... Weitz, the product of a decision on our part to extend the concept (Weitz, 1956, 188) According to Weitz, this “openness” of the concept of art is the condition of the possibility of further creativity ... identified with one another A good theory of art, while acknowledging that the concept of art evolves on the basis of decisions made by repres...
Ngày tải lên: 23/03/2014, 13:20
... data and its representation by different α-modulation frames, the concept of joint sparsity (detection of common pattern), and finally on establishing the signal recovery model The aspect of common ... to a mixed form of the wavelet and the Gabor transform, and it also provides some kind of homotopy between both cases Indeed, for α = 0, we are in the clas...
Ngày tải lên: 22/06/2014, 01:20
Journal of retailing and consumer services volume 19 issue 1 2012 modeling the effect of self efficacy on game usage and purchase behavior
... 0.5 po 0.5 po 0.5 R Davis, B Lang / Journal of Retailing and Consumer Services 19 (2 012 ) 67–77 Game, Game, Game, Game, Game, Game, Game, Game, p 29 61. 16 (18 6) Game group X2/DF ratio 65.89 (24) ... coupon-prone consumer: some findings based on purchase behavior across product classes Journal of Marketing 51 (4), 99 11 0 76 R Davis, B Lang / Journal...
Ngày tải lên: 23/06/2014, 15:22
CHAPTER 4: THE CONCEPT OF MEASUREMENT IN THE MARKETING RESEARCH docx
... CONTENTS The concept of measurement; What is measured?; The benefits of the measurement; The laws (rules) of measurement; Measure scales; Three standards of a measurement; Psychological measure; The ... to marketing research WHAT IS MEASURED? Measurement of physical phenomenon Measurement of Social – economic phenomenon Measurement of human psychologica...
Ngày tải lên: 09/07/2014, 17:20
Báo cáo y học: "Egress of HSV-1 capsid requires the interaction of VP26 and a cellular tetraspanin membrane protein" doc
... were against the nucleotides 179 to 208 and 553 to 582 of the CTMP-7 gene respectively: 5'-GGATCCCGCAGGCCAAAGACAACAATAGT GGTGCCAGTCAAGAGCTGGCACCACTATTGTTG TCTTTGGCCTGtcgtcagctcgtgccgtaag TGAAACTAGTTACCAGATCATAACAACCCTCA ... conceived of the study, and participated in its design and coordination, QL and LL revised the manuscript LW and LL participated in the design of...
Ngày tải lên: 12/08/2014, 04:20
Mencius and xunzi on moral agency and the concept of neng
... More on Mencian Si and Tui 140 6.1 Introduction 6.2 The Importance of the Environment in Mencian Thought 6.3 More on the Concept of Si 6.4 Nivison on the Concept of “Tui” 6.5 Im on the Concept of ... CHAPTER 2: Mencius: Motivation and Agency 2.1 Introduction 2.2 Van Norden on Mencian Moral Agency 2.3 Moral Desires and Proper Motivation 2.4 The...
Ngày tải lên: 26/11/2015, 10:49
The effects of planning with writing on the fluency, complexity, and accuracy of l2 oral narratives
... difference between the effects of planning with writing and those of the other planning conditions like rehearsal and reading on the fluency, complexity, and accuracy of oral narratives The present study: ... effects does planning with and without writing have on the complexity of an L2 oral narrative? 53 RQ 3: What effects does...
Ngày tải lên: 12/05/2016, 16:06
EXPLORING SOCIAL MARKETING POLICIES THE USE OF POSITIVE AND NEGATIVE EMOTIONAL APPEALS IN HEALTH ADVERTISING IN FOUR EUROPEAN COUNTRIES
... negative appeals in social marketing in a longitudinal overview, characterising their form and the context where they are used The thesis examines whether the use of positive and negative appeals ... Classify Social Advertisements According to their Use of Positive and Negative Appeals Paper - The Use of Positive Appeals in Social Mar...
Ngày tải lên: 19/12/2016, 12:10
The Conduct of Monetary Policy: Strategy and Tactics
... The Price Stability Goal and the Nominal Anchor • Over the past few decades, policy makers throughout the world have become increasingly aware of the social and economic costs of inflation and ... All rights reserved Other Goals of Monetary Policy • Five other goals are continually mentioned by central bank officials when they discuss the objectives of monetary...
Ngày tải lên: 15/11/2013, 20:27
GRIND MARKETING By The founders of SPATE MAGAZINE ppt
... business and marketing career Make sure you visit our websites regularly www.SPATEMAG.com www.SPATETV.com www.Blogtalkradio.com /SPATE 7 |Grind Marketing SPATE Communications Copyright 2009 GRIND MARKETING ... Grind Marketing? How to market products online -4 Make people love you -6 (Grind marketing website coming soon) www.SPATEMAG.com www.SPATETV.com www.Blogtalkradio.com...
Ngày tải lên: 06/03/2014, 14:21
Ave Roma Immortalis, Vol. 1 Studies from the Chronicles of Rome doc
... to describe the growth of Rome from the early Kings to Augustus, than to account for the change from the Rome of the Empire at the beginning of our era to the Rome of the Popes in the year eight ... supporting the Channels of the Aqueduct of Claudius and the Anio Novus 14 5 Interior of the Colosseum 15 2 Region II Trevi, Device of 15 5 Gr...
Ngày tải lên: 08/03/2014, 12:20
Marketing in the Age of Google : Your Online Strategy IS Your Business Strategy
... way in which we navigate the Web, the home page of a site may not be the entry point for 10 MARKETING IN THE AGE OF GOOGLE a visitor Any page can be the entry page, which makes it increasingly ... percent of marketing spend in 2004 and 14 MARKETING IN THE AGE OF GOOGLE 10 percent of marketing spend in 2008 at $1.3 billion27) Chances are, your...
Ngày tải lên: 17/03/2014, 21:33
Báo cáo Y học: Interaction of the GTS1 gene product with glyceraldehyde3-phosphate dehydrogenase 1 required for the maintenance of the metabolic oscillations of the yeast Saccharomyces cerevisiae pdf
... previously [14 ,16 ] GTS1[ DKN] and GTS1[ C5 3Y] inserted into pAUR 112 were transformed into gts1D and the transformants were named pACGTS1 [DKN]/gts1D and pACGTS1[C5 3Y] /gts1D, respectively The yeast ... and GTS1 and TDH mutants Strain Cell density (· 10 )8ÆmL )1) a Wild-type gts1D pACGTS1[N-C]/gts1D pACGTS1[DKN]/gts1D pACGTS1[C5 3Y] /gts1D tdh1D tdh2D tdh3D pACTDH1/tdh1D pACTDH...
Ngày tải lên: 31/03/2014, 21:21
Báo cáo toán học: "How to include organ interactions in models of the root system architecture? The concept of endogenous environment " potx
... that of their mother root The global response was essentially local, since only the laterals close to the tip of the mother root responded In the second example [7], the growing medium of the root ... In order to improve the architectural models of the root system, and to enlarge their scope of interest, a next step in their development would...
Ngày tải lên: 08/08/2014, 14:22
Báo cáo y học: "The concept of “compartment allergy": prilocaine injected into different skin layers" pdf
... Cite this article as: Wobser et al.: The concept of “compartment allergy": prilocaine injected into different skin layers Allergy, Asthma & Clinical Immunology 2011 7:7 Abbreviations (LA): Local ... inflammatory reactions after 1-4 days were provoked by superficial subcutaneous injection of prilocaine (Figure 1a), so that diagnosis of delayed-type allergy against pr...
Ngày tải lên: 08/08/2014, 21:20