A novel sufficient schedulability analysis for for floating defer preemption

... the operation for this inverter have proved its feasibility for dc-ac conversion in wind turbine applications ACKNOWLEDGMENT The authors wish to thank Natural Sciences and Engineering Research Council ... possibility for a low cost and high efficiency dc-ac converter appropriate for small wind turbine applications The inverter has a low component count with only power...

Ngày tải lên: 03/01/2014, 19:16

... T thermophilus E coli A pernix 277 277 283 TSIPGVYACGDIVTYPGKLPLIVLGFGEAAIAANHAAAYAN-PALKVNPGHSSEKAAPGT TSIPGVFAAGDVMDHI YRQAITSAGTGCMAALDAERYLD GLADAK TSIPGIFAAGDCTSMWPGFRQVVTAAAMGAVAAYSAYTYLQEKGLYKPKPLTGLK ... (Osaka, Japan) Emulgen 911 was a gift from Kao Chemical (Tokyo, Japan) NADPH, NADH and NADP+ were purchased from Oriental Yeast (Tokyo, Japan) a- Cyano-4-hydroxycinnamic ac...

Ngày tải lên: 18/02/2014, 08:20

... Biotin-TCGACTAGAAGCTTCTAGAAGCTTCTAG AGCTGATCTTCGAAGATCTTCGAAGAT Biotin-TCGACTTCAAGCTTGTACAAGCTTGTAG AGCTGAAGTTCGAACATGTTCGAACATC Biotin-AACGACGGTCGCTCCGCCTGGCT nM Unlabeled HSE DNA-binding activity ... confirm that the assay specifically measures HSF1 DNA-binding activity Analytical range and precision The analytical range of the assay was evaluated using known concentrations of recombi...

Ngày tải lên: 18/02/2014, 14:20

... user input without WBMs, xt be the best word spacing state for ot where ≤ t ≤ n Assume that xt is either (space after ot ) or (no space after ot ) Then each best word spacing state xt for all t ... Nakagawa 2004 Chinese and Japanese word segmentation using word- level and character-level information In COLING ’04, page 466, Morristown, NJ, USA Association for Computational Ling...

Ngày tải lên: 17/03/2014, 02:20

... uniform and non-uniform arrangements In ref [20], different types of array structures for smart antennas (ULA, UCA and Uniform Rectangular Array (URA)), AOA estimation and beamforming performance ... sub-arrays affects the performance of this array Therefore, the PA is an appropriate and simple geometry for AOA estimation and can modify the performance of the conventional ULA in AO...

Ngày tải lên: 21/06/2014, 01:20

... under microwaves irradiation Appl Catal, A 2009, 371(1-2):22-30 Subrahmanyam KS, Panchakarla LS, Govindaraj A, Rao CNR: Simple Method of Preparing Graphene Flakes by an Arc-Discharge Method J Phys ... both methods are used to analyze the Raman data The ID/IG ratio obtained using both peak height and integrated intensity methods are plotted in Figure 7a for the six samples A statis...

Ngày tải lên: 21/06/2014, 06:20

... or capturing the same scene at approximately the same camera orientation A security goal of each node in a cluster is to send partial visual information, which we call shares to a base station ... practicality Finally, we note that our paradigm is geared towards visual data, or any kind of data whose semantics are not destroyed by small perturbations The inherent redundant nature...

Ngày tải lên: 22/06/2014, 23:20

... Residential area TV TV TV PC Residential area n Figure 1: A larger-scale VOD system supported by parallel video servers video- data streams during a short time interval It wastes the server bandwidth and ... the Medusa scheme is approximately 280 Mbits/s At the same request-arrival rate, the average bandwidth consumption of the FCFS batching is Medusa: A Novel Stream-Schedul...

Ngày tải lên: 23/06/2014, 01:20

... study were available for analysis for this study At 28 days, 2.3% of patients had circulatory failure, 13.7% had renal failure, 8.7% had respiratory failure, and 27.2% had died, for an overall ... REDOXS study Statistical Analysis Baseline patient characteristics were compared by POD and survival status at Day 28 Among 28-day survivors, outcomes including Delta SOFA score (maximal SOFAb...

Ngày tải lên: 14/08/2014, 08:21

... experiments and data analysis and drafted the manuscript PVV and ADW performed miRNA profiling experiments DM and FW are responsible for MYCN ChIP-on-chip data FS and JV conceived the study and participated ... This was the case for RNU44, U47 and U75 on 1q25, and RNU58A and RNU58B on 18q21, of which RNU44 and RNU58A were randomly retained for further analysis Na...

Ngày tải lên: 14/08/2014, 21:20

... 2.3.1 Fabrication and characterization of PET film grafted with poly-acrylic acid 49 2.3.2 Fabrication and characterization of bioactive substrata 51 2.3.3 Enhancement of hepatocyte attachment ... LIST OF SYMBOLS 3-MC 3-methylcholanthrene AHG 1-O-(6’-aminohexyl)-D-galactopyranoside AMC Academic Medical Center ALF Acute liver failure ALT Alanine Transaminase APAP Acetaminophen AS...

Ngày tải lên: 12/09/2015, 08:19

... initialize pheromone trail matrix and m ants; while (stop conditions not satisfied) for each a ∈ A Ant a build a multiple graph alignment; Local search// run only at the second stage Search by changing ... initializing parameters and m artificial ants (agents) ACO-MGA2 repeatedly perform two stages as in Algorithm The first stage (applied for the first 70% of iterations)...

Ngày tải lên: 14/10/2015, 15:23

... evolutional rate of EV71, new subgenogroups have been constantly identified The subgenogroup B3 strain was the main causative agent in the epidemics of Sarawak and Peninsular Malaysia in 1997 (Cardosa, ... sequenced a fragment of 207-bp length of the VP4 region from 23 Taiwanese EV 71 isolates and together with another 21 strains from GenBank, they separated the 44...

Ngày tải lên: 16/10/2015, 15:39

... studied separately for more than fifty years In recent decades, a joint consideration of beamforming and cyclostationarity (i.e., beamforming for cyclostationary signals) attracted certain attention ... data j j length for Rq estimation If yq [n] is a stationary and ergodic process, the sample average equals time average, and the sample covariance matrix estimator leads t...

Ngày tải lên: 22/06/2014, 19:20

... and network- based analysis reveals a novel role for hsa-mir-9 and drug control over the p38 network in Glioblastoma Multiforme progression Rotem Ben-Hamo1 and Sol Efroni1,* The Mina and Everard ... over pathway behavior and may serve as a potential therapeutic target for Glioblastoma patients Drug target analysis Over the past 25...

Ngày tải lên: 11/08/2014, 12:21