: Transcript profiling reveals diverse roles of auxin-responsive genes during reproductive development and abiotic stress in rice pdf
... probable role of auxin-responsive genes in reproductive development and abiotic stress signaling in rice Transcript profiling of auxin-responsive genes study from our laboratory, the rice coleoptile ... 2009 FEBS M Jain and J P Khurana Transcript profiling of auxin-responsive genes Fig Expression profiles of auxin-responsive genes in various...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf
... thioredoxins were found In this study we examined the involvement of the peroxiredoxin Bcp2 in oxidative stress in the hyperthermophilic aerobic archaeon Sulfolobus solfataricus Furthermore, ... clarified in detail and could play a key role in the detoxification processes In this study we examined the role of Bcp2 in order to increase the knowledge...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: NMR and molecular dynamics studies of an autoimmune myelin basic protein peptide and its antagonist Structural implications for the MHC II (I-Au)–peptide complex from docking calculations ppt
... various systems comprised 3899 and 4516 SPC molecules for the agonist and the antagonist in water, respectively, and 817 and 927 Me2SO molecules for the agonist and the antagonist, respectively, corresponding ... the binding and affinity for I-Au because of occupation of the P1 pocket Recent thermodynamic and kinetic studies of the binding of TCRs...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Protective effect of dietary curcumin and capsaicin on induced oxidation of low-density lipoprotein, iron-induced hepatotoxicity and carrageenan-induced inflammation in experimental rats ppt
... controls Protective effect of dietary curcumin, capsaicin and their combination on iron -induced LDL oxidation in vivo and copper -induced LDL oxidation in vitro Oxidation of LDL observed in iron(II) ... Manjunatha and K Srinivasan Protective effect of dietary curcumin, capsaicin and their combination on iron -induced LDL oxidation in viv...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Protective effect of active oxygen scavengers on protein degradation and photochemical function in photosystem I submembrane fractions during light stress pdf
... the degradation of each polypeptide and the protein conformation changes are assessed in connection with alterations in photochemical activity during strong light illumination of the PSI submembrane ... Lhca1 and Lhca2 is due to generation of reactive oxygen species during strong light illumination which leads to some alteration in the Chl protein interactio...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: The heterogeneity of mast cell tryptase from human lung and skin Differences in size, charge and substrate affinity ppt
... Heterogeneity of human mast cell tryptase (Eur J Biochem 270) 279 Fig pH prole of human skin and lung tryptase in the presence and absence of heparin (j) skin tryptase, no heparin (h) skin tryptase + ... lysates of puried lung and skin mast cells and have employed lectin binding studies to investigate the nature of glycosylation In addi...
Ngày tải lên: 31/03/2014, 07:20